|

- 积分
- 0
- 威望
- 0
- 包包
- 0
|

作者:Huda Ismail Abdullah, Paulina L. Pedraza, Shoujin Hao, Karin D. Rodland, John C. McGiff, and Nicholas R. Ferreri作者单位:1 Department of Pharmacology, New York Medical College, Valhalla, New York; and 2 Biological Sciences Division, Pacific Northwest National Laboratory, Richland, Washington
8 W) p! J% Z' x4 j8 ^ & K7 `0 S0 _" o# B f9 U/ C+ G" ~
/ T8 T' h7 ^9 k0 M" A. f
. H3 q5 G* O1 K9 h4 p" g
+ a" Y: w C' a7 \
: d: z$ M3 \# N% C9 e ' t& J& d& {2 a0 f3 t( }* M3 Q
% K* W) u7 C. c- j( i 2 X0 \9 J M" G: p( |
, {* ?2 U3 K( E O. Q
: h1 P; w( z+ S$ g7 n+ c
1 A, c, C& W& B5 C7 ]6 L + H' E/ {# a1 s' U9 D: w3 C3 o1 ?
【摘要】" l0 n7 n. K- J* v6 A
Because nuclear factor of activated T cells (NFAT) has been implicated in TNF production as well as osmoregulation and salt and water homeostasis, we addressed whether calcium-sensing receptor (CaR)-mediated TNF production in medullary thick ascending limb (mTAL) cells was NFAT dependent. TNF production in response to addition of extracellular Ca 2 (1.2 mM) was abolished in mTAL cells transiently transfected with a dominant-negative CaR construct (R796W) or pretreated with the phosphatidylinositol phospholipase C (PI-PLC) inhibitor U-73122. Cyclosporine A (CsA), an inhibitor of the serine/threonine phosphatase calcineurin, and a peptide ligand, VIVIT, that selectively inhibits calcineurin-NFAT signaling, also prevented CaR-mediated TNF production. Increases in calcineurin activity in cells challenged with Ca 2 were inhibited after pretreatment with U-73122 and CsA, suggesting that CaR activation increases calcineurin activity in a PI-PLC-dependent manner. Moreover, U-73122, CsA, and VIVIT inhibited CaR-dependent activity of an NFAT construct that drives expression of firefly luciferase in transiently transfected mTAL cells. Collectively, these data verify the role of calcineurin and NFAT in CaR-mediated TNF production by mTAL cells. Activation of the CaR also increased the binding of NFAT to a consensus oligonucleotide, an effect that was blocked by U-73122 and CsA, suggesting that a calcineurin- and NFAT-dependent pathway increases TNF production in mTAL cells. This mechanism likely regulates TNF gene transcription as U-73122, CsA, and VIVIT blocked CaR-dependent activity of a TNF promoter construct. Elucidating CaR-mediated signaling pathways that regulate TNF production in the mTAL will be crucial to understanding mechanisms that regulate extracellular fluid volume and salt balance.
0 L4 h, X7 V! M8 j2 B' A 【关键词】 tumor necrosis factor calciumsensing receptor loop of Henle cyclosporine A
5 J9 `: q8 D! m- E BROAD DISTRIBUTION OF THE calcium-sensing receptor (CaR) supports the concept that calcium, acting as a hormone, has direct effects on the function of many cell types ( 27 ). The CaR is expressed on basolateral membranes in the thick ascending limb (TAL) of the kidney, and functional expression of the receptor is retained in primary cultures of medullary TAL (mTAL) cells ( 43, 44, 60, 62 ). Although TNF is often studied as a cytokine induced under pathophysiological conditions, our studies indicate that TNF also acts as a physiological regulator of tubular function. We have identified several pathways, including CaR activation, that lead to production of this cytokine in the mTAL ( 17, 38, 62 ). For instance, ANG II induces TNF production. Furthermore, exogenous TNF inhibited ouabain-sensitive 86 Rb uptake (an in vitro correlate of natriuresis) in the mTAL via a prostaglandin-dependent mechanism ( 14, 17 ). Similarly, COX-2-dependent PGE 2 synthesis induced by CaR activation is, in part, mediated by TNF. Under high-salt conditions, PGE 2 plays a role in regulating ion transport by inhibiting the apical Na -K -2Cl - cotransporter and K channel in the mTAL, and the basolateral Na pump in other nephron segments. The long-term regulation of ion transport in cultured mTAL cells induced by TNF is COX-2/PGE 2 dependent and consistent with the in vivo actions of PGE 2 regarding the regulation of extracellular fluid volume via an increase in salt and water excretion.
# x1 R3 W' L8 X' S- x, |
. \8 p( n, X: |9 x$ s nThe Ca 2 /calmodulin-dependent activation of calcineurin and contribution of nuclear factor of activated T cells (NFAT) to TNF production in response to activation of the T cell antigen receptor suggested that CaR activation may increase TNF production in mTAL cells by a similar mechanism. An NFAT homology region of 300 amino acids located NH 2 terminal to the DNA-binding domain defines a calcineurin-activated regulatory domain that binds calcineurin, is dephosphorylated when calcineurin is activated, and controls calcineurin-dependent nuclear translocation of NFAT ( 42 ). The Ca 2 , calcineurin/NFAT signaling pathway is operational in various cell types with different outcomes, but increases in intracellular Ca 2 is a common, obligatory step for the activation of this pathway. NFAT has been shown to integrate Ca 2 signals with signals transduced by mitogen-activated protein kinase (MAPK)- and protein kinase C (PKC)-dependent pathways ( 9 ). Accordingly, the NFAT transcription complex requires that Ras/PKC and Ca 2 /calcineurin signaling be coordinated to achieve activation. Thus, in nearly all cell types studied, activation of Rac, Ras, or PKC must accompany a Ca 2 signal for NFAT-dependent transcription to occur ( 9 ). We previously demonstrated that CaR-mediated increases in TNF production were PKC dependent and involved transcription of the TNF gene ( 62 ). Because the CaR is known to activate PKC, and NFAT contributes to TNF production in T cells, we hypothesized that CaR-mediated TNF production in mTAL cells might occur via an NFAT/calcineurin-dependent mechanism. Accordingly, CaR-mediated G q -coupled signaling pathways that increase intracellular Ca 2 and PKC activity ( 3, 32, 39 ) may be part of an amplification cascade that interacts with downstream signals to initiate TNF gene transcription. \2 s& |5 n; M; Z
2 d/ O( w, k+ p! HMATERIALS AND METHODS
H; t, p% j" e0 t6 g/ [# a) v% K2 D$ q# k3 L$ [! y( \
Animals. Male Sprague-Dawley rats (Charles River Lab, Wilmington, MA) weighing 100-110 g were maintained on standard rat chow (Ralston-Purina, Chicago, IL) and given tap water ad libitum. Experimental procedures were conducted in accordance with institutional and international guidelines for the welfare of animals (animal welfare assurance number A3362-01, Office of Laboratory Animal Welfare, PHS, NIH).
) e/ d+ d! A# x! x/ {0 @6 g( R D" L" J
Reagents. Tissue culture media was obtained from Life Technologies (Grand Island, NY). Reagent-grade chemicals and collagenase (type 1A) were from Sigma (St. Louis, MO). Polyvinylidene difluoride (PVDF) membranes were obtained from Amersham (Arlington Heights, IL). Reagents for preparation of the TNF ELISA were purchased from Pharmingen (San Diego, CA). The neutralizing anti-TNF antibody was purchased from R&D Systems (Minneapolis, MN). The luciferase assay kit was from Promega (Madison, WI). The PI-PLC inhibitor U-73122 and inactive analog U-73142 were purchased from Biomol; CsA and VIVIT were purchased from Calbiochem. Preliminary experiments were performed to establish the optimal conditions for each inhibitor with respect to concentration and time.
5 _' E' l- r* }, T, ^
4 ]) ]- A" u3 }+ PIsolation of mTAL cells. The isolation and characterization of mTAL cells ( 95% purity) were performed as previously described ( 7, 14 ). Briefly, male Sprague-Dawley rats were anesthetized with an intraperitoneal injection of pentobarbital sodium (0.65 mg/100 g body wt). The kidneys were perfused with sterile 0.9% saline, via retrograde perfusion of the aorta, and cut along the corticopapillary axis. The inner stripe of the outer medulla was excised, minced with a sterile blade, and incubated for 10 min at 37°C in a 0.1% collagenase solution gassed with 95% oxygen. The suspension was sedimented on ice, mixed with Hanks' balanced salt solution (HBSS) containing 2% BSA, and the supernatant containing the crude suspension of tubules was collected. The collagenase digestion was repeated three times with the remaining undigested tissue. The combined supernatants were centrifuged for 10 min, resuspended in HBSS, and filtered through a 52-µm nylon mesh membrane (Fisher Scientific, Springfield, NJ). The filtrated solution was discarded, and the tubules retained on the mesh were resuspended in HBSS. Then, the solution was centrifuged at 500 rpm for 10 min, supernatant was aspirated, and the cells were cultured in renal epithelial cell basal medium (REBM, Cambrex), containing renal epithelial cell growth medium (REGM, Cambrex) consisting of rhEGF, insulin, hydrocortisone, GA-1000 (gentamycin sulfate and amphotericin B), FBS, epinephrine, T3 (triiodothronine), and transferrin. After 3-4 days, monolayers of cells were 80-90% confluent. The cells were quiesced for 24 h in RPMI containing 0.42 mM CaCl 2 and 0.5% FBS, L -glutamine (2 mM), 100 U/ml streptomycin-penicillin (GIBCO), MEM nonessential amino acids (GIBCO), MEM sodium pyruvate, and -mercaptoethanol before their use. In all experiments, "control conditions" (i.e., no addition of CaCl 2 ) reflect that cells were incubated in media containing 0.42 mM Ca 2 . This amount of calcium should be added to the amounts used to challenge the cells to obtain total extracellular Ca 2 present. These control conditions were selected based on previous work showing that the CaR is functionally insensitive when extracellular Ca 2 concentrations are & D- Y$ A8 l+ ]& w
0 x1 t8 A7 f0 T6 \& G" z. D, T( \5 SMeasurement of TNF. Primary cultured rat mTAL cells were quiesced overnight and then challenged with CaCl 2 for different times at 37°C 5%/CO 2. TNF levels in cell-free supernatants were determined by ELISA (Pharmingen), according to the protocol provided by the manufacturer and as previously described ( 62 ).
8 k; ?4 N4 y& e! l+ s5 k9 e) M5 o8 A! U0 B I
Transient transfection. mTAL cells were cultured to 70-80% confluence and transfected as previously described ( 60 ). Briefly, the medium was removed and cells were placed in 1 ml of serum-free OPTI-MEM medium containing 3-7 µg/well of either plasmid DNA containing a dominant-negative R796W CaR construct ( 39 ) or empty plasmid vector (pcDNA3.1) and 10 µl lipofectamine reagent (Life Technologies) for 4 h at 37°C/5% CO 2. After the transfection period, 1 ml of DMEM/F12 containing 20% FBS was added and the cells were incubated overnight at 37°C/5% CO 2. The medium was then removed, and cells were cultured for an additional 12 h in DMEM/F12 containing 10% FBS. The cells were quiesced overnight in RPMI medium containing 0.5% FBS and then treated with the appropriate reagents for the indicated times; TNF levels in the supernatants were determined by ELISA. Transfection efficiency was evaluated by staining for -galactosidase activity in cells transiently transfected with the pSV- -galactosidase vector. Expression of -galactosidase was visualized by microscopy after incubation with the X-Gal substrate and was 35-40 and 65-70% after addition of 3 and 7 µg of pSV- -galactosidase vector, respectively. Dual transfection with a NFAT binding site, TATA-driven firefly luciferase promoter (2 µg/well; Stratagene), and a control pSV40-driven Renilla luciferase promoter (0.025 µg/well) was performed as described above. Stop and glo solution was used according to manufacturer's directions (Promega). The pGV- 2-TNFprom promoter construct was a generous gift from Dr. A. Nakamura, Teikyo University School of Medicine.
1 x: w5 U4 C0 q" k9 p4 X$ @
) j8 D; A' r. L, S Q7 `Calcineurin activity. Calcineurin activity was determined using a cellular assay kit plus (AK-816) purchased from Biomol according to manufacturer's directions. Briefly, mTAL cells were cultured in REGM and maintained in RPMI as previously described. Cells were pretreated with U-73122, CsA, or VIVIT for 15 min before stimulation with Ca 2 (1.2 mM) for 25 min. Cells were washed twice with cold TBS, lysed with 120 µl/well of lysis buffer, collected into 1.5 ml eppendorf tubes, and incubated at room temperature for 20 min in the presence of a selective phosphopeptide substrate for calcineurin. The reaction was stopped with Biomol GREEN reagent after allowing color to develop for 20 min and the OD 620nm was determined. Both the phosphate standard curve and all samples were assayed in duplicate. The conventional method of reporting calcineurin activity: calcineurin = total phosphatase activity - activity in the presence of EGTA buffer, was used; background phosphate was subtracted from each sample. Protein concentration in the lysates was determined with a Bio-Rad protein assay kit.
/ N9 c5 @( O2 H1 G- ~1 r @' P1 q4 W9 D# D3 X$ T
Preparation of nuclear extracts. Nuclear extracts were prepared by a modification of the method of Dignam et al. ( 11 ). Briefly, mTAL cells were cultured in REGM and maintained in RPMI as above described. Cells were stimulated with Ca 2 for 30 min, washed twice with cold PBS, transferred with RIPA buffer into a 1.5-ml eppendorf tube, and spun for 5 min at 4,000 rpm and 4°C. The cell pellet was lysed in CE buffer [10 mM Tris, pH 8.0, 60 mM KCl, 2 mM MgCl 2, 1 mM DTT, 0.1 mM EDTA, 0.5 mM phenylmethylsulfonyl fluoride (PMSF), 10 µg/ml aprotinin, 25 µM leupeptin, 2 µM pepstatin A, and 0.3% Nonidet P-40 at 4°C and centrifuged for 5 min at 4,000 rpm and 4°C]. The nuclei were kept on ice and washed in 0.5 ml CE buffer without Nonidet P-40 for 5 min at 4,000 rpm. The nuclear proteins were extracted under high-salt conditions in a solution containing 20 mM Tris, pH 7.8, 0.42 M NaCl, 1.5 mM MgCl 2, 0.5 mM DTT, 0.2 mM EDTA, 0.5 mM PMSF, 10 µg of aprotinin per ml, 25 µM leupeptin, 2 µM pepstatin A, and 25% (vol/vol) glycerol for 30 min at 4°C. After centrifugation at 12,000 rpm for 30 min, protein concentration in the supernatant was determined with a Bio-Rad protein assay kit.8 ~7 \8 k O( }7 A( T8 n
7 u! N3 x9 Y# H& A6 W
EMSA. Nuclear proteins (4 µg) were preincubated for 10 min at room temperature in 20 µl of buffer containing 10 mM Tris·HCl (pH 7.5), 10 mM NaCl, 0.5 mM EDTA, 8% Ficoll 400, 1 mM DTT, and 50 ng of poly (dI-dC) per milliliter. Nuclear extracts were preincubated in the absence or presence of 50-fold molar excess of nonlabeled NFAT consensus oligonucleotide (CGCCCAAAGAGGAAAATTTGTTTTCATA). The oligonucleotides were labeled with [ - 32 P]-ATP by a reaction with T4 oligonucleotide kinase (New England Biolaboratories). Radiolabeled oligonucleotides (0.2 to 0.4 ng; 70,000 cpm) were added to the reaction mixture, which was incubated for 30 min at room temperature. The reaction mixture was electrophoresed through a 4% nondenaturating polyacrylamide gel in 0.5 M Tris-borate-EDTA; gels were subsequently dried and subjected to autoradiography with intensifying screens at -70°C.2 u% C. w( w8 f0 V& Z
1 m N2 q" f8 H* x% n# cStatistical analysis. Data were compared by unpaired Student's t -test or by a one-way ANOVA followed by the Newman-Kuels test when multiple comparisons were made. Data are presented as means ± SD; P 0.05 was considered statistically significant., o' m% H* @# V2 v* b& c" j7 O0 C
- i. W$ K: F" ]4 n4 M ^1 u; o; k% G
RESULTS
$ n# ~6 c6 E/ i* G6 Z" `3 r6 N- a1 u. b0 v' x/ u
CaR-mediated activation of G q contributes to TNF production in mTAL cells. Primary cultures of mTAL cells were prepared from male Sprague-Dawley rats (100-110 g) as previously described ( 7, 14 ). Cells were grown in six-well plates and quiesced overnight in RPMI 1640 containing 0.5% FBS and 0.4 mM CaCl 2. Then, cells were washed in RPMI 1640 and challenged at 37°C/5% CO 2 for various times with Ca 2 . The dominant-negative CaR mutant, R796W, has previously been used to inhibit CaR-mediated signaling events ( 25, 39 ). Thus mTAL cells were transiently transfected with 3 or 7 µg of either pcDNA3 (empty vector) or pcDNA3-R796W and challenged with Ca 2 (1.2 mM) for 6 h, based on kinetics for TNF production and concentrations for Ca 2 established in a previous study ( 62 ). CaR-mediated TNF production assessed by ELISA as previously described ( 62 ) was inhibited in a concentration-dependent manner in cells transfected with pcDNA3-R796W suggesting that signaling events initiated by CaR activation contribute to TNF production in these cells ( Fig. 1 ). As CaR-mediated TNF production in mTAL cells is PKC dependent, we determined whether the response to Ca 2 could be blocked by inhibition with U-73122, a selective aminosteroid inhibitor of the PI-PLC pathway ( 64 ). TNF production induced by 1.2 mM Ca 2 was completely inhibited by U-73122 suggesting that the CaR coupled to G q may contribute to this effect ( Fig. 2 ). This inhibitor did not affect basal production of TNF, and the inactive analog U-73142 (500 nM) had no effect on either basal or CaR-mediated TNF production (data not shown). Collectively, these data suggest that CaR-mediated TNF production in mTAL cells requires G q -dependent mechanisms that may converge at a critical downstream pathway.4 k: K3 k- Y1 H) z
" ?' m/ }2 a0 Y+ E: c4 h
Fig. 1. Dominant-negative Ca 2 -sensing receptor (CaR) construct R796W inhibits TNF production. Medullary thick ascending limb (mTAL) cells were transiently transfected with empty vector or R796W, and TNF production was determined by ELISA after challenge with 1.2 mM Ca 2 for 6 h. (Note: for all figures, cells that were not treated with Ca 2 contained 0.42 mM Ca 2 present in the media.)
& f6 Z/ |5 s6 I# o& P+ m* s- q: I( x' G4 w' [" M9 D
Fig. 2. Inhibition of PI-PLC blocks TNF production. Stimulation with 1.2 mM Ca 2 increased TNF production and pretreatment with the PI-PLC inhibitor U-73122 (500 nM) abolished calcium-mediated increases in TNF production; n = 3. Pretreatment with U-73122 did not alter basal TNF production.
# D7 o4 c% e/ A7 S( z# _5 A' ~* O8 G
CaR-mediated NFAT-dependent TNF production in mTAL cells. Stimulation of mTAL cells with extracellular Ca 2 increases intracellular Ca 2 concentration by a mechanism that causes an initial rapid transient peak followed by a lower level sustained increase in Ca 2 ( 61 ). This type of response has been observed for CaR activation in several cell types and is attributed to a G q -mediated increase in IP 3 that causes release of Ca 2 from intracellular stores followed by capacitative Ca 2 entry ( 6 ). A conventional approach for inhibiting calcineurin-NFAT signaling involves application of the immunosuppressive compound CsA, which forms a complex with cyclophilin and subsequently binds both the calcineurin A and B subunits simultaneously. This interaction blocks the ability of calcineurin to dephosphorylate substrates including NFAT, thereby preventing nuclear translocation and DNA binding of the transcription factor. CsA completely inhibited TNF production in mTAL cells challenged for 6 h with Ca 2 without affecting either basal production or cell viability ( Fig. 3 ). A high-affinity peptide (VIVIT) for the NFAT recognition site on calcineurin also inhibited TNF production ( Fig. 4 ). This peptide binds to calcineurin with a dissociation constant ( K d ) of 0.5 ± 0.03 µM, inhibits NFAT dephosphorylation and nuclear translocation without affecting calcineurin activity, and is even more selective than CsA ( 2 ). VIVIT has been shown to selectively block NFAT activation and the expression of NFAT-dependent genes, without affecting activation of other transcription factors or expression of other genes that are calcineurin dependent but NFAT independent ( 37 ). Collectively, these data suggest that inhibition of NFAT by a mechanism involving calcineurin blocks CaR-mediated TNF production in mTAL cells.6 W. v' C9 P. o4 W# z7 U! M8 q
1 _- }6 e/ ?, N9 F$ i) rFig. 3. Calcineurin inhibitor, CsA, reduces TNF production. mTAL cells were pretreated for 15 min with cyclosporin A (CsA; 0.55 ng/ml) then challenged with 1.2 mM Ca 2 for 6 h. CsA inhibited CaR-mediated, but not basal, TNF production; n = 4.9 { ~: b. T$ }) C5 l8 _0 b
) x1 A" ]. w* W: v4 ]; v8 ^Fig. 4. Inhibition of NFAT translocation prevents CaR-mediated TNF production. VIVIT (20 µM), a specific peptide inhibitor of NFAT, inhibited TNF production in response to stimulation with 1.2 mM Ca 2 but did not alter basal TNF production; n = 5.. a& M4 T' ^; ]; K: C" q
1 S. z) c8 G4 i" j- s) m
CaR activation increases calcineurin phosphatase activity. Cellular calcineurin (PP2B) activity was measured in response to CaR activation in mTAL cells. In the presence of calcineurin from mTAL extracts the RII phosphopeptide was dephosphorylated, releasing free phosphate that was detected by the classic malachite green assay and normalized for each sample by measuring protein concentration. Cells stimulated with Ca 2 (1.2 mM) increased calcineurin activity by 2.5-fold ( Fig. 5 ). This increase was inhibited by pretreatment with U-73122, which did not alter basal level calcineurin activity. Similarly, cells pretreated with CsA inhibited CaR-mediated increases in calcineurin activity. As a means to test the specificity of the high-affinity VIVIT peptide for the NFAT recognition site on calcineurin, it was employed in these experiments as a negative control. As expected, pretreatment with the VIVIT peptide did not inhibit CaR-mediated increases in calcineurin activity ( Fig. 5 ). These data suggest that both the PI-PLC pathway and calcineurin are involved in the activation and dephosphorylation of NFAT in response to CaR activation.2 |' q( P9 f% K. w& l, H$ w
) C& g1 x+ l" m2 n1 j5 U8 {/ K& KFig. 5. U-73122 and CsA inhibit CaR-mediated induction of calcineurin activity. mTAL cells were pretreated with U-73122, CsA, or VIVIT for 15 min before incubation with Ca 2 for 25 min. CaR activation increased calcineurin activity; U-73122 and CsA abolished the CaR-mediated increases in calcineurin activity. The free phosphate released was divided by the amount of protein in each sample to normalize for differences in protein levels per sample (pmol Pi/µg protein); n = 3.# \% A$ g! Z; ?' ~- G7 l
% k; Z/ |0 C& N' G; M
G q -dependent activation of NFAT. A luciferase reporter gene construct driven by a basic promoter element (TATA box), plus a defined inducible NFAT cis -enhancer element ( Fig. 6 A, inset ), was used to demonstrate that CaR-dependent activation of PI-PLC increases NFAT activity. Cells were transfected, using lipofectamine as previously described ( 60 ), with the NFAT enhancer-containing plasmid or control plasmid pCIS-CK, which contains the luciferase reporter gene but not any cis -acting DNA elements, thus serving as a negative control. The low level of background luciferase activity from the pCIS-CK control plasmid was subtracted from the values obtained in the experimental samples. After transfection, the cells were quiesced, challenged for 6 h with 1.2 mM Ca 2 in the absence or presence of U-73122, and then lysed and tested in a dual transfection assay, which allows normalization of NFAT construct activity (firefly luciferase) in each sample by cotransfecting cells with an SV40 promoter construct that drives expression of Renilla luciferase (Promega Dual Luciferase Assay System). CaR activation increased activity of the NFAT cis -enhancer-containing construct and significant inhibition of this response was observed in the presence of U-73122, suggesting that CaR-mediated increases in NFAT activity are PI-PLC dependent ( Fig. 6 A ). Further evidence for a calcineurin/NFAT-dependent mechanism was provided by measuring activity of the NFAT construct in cells challenged with Ca 2 in the absence or presence of either CsA or VIVIT. Significant inhibition of CaR-mediated increases in NFAT activity was observed in cells pretreated with either CsA ( Fig. 6 B ), or VIVIT ( Fig. 6 C ), suggesting that activation of CaR-dependent signaling pathways facilitates translocation of NFAT from the cytoplasm into the nucleus where it interacts with an NFAT-specific DNA sequence that drives transcription of a reporter gene (firefly luciferase).; y# q; M% ]& [0 }* ~# \
Z; O! n" A% a: O* T( dFig. 6. U-73122, CsA, and VIVIT inhibit CaR-mediated activation of an NFAT reporter construct. CaR-mediated induction of a reporter construct that requires activated NFAT to drive a luciferase reporter gene, depicted in inset, was inhibited by U-73122 (500 nM; n = 5; A ), CsA (0.55 ng/ml; n = 3; B ), and VIVIT peptide (20 µM; n = 5; C ).
' ^/ r! S' P1 f3 X6 U
! L3 {3 h( e# R2 O) A8 k+ l$ Y" ?' iCaR-mediated activation of NFAT. We assessed the binding of endogenous NFAT in the nucleus of mTAL cells to a radiolabeled consensus NFAT oligonucleotide probe before and after activation of the CaR. EMSA analysis detected increased binding of NFAT to the probe in nuclear extracts of mTAL cells challenged with 1.2 mM Ca 2 for 30 min ( Fig. 7 ). Moreover, preincubation of nuclear extracts with a 50-fold molar excess of unlabeled NFAT oligonucleotide competitively antagonized the interaction of NFAT with DNA, demonstrating the specificity of the recognition of NFAT binding sites on DNA by the consensus oligonucleotide. The binding of NFAT in nuclear extracts from cells challenged with Ca 2 also was less when cells were pretreated with either CsA or U-73122 suggesting that activation of a PI-PLC-dependent pathway, subsequent to CaR activation, contributes to the activation of NFAT by a calcineurin-dependent mechanism ( Fig. 7 ). These data suggest that NFAT is activated and translocates into the nucleus or is activated in the nucleus, where it regulates TNF gene expression in mTAL cells after stimulation of the CaR, and collectively, are the first experimental evidence that the CaR is involved in the regulation of NFAT expression and/or translocation in any cell type.
4 a: Z9 a: q# N- A% @; |: Z/ R# @' W0 y3 G- K
Fig. 7. CaR activation increases NFAT activity in the nucleus. mTAL cells were challenged with 1.5 mM Ca 2 for 30 min. Nuclear extracts were prepared and incubated with a 32 P-labeled NFAT consensus oligonucleotide probe in the absence or presence of a 50-fold molar excess of unlabeled oligonucleotide, which was used as a competitor to demonstrate specificity of the reaction. Ca 2 stimulation prompted increased binding of NFAT to the probe; binding was reduced in the presence of either U-73122 (500 nM) or CsA (0.55 ng/ml). Representative figure from 8 similar experiments., d: M; q0 x$ z6 ?6 ^5 C# \
6 z) D/ [; j8 h3 \0 |5 JCaR-mediated activation of a TNF promoter construct. Because increased NFAT binding was detected in the nucleus after activation of the CaR, and because inhibition of PI-PLC and calcineurin activity abolished TNF production, mTAL cells were transiently transfected with a TNF promoter construct (pGV-B2-TNFprom) to determine whether activation of these pathways is required for induction of a TNF promoter construct. Activity of the TNF promoter construct increased after cells were challenged with Ca 2 ( Fig. 8, A - C ). In contrast, the CaR-mediated increases in TNF promoter construct activity were inhibited when cells were pretreated with U-73122, CsA, or VIVIT. These data suggest that the CaR increases TNF production via a mechanism involving TNF gene transcription that requires NFAT activation as an obligate step following activation of PI-PLC." h- i" [" ]' U! p3 j
7 j; G& q" i% Q$ |$ Y) u) d/ ~Fig. 8. CaR-dependent activation of a TNF promoter construct. mTAL cells were challenged with 1.2 mM Ca 2 for 6 h following transient transfection with a TNF promoter construct (0.05 µg/well). Pretreatment with U-73122 (500 nM; n = 3; A ), CsA (0.55 ng/ml; n = 3; B ), and VIVIT (20 µM; n = 3; C ) attenuated CaR-mediated increases in luciferase activity. Data were normalized using a SV40 Renilla luciferase promoter construct (0.025 µg/well) in a dual transfection assay.
9 p2 K4 c ]. c5 M* h" l6 f7 u2 h$ S: U9 f! `/ W
DISCUSSION
) y" R8 A# S' H0 o) h3 ]9 s Y, }0 W- I" T& O: ?8 ~
In the present study, we demonstrated that activation of the CaR in primary cultures of mTAL cells increased TNF production by a mechanism involving calcineurin and NFAT. Transient transfection with dnCaR blocked CaR-mediated TNF production, as did inhibition of G q -coupled PI-PLC signaling. Activation of the CaR increased calcineurin activity in a PI-PLC-dependent manner. Moreover, inhibition of calcineurin with CsA, and calcineurin-dependent activation of NFAT with the high-affinity peptide VIVIT abolished CaR-mediated TNF production. The contribution of NFAT activation to this process was supported by the findings that U-73122, CsA, and VIVIT inhibited the activity of an NFAT cis -promoter construct that was transfected into mTAL cells. Increased NFAT binding was observed in nuclear extracts of mTAL cells after CaR activation but was absent when either PI-PLC or calcineurin activity was inhibited before activation. Activity of a TNF luciferase promoter construct in response to Ca 2 was blocked by pretreatment with U-73122, CsA, and VIVIT, suggesting that CaR activation increases TNF gene transcription by a PI-PLC-dependent mechanism involving calcineurin and NFAT. These data are the first to show that CaR activates calcineurin and NFAT in any cell type.+ M' O2 t# r4 F: g+ i& m; X9 S
; K3 V6 |/ i* l% a" Q" _; S( e* M
The CaR belongs to family C of the G protein-coupled receptor superfamily and was initially characterized as the receptor expressed on parathyroid cells responsible for modulating release of parathyroid hormone in response to changes in plasma ionized calcium ( 4 ). However, the CaR is also expressed in the kidney, brain, bone, gastric epithelial cells, and fibroblasts ( 20, 39, 41, 45, 48 ). Thus physiological functions of the CaR include regulation of calcium homeostasis and modulation of Na , Cl -, Ca 2 , and H 2 O transport in the kidney ( 5 ). In the kidney, the CaR is expressed in the cortical and mTAL, distal convoluted tubule, macula densa, inner medullary collecting duct, and proximal tubule ( 43, 44, 67 ). The TAL is responsible for reabsorption of 25% of filtered Na as well as Ca 2 ( 19 ). Because most divalent mineral reabsorption in the TAL occurs via a paracellular route and is driven by the lumen-positive transepithelial voltage generated by NaCl reabsorption and K recycling, reduced NaCl reabsorption reduces Ca 2 reabsorption. Moreover, as the TAL is water impermeable, the concentration of extracellular Ca 2 will increase at the basolateral side of the TAL as Ca 2 reabsorption occurs. Thus reabsorbed Ca 2 interacts with the CaR on the basolateral membrane of TAL cells and attenuates Ca 2 /Mg 2 reabsorption ( 24, 44 ). Increases in plasma levels of Ca 2 also modulate NaCl transport in the rat TAL ( 65 ).
4 K$ y7 x) I$ x& m8 h9 I* j1 Y9 Y3 r" N( C/ i$ h1 r8 _1 Z
The temporal changes in CaR-mediated intracellular Ca 2 levels in mTAL cells ( 61 ) are similar to those observed for CaR activation in other cell types and have been attributed to a G q -mediated increase in IP 3 that causes release of Ca 2 from intracellular stores followed by capacitative Ca 2 entry ( 6 ). It is intriguing to speculate that a nonselective cation channel of the transient receptor potential family, which is highly expressed on the basolateral membranes of the TAL, is involved in the increase in Ca 2 that is secondary to CaR activation ( 54 ). Sustained levels of intracellular Ca 2 activate calcineurin, which dephosphorylates NFAT and unmasks the nuclear localization signal domain that facilitates translocation of cytoplasmic NFAT into the nucleus ( 55 ). These findings and previous studies showing that TNF production in T cells is NFAT dependent ( 21, 22 ) led us to postulate that the CaR might increase TNF production via activation of NFAT. In this study we demonstrate that CaR-mediated activation of a TNF promoter construct and endogenous TNF production by mTAL cells were prevented by inhibition of a PI-PLC-dependent pathway that was likely coupled to G q. Indeed, CaR-mediated activation of G q stimulates PI-PLC activity, which cleaves phosphoinositides (PIP 2 ) into diacylglycerol (DAG) and IP 3, and results in activation of PKC and release of intracellular Ca 2 from sarcoplasmic reticulum stores, respectively.# b1 k1 X6 `! z7 A, _
8 K$ @8 g+ S& E" h& e6 a- }- ZRobust increases in intracellular Ca 2 are associated with formation of a Ca 2 -calmodulin complex that activates calcineurin, a Ca 2 /calmodulin, serine/threonine-dependent phosphatase ( 9 ). Activated calcineurin mediates dephosphorylation of cytosolic NFAT, a requisite for nuclear translocation and binding to nuclear binding partners for NFAT. Several members of the NFAT family of transcription factors are being considered as candidates for activation of TNF gene transcription via CaR activation in mTAL cells. For instance, NFAT5, termed TonEBP or osmotic response element binding protein, the most primordial isoform of this family of transcription factors, is expressed in the kidney and contributes to induction of genes that increase the accumulation of organic osmolytes to protect cells against a hypertonic environment ( 10, 36, 40 ). Moreover, NFAT5 regulates TNF production in osmotically stressed T cells ( 35 ). Because the mTAL is involved in concentrating and diluting mechanisms of the kidney, it is possible that this NFAT isoform contributes to CaR-mediated TNF production, which regulates ion transport in the mTAL ( 14 ). Regulation of NFAT5 by a calcineurin-dependent mechanism appears to be stimulus dependent and indirect as this isoform lacks the conserved regulatory domains that permit direct association with calcineurin, but may be induced in a calcineurin-dependent manner ( 1, 37, 57 ). Interestingly, T cell receptor stimulation, like CaR stimulation, induces sustained increases in intracellular calcium ( 55 ) in contrast to hypertonicity which does not ( 15 ).
$ s$ F5 P2 M5 m
; Y, T7 ^. V$ M' uThe presence of TNF receptors on virtually all cells tested may account for the pleiotropic effects of this cytokine. TNF plays an important role in inflammatory and immune events and has beneficial or detrimental effects depending on the circumstances. The contribution of this cytokine to cardiovascular, endocrine, and renal physiology and pathology is becoming increasingly appreciated. For instance, TNF may function as a regulator of renal function in physiological and pathophysiological settings. Previous studies from our laboratory identified a role for this cytokine in a COX-2-dependent renal ion transport mechanism and as a modulator of ANG II-dependent hypertension ( 14, 17, 18, 66 ). Other investigators have demonstrated that TNF increases Na uptake in distal tubule cells from diabetic but not control rats ( 12 ), stimulates the 70-pS K channel in the TAL ( 66 ), is increased in the urine of diabetic rats and contributes to diabetic nephropathy ( 30, 52 ), inhibits renin secretion ( 56 ), contributes to the development of renal fibrosis ( 23 ), and causes endothelium-independent relaxation in isolated blood vessels ( 28 ). The contribution of PGE 2 to the regulation of salt and water homeostasis has been demonstrated by many investigators ( 16, 29, 34, 53, 59 ). Thus COX-2-derived PGE 2 produced by mTAL cells in response to TNF may contribute to the regulation of salt and water reabsorption in the mTAL and collecting duct. Salt loading increases COX-2 expression in the medulla, and the subsequent increase in PGE 2 contributes to a natriuretic mechanism that is antagonized by COX-2 inhibitors ( 46, 68 ). COX-2 inhibitors also cause Na retention in some human subjects, particularly those having either heart or liver failure, and decrease urinary Na excretion in subjects with salt depletion or in elderly subjects on a normal-Na diet ( 8, 47, 49, 51 ).( \1 |6 t5 ?: @
! h) e7 q; X1 N) n3 GThe CaR is part of a mechanism that maintains tight control over calcium homeostasis. The renal expression of this receptor may be important for the regulation of salt and water balance. For instance, raising the serum-ionized Ca 2 level by 25% increased the urinary excretion of Na by 150% ( 13 ). Although the CaR is known to increase Ca 2 excretion and affect NaCl reabsorption, the mechanism for these effects is not well understood. When CaR -/- mice were bred with mice deficient in the transcription factor glial cell missing 2 or mice deficient in PTH, the mice were "rescued" from severe defects in skeletal phenotype but remained hypocalciuric ( 33, 58 ). These data indicate that while PTH contributes to the bone pathology associated with homozygous mutations of the CaR, the effects on Ca 2 excretion by the kidney occur by a distinct mechanism ( 33 ). Accordingly, there may be other factors that contribute to the effects of the CaR on renal excretion of calcium and sodium, which occur in a parallel manner in the TAL segment of the nephron. We previously showed that CaR activation increases TNF production in cultured mTAL cells and propose that this cytokine could contribute to the actions of the CaR in this segment of the nephron ( 62 ). CsA inhibited renal COX-2-mediated PGE 2 production and substantially reduced urine volume and sodium excretion ( 26 ). Interestingly, CsA also inhibits CaR-mediated increases in COX-2 expression and PGE 2 production in cultured mTAL cells (unpublished observations, H. I. Abdullah et al.). These data support the notion that an NFAT/calcineurin-dependent pathway is part of a mechanism that regulates renal excretory function. They are consistent with the observation that CsA attenuates furosemide-mediated increases in diuresis and natriuresis and earlier reports that illustrated the antinatriuretic effects of CsA ( 31, 50 ). It is likely that a diverse array of transcription factors and genes can be induced by activation of the CaR. G protein amplification cascades are multifaceted and involve the interaction of many downstream signaling proteins. The NFAT/calcineurin-dependent synthesis of TNF in the mTAL could represent a previously uncharacterized autocrine regulatory mechanism that regulates salt and water transport.2 A, n1 T- q, Q1 N: n4 a
# W' _6 r: F* `% _
GRANTS( f- W9 H4 Q, g- {3 g0 @
[7 L# _$ s' G, K7 m$ t! V
This work was supported by National Institutes of Health Grants HL-56423 and PPG HL-34300.
! ]7 v* B& s+ d6 B 【参考文献】
3 }! y% ~5 o7 a/ A. r- z; |6 C/ s Aramburu J, Heitman J, and Crabtree GR. Calcineurin: a central controller of signalling in eukaryotes. EMBO J 5: 343-348, 2004.
: R2 P( M' R; l& c- Z
& i+ ] Z. a' f4 ?2 o1 G6 n& L! k0 h, W% ~; \/ ^! o( t
0 V5 Y/ L3 B, Z7 TAramburu J, Yaffe MB, Lopez-Rodriguez C, Cantley LC, Hogan PG, and Rao A. Affinity-driven peptide selection of an NFAT inhibitor more selective than cyclosporin A. Science 285: 2129-2133, 1999.) i# |5 t7 e* Q1 w1 u \
X3 H0 s; S5 W% z8 i" y$ d& M9 P" ?
" H. T" m V$ N% j: X5 g
Awata H, Huang C, Handlogten ME, and Miller RT. Interaction of the calcium-sensing receptor and filamin, a potential scaffolding protein. J Biol Chem 276: 34871-34879, 2001.' P4 J) ~: ?* {0 \3 [
5 {+ E n) j( P* ~. Q" S
0 L( N% C+ M" L% b" ~7 D1 q% i9 V, L$ e
" j1 t+ o; s, z: v4 |
Brown EM, Gamba G, Riccardi D, Lombardi M, Butters R, Kifor O, Sun A, Hediger MA, Lytton J, and Hebert SC. Cloning and characterization of an extracellular Ca 2 -sensing receptor from bovine parathyroid. Nature 366: 575-580, 1993.
) I1 @: c: ^( D8 ^8 _ Q6 x# H& @
5 G2 w' P; q. F: ~7 D% p& ?) g" Q* @0 d7 F
" p8 }, ]# S, x6 G! l, \! A
Brown EM and MacLeod RJ. Extracellular calcium sensing and extracellular calcium signaling. Physiol Rev 81: 239-297, 2001.3 Z; C' H6 I! e% U4 K0 f
7 X& }2 E" O7 F0 Q3 X
9 }# u l, {5 `6 U W0 |
* _; @& g9 _* N6 ^. L0 f* U5 v0 QBrown EM, Vassilev PM, and Hebert SC. Calcium ions as extracellular messengers. Cell 83: 679-682, 1995.
; u# ~/ z! F. y" f# ?+ i2 E5 t
; P# p+ M& a5 m g* V7 |- s: {8 n& @- }$ A" _+ R$ a
$ ?% d% H3 O% O4 N/ QCarroll MA, McGiff JC, and Ferreri NR. Products of arachidonic acid metabolism. Methods Mol Med 86: 385-397, 2003.8 Y1 C) e4 F( Q" A
. g$ c/ `5 z) e1 z {. f
, e3 {( p' T+ ~' e3 M" _' c% k% e
3 m9 k Q& n7 t! Y. l( T
Catella Lawson F, McAdam B, Morrison BW, Kapoor S, Kujubu D, Antes L, Lasseter KC, Quan H, Gertz BJ, and FitzGerald GA. Effects of specific inhibition of cyclooxygenase-2 on sodium balance, hemodynamics, and vasoactive eicosanoids. J Pharmacol Exp Ther 289: 735-741, 1999.
, N) t7 C! H% z) ~: B7 }; D3 E3 J' C; p# d1 T" K1 h7 `# b
, ?" Q$ f- s" g. ~% L9 x
5 j1 V% a, |( E) VCrabtree GR. Calcium, calcineurin, and the control of transcription. J Biol Chem 276: 2313-2316, 2001.
0 Q# ~5 t' D) N- s. ?6 T, r' n
, Z4 ~: p8 o( h7 }
% k/ L; h- \ |' P% m% `
9 N" P8 |6 H. M" }+ ]# }Dahl SC, Handler JS, and Kwon HM. Hypertonicity-induced phosphorylation and nuclear localization of the transcription factor TonEBP. Am J Physiol Cell Physiol 280: C248-C253, 2001.
$ E }# e4 m1 F2 a E t
* k3 x4 }+ ^( P% i7 v3 \% D8 y+ u0 p2 E6 h4 S
- x8 ^/ I5 s/ R7 H: NDignam JD, Lebovitz RM, and Roeder RG. Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei. Nucleic Acids Res 11: 1475-1489, 1983.' |" i% \% B) t6 t8 g7 Y* H
/ `( L! h- Q& A' ]9 ^" D2 m/ L7 w3 n
) H/ E0 n8 E- D# F$ V& z( ~/ SDiPetrillo K, Coutermarsh B, Soucy N, Hwa J, and Gesek F. Tumor necrosis factor induces sodium retention in diabetic rats through sequential effects on distal tubule cells. Kidney Int 65: 1676-1683, 2004.
5 x! y) U% \" L/ b2 T) i" g# b& _
* X) a; s% j% j5 R7 h% D5 W9 o8 a8 W2 b* U
; G9 I* }) Q: N$ u) Y$ S& H& SEl-Hajj Fuleihan G, Seifter J, Scott J, and Brown EM. Calcium-regulated renal calcium handling in healthy men: relationship to sodium handling. J Clin Endocrinol Metab 83: 2366-2372, 1998.
9 x* n9 { {% S) _4 j5 X6 R: {# y- V0 U7 I, ~ y2 t
5 Q! T' y7 A/ m2 X% U, q6 b- y( }7 R" O6 Y) S
Escalante BA, Ferreri NR, Dunn CE, and McGiff JC. Cytokines affect ion transport in primary cultured thick ascending limb of Henle's loop cells. Am J Physiol Cell Physiol 266: C1568-C1576, 1994.
' B9 \5 f$ [! Z& E1 [
; n4 X' ~9 V) T; _& I/ t8 A
+ `7 t* k0 f d1 i9 u7 W: V- n* q. A7 w" i% a W$ q, H+ T
Ferraris JD, Williams CK, Persaud P, Zhang Z, Chen Y, and Burg MB. Activity of the TonEBP/OREBP transactivation domain varies directly with extracellular NaCl concentration. Proc Natl Acad Sci USA 99: 739-744, 2002.0 X" y+ c0 N6 L6 s
' q8 L F- S9 B$ q# M8 H7 ]* M; ]: [
: G, \) w0 i' W3 I, j8 h- {( F4 v& B; [$ m& D! K, C) P2 L8 R2 X
Ferreri NR, An SJ, and McGiff JC. Cyclooxygenase-2 expression and function in the medullary thick ascending limb. Am J Physiol Renal Physiol 277: F360-F368, 1999.
! j% |9 V& ^/ ]# e+ K& v1 V/ J
+ ]; G4 D/ S$ D, E6 b- _
+ j$ {2 N! u: G
* y7 r, f' r) S3 JFerreri NR, Escalante BA, Zhao Y, An S, and McGiff JC. Angiotensin II induces TNF production by the thick ascending limb: functional implications. Am J Physiol Renal Physiol 274: F148-F155, 1998.; o3 k- j( r+ i; v* b/ I5 {% @
9 a; e5 |& a: Y; ]# x9 h
$ q" ~( T% Q3 B0 ]2 T) [* C) {$ T; G: B/ |. [0 e1 P. W
Ferreri NR, Zhao Y, Takizawa H, and McGiff JC. Tumor necrosis factor- /angiotensin interactions and regulation of blood pressure. J Hypertens 15: 1481-1484, 1997.
6 F3 b! g) t& G5 a- n( \/ D( w$ K% y2 M7 d
% `4 _8 E2 V+ z
! y; H- L. T# A+ q+ hFriedman PA and Gesek FA. Cellular calcium transport in renal epithelia: measurement, mechanisms, and regulation. Physiol Rev 75: 429-471, 1995.
! K" \! ?' _( H( U# i. `3 }" Q# ]% d/ K, E( m! W
/ I- e, g' z; ?" s
% n: a4 [* u' H$ qGodwin SL and Soltoff SP. Extracellular calcium and platelet-derived growth factor promote receptor-mediated chemotaxis in osteoblasts through different signaling pathways. J Biol Chem 272: 11307-11312, 1997.6 [; K- M0 x9 E
- u: B+ E8 ]3 p# w+ a7 X! `- x0 i& I3 Y' @% K
8 @- { I2 F) a0 Z. R1 ]
Goldfeld AE, McCaffrey PG, Strominger JL, and Rao A. Identification of a novel cyclosporin-sensitive element in the human tumor necrosis factor- gene promoter. J Exp Med 178: 1365-1379, 1993." \6 [: q5 d( A4 s# }, M
, {5 U1 ]1 c& [0 h0 p/ [/ q6 D2 c& W3 s- ?3 U I
6 Y& C! s& e6 K1 {/ s; ^
Goldfeld AE, Tsai E, Kincaid R, Belshaw PJ, Schrieber SL, Strominger JL, and Rao A. Calcineurin mediates human tumor necrosis factor- gene induction in stimulated T and B cells. J Exp Med 180: 763-768, 1994.
9 l6 q5 d* Y: ?; Y% o4 y1 T# i
/ T* n; H \5 n2 G0 T! v4 G# {0 K' ]: k
+ J1 Z7 q$ n2 z
Guo G, Morrissey J, McCracken R, Tolley T, Liapis H, and Klahr S. Contributions of angiotensin II and tumor necrosis factor- to the development of renal fibrosis. Am J Physiol Renal Physiol 280: F777-F785, 2001.
; P0 K- \# ^) p" M$ Z. [; p' g7 D0 v ~6 c; m
`$ @# B- R4 G0 s8 [5 A, G! i2 Y7 D2 j
Hebert SC. Extracellular calcium-sensing receptor: implications for calcium and magnesium handling in the kidney. Kidney Int 50: 2129-2139, 1996.
b2 n w+ ?/ j( S; C* u" t8 I2 W$ X4 g/ m% E' Z
8 K# f$ n" X! w7 [. m) I- j' s c0 a% T
Hobson SA, Wright J, Lee F, McNeil SE, Bilderback T, and Rodland KD. Activation of the MAP kinase cascade by exogenous calcium-sensing receptor. Mol Cell Endocrinol 200: 189-198, 2003.
$ _5 \" v0 f0 z7 G7 ~# R, @1 I/ {! C c
0 C: f @+ @6 N' D6 m$ J4 V
/ l0 J( w3 h K1 S9 E# ]7 A0 \$ E
# O( C4 \& ^5 c* m6 `' A" SHocherl K, Kees F, Kramer BK, and Kurtz A. Cyclosporine A attenuates the natriuretic action of loop diuretics by inhibition of renal COX-2 expression. Kidney Int 65: 2071-2080, 2004./ o/ t9 f* {/ X: G4 `; f
1 x' O1 K4 h( ~ |! K8 H5 D( b; f9 o$ z L, x; C+ A% v" k
0 V" c. O' r7 S
Hofer AM and Brown EM. Extracellular calcium sensing and signalling. Nat Rev Mol Cell Biol 4: 530-538, 2003.
) B- M' |0 I! J4 @% Y& [" q* @1 }, @+ r7 G: X3 x
/ X5 [& n) g2 K! l O6 ]
# @+ S0 T( f* m1 ]
Johns DG and Webb RC. TNF- -induced endothelium-independent vasodilation: a role for phospholipase A2-dependent ceramide signaling. Am J Physiol Heart Circ Physiol 275: H1592-H1598, 1998.
, Y/ s9 m7 y" m1 V, M7 `) D# P
6 c- |& f/ B& O6 q6 }1 B( e# S6 L M/ X' R- o( W
Kaji M, Chase HS Jr., Eng JP, and Diaz J. Prostaglandin E 2 inhibits Na-K-2Cl cotransport in medullary thick ascending limb cells. Am J Physiol Cell Physiol 271: C354-C361, 1996.
; Y5 p2 M" u# a+ t, T2 u) v" D7 \
+ x& j2 q6 E# U, H o! ]( S. \6 @- `) H& V9 d$ d6 ~
! V( O8 S6 P- r& W
Kalantarinia K, Awad AS, and Siragy HM. Urinary and renal interstitial concentrations of TNF- increase prior to the rise in albuminuria in diabetic rats. Kidney Int 64: 1208-1213, 2003.
; R$ X/ h9 a6 _ D
1 N% e9 k5 y. G& [/ v+ [& a5 F7 H& K/ c9 K& [: Y
* u: R2 G) {6 g7 d n8 X+ Q
Kaskel FJ, Devarajan P, Arbeit LA, Partin JS, and Moore LC. Cyclosporine nephrotoxicity: sodium excretion, autoregulation, and angiotensin II. Am J Physiol Renal Fluid Electrolyte Physiol 252: F733-F742, 1987.: p Q9 Z$ J! R1 c y
+ R8 E/ ]; O+ q8 r5 F D- ^0 o4 w& q- W- z# s1 Z h
9 {8 O9 b8 k* |( N- ^6 tKifor O, MacLeod RJ, Diaz R, Bai M, Yamaguchi T, Yao T, Kifor I, and Brown EM. Regulation of MAP kinase by calcium-sensing receptor in bovine parathyroid and CaR-transfected HEK293 cells. Am J Physiol Renal Physiol 280: F291-F302, 2001.; |2 q0 S# ^0 B8 f4 h$ a, N3 r" f
8 V; W9 F7 O3 ~# V& k4 n2 x- _7 G
* v5 U4 I; p; \( ^3 p# s% ]# }* p. s" z& i2 u3 l
Kos CH, Karaplis AC, Peng JB, Hediger MA, Goltzman D, Mohammad KS, Guise TA, and Pollak MR. The calcium-sensing receptor is required for normal calcium homeostasis independent of parathyroid hormone. J Clin Invest 111: 1021-1028, 2003.4 N' o; Y* L2 f' D @# A5 j( k
9 X; p0 g$ w# K4 E2 q0 h/ c E, q/ m2 s4 @* j
" b; @- D, K$ b0 lLiu HJ, Wei Y, Ferreri NR, Nasjletti A, and Wang WH. Vasopressin and PGE 2 regulate the activity of the apical 70 pS K channel in the thick ascending limb of the rat kidney. Am J Physiol Cell Physiol 278: C905-C913, 2000.0 o% v2 ^6 X: ]% Z
" k. J, T, z& ] F' I2 |2 E3 J
: M# u( K2 R3 S
9 ~5 M% T& r7 d' ?$ p' ~* _6 Z
Lopez-Rodriguez C, Aramburu J, Jin L, Rakeman AS, Michino M, and Rao A. Bridging the NFAT and NF- B families: NFAT5 dimerization regulates cytokine gene transcription in response to osmotic stress. Immunity 15: 47-58, 2001.7 y4 i# j, c/ R3 Q& I. Q
9 a, g) w) T! j; J
* n& o1 m+ L, y# n5 u7 L' a! V- O# D$ I; a
Lopez-Rodriguez C, Aramburu J, Rakeman AS, and Rao A. NFAT5, a constitutively nuclear NFAT protein that does not cooperate with Fos and Jun. Proc Natl Acad Sci USA 96: 7214-7219, 1999.& V+ J1 u' W9 Z- P: r3 a+ ]
" i- \+ a( I9 l! [, v. B# }" u$ T/ W
1 p6 Y9 _$ Y4 p- SMacian F, Lopez-Rodriguez C, and Rao A. Partners in transcription: NFAT and AP-1. Oncogene 20: 2476-2489, 2001.
0 ~2 J h' |9 ]4 T9 X- f, Y5 K# K
4 x8 f* g. _. p0 s5 f T7 @5 b
- z5 ?2 e: B# _( ^, m" g) @Macica C, Escalante BA, Conners MS, and Ferreri NR. TNF production by the medullary thick ascending limb of Henle's loop. Kidney Int 46: 113-121, 1994.! P+ e+ q$ q- w/ i% K
0 E( m/ H' m! {7 a% l4 L0 k. p- z$ t0 |) @* O8 r" q0 `
4 `" E/ d4 C: HMcNeil SE, Hobson SA, Nipper V, and Rodland KD. Functional calcium-sensing receptors in rat fibroblasts are required for activation of SRC kinase and mitogen-activated protein kinase in response to extracellular calcium. J Biol Chem 273: 1114-1120, 1998.0 r/ x0 h) D8 j6 Y7 T! m' w* S* Q9 _
4 N# }5 `1 K" @
( W& H7 U) ^: @4 S. o! u
* F2 H* u6 |# j* {Miyakawa H, Woo SK, Dahl SC, Handler JS, and Kwon HM. Tonicity-responsive enhancer binding protein, a rel-like protein that stimulates transcription in response to hypertonicity. Proc Natl Acad Sci USA 96: 2538-2542, 1999.+ p5 d, a5 }3 g8 h: V
( }/ G' C. `+ A+ i
. P% f# j9 j# P1 c7 a! P
& y! j. T, N) P( Q8 {( D7 JPazianas M, Adebanjo OA, Shankar VS, James SY, Colston KW, Maxwell JD, and Zaidi M. Extracellular cation sensing by the enterocyte: prediction of a novel divalent cation "receptor". Biochem Biophys Res Commun 210: 948-953, 1995.
) s9 ?2 r" t- X0 Z
j9 e6 w# W E/ Y& [3 u1 O+ p
% U$ G5 i% r( B8 b2 x9 M) b' W3 z
Rao A, Luo C, and Hogan PG. Transcription factors of the NFAT family: regulation and function. Annu Rev Immunol 15: 707-747, 1997." @/ e% e' F) x" k+ K3 Z2 V5 F/ C
& T& H9 p* @& }' O
* j) [) Q/ b- P1 L1 b. O
6 r& o8 \/ f7 I2 ARiccardi D, Hall AE, Chattopadhyay N, Xu JZ, Brown EM, and Hebert SC. Localization of the extracellular Ca 2 /polyvalent cation-sensing protein in rat kidney. Am J Physiol Renal Physiol 274: F611-F622, 1998.
) q" T/ T8 n' M% ^. u2 H% A
! }# ]) Z; [8 P% q6 G' Z' k: V3 u s( h) V. L, M; i# b2 |
" {2 l: g9 ?" J+ S8 @
Riccardi D, Lee WS, Lee K, Segre GV, Brown EM, and Hebert SC. Localization of the extracellular Ca 2 sensing receptor and PTH/PTHrP receptor in rat kidney. Am J Physiol Renal Fluid Electrolyte Physiol 271: F951-F956, 1996.
9 Y1 K B$ Q' J& Y
% n. T8 x4 {; u+ x1 i* s; t1 C' _9 x, x0 Y
: c" l# u- i; @Riccardi D, Park J, Lee W, Gamba G, Brown EM, and Hebert SC. Cloning and functional expression of a rat kidney extracellular calcium/polyvalent cation/sensing receptor. Proc Natl Acad Sci USA 92: 131-135, 1995.1 Q, C! e8 `" f) |. n0 b. y1 B
{* i) l( x& l2 F! n; c4 z; F, N
) E0 E% X+ D6 G0 d
S3 m8 V9 `! a+ b& z2 m& q% tRodriguez F, Llinas MT, Gonzalez JD, Rivera J, and Salazar FJ. Renal changes induced by a cyclooxygenase-2 inhibitor during normal and low sodium intake. Hypertension 36: 276-281, 2000.7 ~$ A2 a, r, j0 ~% f0 v4 o; R
5 V* y3 q1 f* Y# q
2 l, D# w$ Z! ?5 J
( p1 r* h; m3 w2 S( u3 t/ @
Rossat J, Maillard M, Nussberger J, Brunner HR, and Burnier M. Renal effects of selective cyclooxygenase-2 inhibition in normotensive salt-depleted subjects. Clin Pharmacol Ther 66: 76-84, 1999.; e& ~9 }& j; Y# I
0 k! {6 i+ I Z+ m$ t! }; [5 k
7 E: ^ J* A! _' s R9 c
S" [" B* C* P/ R* q/ i5 qRuat M, Molliver ME, Snowman AM, and Snyder SH. Calcium sensing receptor: molecular cloning in rat and localization to nerve terminals. Proc Natl Acad Sci USA 92: 3161-3165, 1995.
% j6 U2 s1 ^( r0 R4 a- I
$ d) k( D P) w( S8 j I) `+ r, [" y% X7 u/ ]5 u
" p& e8 I# C, z4 i8 A4 @ J
Schwartz JI, Vandormael K, Malice MP, Kalyani RN, Lasseter KC, Holmes GB, Gertz BJ, Gottesdiener KM, Laurenzi M, Redfern KJ, and Brune K. Comparison of rofecoxib, celecoxib, and naproxen on renal function in elderly subjects receiving a normal-salt diet. Clin Pharmacol Ther 72: 50-61, 2002.: q4 T {& R; T8 r$ T9 C: L6 { c
' c$ q, `7 _ z" q' h/ J. h9 V/ m6 t% L- G$ b
( v6 m- ?+ m8 l: b
Siegl H and Ryffel B. Effect of cyclosporin on renin-angiotensin-aldosterone system. Lancet 2: 1274, 1982.7 w+ J% r$ L0 B* C5 N
* a& J1 d3 Y/ N2 F/ ~3 j- U* v% }. z9 T
- z8 k* S7 S# N5 rSilverstein FE, Faich G, Goldstein JL, Simon LS, Pincus T, Whelton A, Makuch R, Eisen G, Agrawal NM, Stenson WF, Burr AM, Zhao WW, Kent JD, Lefkowith JB, Verburg KM, and Geis GS. Gastrointestinal toxicity with celecoxib vs. nonsteroidal anti-inflammatory drugs for osteoarthritis and rheumatoid arthritis: the CLASS study: a randomized controlled trial. Celecoxib long-term arthritis safety study. JAMA 284: 1247-1255, 2000.$ ]& y/ Q6 D, _3 E# C
6 m; ?% u3 X4 H9 X, D: n5 {' p
7 E/ O. ]8 @8 k/ g* b
0 r/ V/ E* Y& n; O% kSiragy HM, Awad A, Abadir P, and Webb R. The angiotensin II type 1 receptor mediates renal interstitial content of tumor necrosis factor- in diabetic rats. Endocrinology 144: 2229-2233, 2003.
. q8 ]& a4 ]( x. Y
2 N" `' w/ e# D0 o3 K
- n, p' r4 }% o, ~7 s7 g
. u y* v8 W! S& lStokes JB. Effect of prostaglandin E 2 on chloride transport across the rabbit thick ascending limb of Henle. J Clin Invest 64: 495-502, 1979.$ H% e7 C/ Z( U# y9 l7 O
) ~6 }5 P8 v- n5 P$ J$ _& n0 h8 X9 L' }3 S* P! w# C' `
6 i) G# S3 ]/ e' @5 h* j1 x5 |Tian W, Salanova M, Xu H, Lindsley JN, Oyama TT, Anderson S, Bachmann S, and Cohen DM. Renal expression of osmotically responsive cation channel TRPV4 is restricted to water-impermeant nephron segments. Am J Physiol Renal Physiol 287: F17-F24, 2004.% d$ `0 ~/ o- n; x6 |5 m$ S
/ D- P+ E5 o" Q$ x) q$ _5 I
& T& L! U5 P, s6 L! N7 d8 C) @
5 ~9 P4 |' {! Q9 v# @Timmerman LA, Clipstone NA, Ho SN, Northrop JP, and Crabtree GR. Rapid shuttling of NF-AT in discrimination of Ca 2 signals and immunosuppression. Nature 383: 837-840, 1996.; `4 S& a0 e: c' Y h- n: ^
+ Q5 _+ H9 z1 H# ^! t7 N. }+ a2 s. t @: v5 O# V- r
$ V3 Z; e6 {* }6 d
Todorov V, Muller M, Schweda F, and Kurtz A. Tumor necrosis factor- inhibits renin gene expression. Am J Physiol Regul Integr Comp Physiol 283: R1046-R1051, 2002.! d% _8 U$ \* V5 }2 `
: B8 L1 V! E T* F4 z# q
# H" d5 j$ d' W1 h9 a, D
0 Q' y' x7 U8 Q: E, @( ITrama J, Lu Q, Hawley RG, and Ho SN. The NFAT-related protein NFATL1 (TonEBP/NFAT5) is induced upon T cell activation in a calcineurin-dependent manner. J Immunol 165: 4884-4894, 2000.5 W/ o" B# e: K% e6 [
% d4 R$ W: G& M! d- w5 B
" F2 p: D- I# u1 F* s, G6 m4 }" k
Tu Q, Pi M, Karsenty G, Simpson L, Liu S, and Quarles LD. Rescue of the skeletal phenotype in CasR-deficient mice by transfer onto the Gcm2 null background. J Clin Invest 111: 1029-1037, 2003.
& A$ y' P; r0 k# }
4 e& X% b6 i6 f7 z' r% o+ I/ L! a. |# d
1 ], D; L. G2 ?, w& _; [/ k. K* ]! m
Wald H, Scherzer P, Rubinger D, and Popovtzer MM. Effect of indomethacin in vivo and PGE 2 in vitro on mTAL Na-K-ATPase of the rat kidney. Pflügers Arch 415: 648-650, 1990.) S5 B0 k: U* R* l
; u% [& I: q: {8 ?3 G1 |7 K5 S% ?7 e( H7 [9 z7 J
1 |7 V( I0 o+ F \$ l$ s4 Q. |Wang D, An SJ, Wang WH, McGiff JC, and Ferreri NR. CaR-mediated COX-2 expression in primary cultured mTAL cells. Am J Physiol Renal Physiol 281: F658-F664, 2001.7 G, t* J4 a) j! V7 T/ h6 J- W9 r
2 H3 t$ q V% K+ y* U2 h/ }7 {% x& ^; ?# j5 \4 q; B
' I& u5 B- m9 w* o7 }# m: E
Wang D, McGiff JC, and Ferreri NR. Regulation of cyclooxygenase isoforms in the renal thick ascending limb: effects of extracellular calcium. J Physiol Pharmacol 51: 587-595, 2000. p% g7 j( o2 e# H
+ L1 ^/ l, Y" t) C
& t' `( s9 H& n1 ~( C) s ]& E; f6 _- S- i, l. f' D
Wang D, Pedraza PL, Abdullah HI, McGiff JC, and Ferreri NR. Calcium-sensing receptor-mediated TNF production in medullary thick ascending limb cells. Am J Physiol Renal Physiol 283: F963-F970, 2002.
7 f* R1 w9 I# Z; n- ]- ^& u9 O; |% a t# \% y
, L! M" Y4 N) T z9 S8 V
6 D1 C& W3 F# H3 V/ R. y! g, kWang WH, Lu M, Balazy M, and Hebert SC. Phospholipase A 2 is involved in mediating the effect of extracelluar Ca 2 on apical K channels in rat TAL. Am J Physiol Renal Physiol 273: F421-F429, 1997.6 T) B+ |. ~9 A; }7 R
, ], P7 w4 D8 c5 g: O) t4 u
4 K* z7 ^/ X8 \# L
& l: ^7 h+ e9 ~3 i1 s! Z+ WWang XD, Kiang JG, and Smallridge RC. A phospholipase C inhibitor, U-73122, blocks TSH-induced inositol trisphosphate production, Ca 2 increase and arachidonic acid release in FRTL-5 thyroid cells. Biochim Biophys Acta 1223: 101-106, 1994.4 N, F) Y# {; R4 [8 {4 ~: E' K* N
$ I' J! M9 h% k7 W8 @
/ d# d' t& I/ _# b' [
) t3 ^" K9 h* d4 I( S% `Ward DT and Riccardi D. Renal physiology of the extracellular calcium-sensing receptor. Pflügers Arch 445: 169-176, 2002., M$ Q: F% i4 f* `
5 c& h% Q" o6 M- _ A2 v6 D( _9 A* C2 ^
& I. {9 d2 \ I3 I% p8 p: d# ?9 z* C- G3 R Q2 V$ A1 s
Wei Y, Babilonia E, Pedraza PL, Ferreri NR, and Wang WH. Acute application of TNF stimulates apical 70-pS K channels in the thick ascending limb of rat kidney. Am J Physiol Renal Physiol 285: F491-F497, 2003.
& [1 Y- V L+ h. T0 a$ `( ^$ V1 U6 Y- \3 Z4 L' `
+ P4 q6 j3 r9 n/ u. @
- i5 s9 u6 w7 d! B/ [
Yang T, Hassan S, Huang YG, Smart AM, Briggs JP, and Schnermann JB. Expression of PTHrP, PTH/PTHrP receptor, and Ca 2 -sensing receptor mRNAs along the rat nephron. Am J Physiol Renal Fluid Electrolyte Physiol 272: F751-F758, 1997.% v" O; x- \# X
2 Z2 n' p! k: G3 G- ]% W. {; v1 ^' E+ y8 @- U+ k1 i$ Z% }
1 s7 W$ T$ c/ V2 o7 K5 v& }3 mYang T, Singh I, Pham H, Sun D, Smart A, Schnermann JB, and Briggs JP. Regulation of cyclooxygenase expression in the kidney by dietary salt intake. Am J Physiol Renal Physiol 274: F481-F489, 1998. |
|