|

- 积分
- 0
- 威望
- 0
- 包包
- 0
|

作者:Li Sun, Yuanzhen Peng, Neeha Zaidi, Ling-Ling Zhu, Jameel Iqbal, Kosj Yamoah, Xin Wang, Peng Liu, Etsuko Abe, Baljit S. Moonga, Solomon Epstein, and Mone Zaidi作者单位:Mount Sinai Bone Program and Department of Medicine, Mount Sinai School of Medicine, New York
8 @8 a& X) E4 x9 ^! S( k# s8 T
. V- Z! j7 ?$ o8 |, j9 i+ ~( S
( G l7 q) w2 g1 _* X! w4 q' U ; |% u: k/ w+ i/ F! m, b3 q* p8 F
1 P) a* O# g9 v* s; y
. i+ l7 G2 b, G / _( G9 f* |( N% l8 g6 s
+ W4 ^/ K& i$ ] # t6 R* r% A( U) `- M- @
! z5 S$ u2 u" O( W* V, p ^: z3 |2 b) v% E4 w" m1 W
, e* d- z! m1 u5 l ! B6 k& S3 B8 f; ^" o) t
【摘要】) d& o7 T1 o A1 W; l/ K
Here, we demonstrate that the Ca 2 /calmodulin-sensitive phosphatase calcineurin is a necessary downstream mediator for osteoclast differentiation. Using quantitative PCR, we detected the calcineurin isoforms A, A, A (catalytic), and B1 (regulatory) in osteoclast precursor RAW-C3 cells. We found that, although the expression of these isoforms remained relatively unchanged during osteoclast differentiation, there was a profound increase in the expression of their primary substrate for calcineurin, nuclear factor of activated T cells (NFAT)c1. For gain-of-function studies, we incubated osteoclast precursors for 10 min with a calcineurin fusion protein (TAT-calcineurin A ); this resulted in its receptorless 90% of the precursor cells. A marked increase in the expression of the osteoclast differentiation markers tartrate-resistant acid phosphatase (TRAP) and integrin 3 followed. In addition, the expression of NFATc1, as well as the alternative substrate for calcineurin, I B, was significantly enhanced. Likewise, transfection with constitutively active NFAT resulted in an increased expression of both TRAP and integrin 3. In parallel loss-of-function studies, transfection with dominant-negative NFAT not only inhibited osteoclast formation but also reversed the induction of NFATc1, TRAP, and integrin 3 by TAT-calcineurin A. The expression of these markers was also inhibited by calcineurin A U1 small nuclear RNA, which significantly reduced calcineurin A mRNA and protein expression. Consistent with these observations, we observed a reduction in osteoclastogenesis in calcineurin A -/- cells and in osteoclast precursors treated with the calcineurin inhibitors cyclosporin A and FK506. Together, the gain- and loss-of-function experiments establish that calcineurin A is necessary for osteoclast formation from its precursor and that this occurs via an NFATc1-dependent mechanism. , `$ V- I1 j# S8 L9 E/ @/ Z
【关键词】 osteoclastogenesis cyclosporin nuclear factor of activated T cells
$ M5 W& A+ |& x; X' C1 L CALCINEURIN, a Ca 2 /calmodulin-dependent protein phosphatase, plays a critical role in transducing Ca 2 signals into cellular responses ( 22, 23 ). The heterodimeric protein consists of two subunits: catalytic (A) and regulatory (B) ( 22 ). Mammalian calcineurin A has three isoforms (,, and ), which are products of different genes and exhibit 86% sequence homology. The two isoforms of calcineurin B, in contrast, are highly conserved from yeast to humans ( 23 ).& r& p' B, p1 p/ X) |, e
( j- y/ S! n$ `( DCalcineurin has established roles in T-cell activation, vesicular trafficking, cell growth, apoptosis, neuron depotentiation, muscle development, and cardiac valve formation ( 20, 27, 33, 37, 44 ). Calcineurin A knockout mice show defective antigen-specific T-cell responses ( 44 ), cardiac defects ( 37 ), and abnormalities in the central nervous system ( 20, 27 ). Mechanistically, the enzyme regulates gene transcription by dephosphorylating a family of transcription factors, the nuclear factors of activated T cells (NFATs) ( 9 ). In lymphocytes, all four NFAT isoforms are utilized, whereas NFATc1 and NFATc4 are critical transducers in myocytes and neurons, respectively ( 30, 34 ). In addition to NFATs, calcineurin can also dephosphorylate the inhibitory subunit of NF- B, I B ( 4 ).) f% V9 e4 z) s9 ^4 u) }1 ]
/ l9 y. V g7 b4 `- f7 i
Calcineurin is potently inhibited by two of the most commonly used immunosuppressants, cyclosporin A and tacrolimus (FK506) ( 22 ). The drugs inhibit phosphatase activity through their interaction with distinct domains of calcineurin A ( 22 ). Both drugs cause dramatic bone loss in rodents ( 11, 32 ). Their administration to humans together with concurrently administered glucocorticoids (for example, after organ transplant) causes acute, rapid, and severe osteoporosis with a high fracture incidence ( 14, 15 ). This bone loss is mimicked by the osteoporosis seen in the calcineurin A -/- mouse ( 38 ). The latter is, at least in part, caused by a marked bone formation defect resulting from inadequate osteoblast differentiation ( 38 ). The osteoblastic defect is compounded by the effects of glucocorticoids that inhibit canonical Wnt signaling by increasing the production of the Wnt inhibitors SFRP-1 and dickkopf-1 ( 5, 6, 28, 29, 36 ).
0 h/ @# \, F& H; C& C7 X) ^
0 ~. _% l8 f, R$ ECalcineurin and NFATc1 cooperate with the immunoreceptors osteoclast-associated receptor and TREM to play key roles in osteoclast differentiation and the transcription of critical osteoclastic genes ( 10, 17, 21, 41 ). Stem cell precursors from NFATc1 -/- mice fail to form osteoclasts in response to receptor activator of NF- B ligand (RANK-L) ( 40 ). Overexpression of c- fos, an AP-1 transcription factor, rescues this defect ( 18 ). Likewise, NFATc1 overexpression cures the abrogated osteoclastogenesis in c- fos -deficient mice ( 25 ). The effects of NFATc1 and c- jun, another AP-1 transcription factor, are cooperative ( 19 ). These findings are not unexpected as there is structural evidence for cooperativity between NFAT and AP-1 binding sites ( 42 ). In contrast to the positive regulation of osteoclastogenesis, we find that calcineurin overexpression in mature osteoclasts inhibits bone resorption in the pit assay ( 39 ). This makes biological sense because intracellular Ca 2 signals generated by any trigger inhibit bone resorption, whereas they stimulate osteoclast formation ( 43 ). It is possible that a switch from NFATc1 to I B dephosphorylation directs the calcineurin-induced inhibition of bone resorption.6 W& V# E! R* r0 ?5 i
4 n5 S5 j- k9 MIn this study, we explore the action of calcineurin on osteoclast formation. We first examined the expression of calcineurin isoforms NFAT and I B during osteoclastogenesis from osteoclast precursors. Gain-of-function experiments used a cell-permeable calcineurin fusion protein, TAT-calcineurin A, as well as constitutively active NFAT (NFAT ca ). Finally, we conducted loss-of-function studies using calcineurin A -/- precursors, calcineurin inhibitors, dominant-negative NFAT (NFAT dn ), and calcineurin A U1 small nuclear RNA (snRNA). Collectively, the results show that calcineurin is required for a full osteoclastogenic response; that NFATc1, the primary NFAT isoform, is downstream of calcineurin; and that, in addition to its ability to dephosphorylate all NFATs, calcineurin specifically enhances NFATc1 expression in the osteoclast.( V5 s8 [* ^# Y$ R* c
9 I4 k, a- M i) N9 L1 o5 G
MATERIALS AND METHODS
) e o) A: v# v9 f: j( o
1 C& _! j' `' C* }+ }Cell culture and osteoclast formation assays. Gene expression studies were carried out with RAW-C3 osteoclast precursors that were cultured in -MEM and FBS (10% vol/vol) with RANK-L (60 ng/ml) for up to 5 days. RAW-C3 is a mouse macrophage subclone of the original RAW264.7 cells, which, in the presence of RANK-L, differentiates into tartrate-resistant acid phosphatase (TRAP)-positive, multinucleated, bone-resorbing osteoclasts ( 1 ). The cells thus represent a well-characterized model for studying osteoclastogenesis in vitro in the absence of contaminating osteoblasts. Cells were harvested after 3 and 5 days of culture with RANK-L. Three-day cultures had TRAP-positive mono- and multinucleated osteoclasts as well as precursor cells, whereas, at day 5, the population became predominantly osteoclastic.+ @& @3 E j" [( p
s# f6 z$ Z: ?# G. I
In separate experiments, bone marrow cells were isolated from femora and tibias of calcineurin-mutant and wild-type mice in -MEM as described previously ( 1 ) and cultured for 2 days with macrophage colony-stimulating factor (M-CSF; 30 ng/ml). Nonadherent cells were collected and purified by Ficoll-Plus (Amersham Pharmacia, Arlington Heights, IL). They were then incubated with M-CSF (30 ng/ml) and RANK-L (60 ng/ml) for 4-6 days followed by staining for TRAP using a kit (Sigma) per the manufacturer?s instruction. The number of TRAP-positive cells was counted.3 `1 J9 D+ H ^- b- y
2 N- W( b i# @& HTransduction of osteoclast precursors with fusion and mutant proteins. TAT-calcineurin A and TAT-hemaglutinnin (TAT-HA) were prepared as described previously ( 13 ). Osteoclast precursors were incubated with TAT-calcineurin A (200 nM) or TAT-HA (200 nM), just once, for 10 min at 37°C and then reincubated in -MEM for up to 5 days. The cells were then fixed in paraformaldehyde (4%, vol/vol, in PBS; pH 7.4) for 20 min at 20°C and washed with PBS before being exposed to antiserum PP2BA (goat anti-calcineurin A antiserum; Santa Cruz Biotechnology, Santa Cruz, CA) plus a monoclonal anti-TAT antibody or with nonimmune goat or mouse IgG (ABI Advanced Biotechnologies) (all in PBS, 1:100). After 6 h, the coverslips were incubated with donkey FITC-conjugated anti-goat IgG (green) or tetramethylrhodamine isothiocyanate-conjugated anti-mouse IgG (red) (Jackson Immuno Research Laboratories). An epifluorescence microscope (Olympus AX-700) was used to visualize the labeling. 90%) and cytosolic retention time (up to 5 days) have been demonstrated previously ( 13 ).) v! P. y, q/ @0 E+ q
$ T( Y1 J7 ^& O3 O7 _. b5 E4 _
In separate experiments, RAW-C3 cells were transfected with constitutively activated and NFAT dn using standard protocols with the lipofectamine reagent. To synthesize calcineurin A U1 snRNA, the human U1 gene was cloned into pUC19 and designated U1 snRNA stuffer vector ( 24 ). PCR-directed mutagenesis was used to construct the modified U1 snRNA anti-calcineurin A transcript from endogenous U1 snRNA transcripts. The 5' primer (mutagenic primer: CTGTCAGACACCCAAGATCTCATGTCTGACAGGCAGGGGAGAA) contained the Bgl II site (GenBank no. J05479 ). The 3' primer (AGTGCCAAGCTTGCATGCCAGCAGGTC) was extended beyond the Hin dIII site, which is downstream of the U1 termination sequence. The 10-bp target sequence was CTGTCAGACA. The PCR fragments were digested with Bgl II/ Hin dIII and cloned into the U1 snRNA stuffer vector to produce a set of modified U1 snRNAs, designated U1 anti-calcineurin A. DNA sequencing was performed to confirm that the mutations were successfully introduced into the U1 recognition sequence. RAW-C3 cells were cultured in six-well plates (0.9 x 10 6 per well), grown to 90% confluence, and cotransfected, using the Fugene6 transfection kit (Roche), with 5 µg of U1 anti-target DNA and 1.5 µg of SV2neo selection vector. The transfected cultures were selected using 400 µg/ml G418.! C* L4 s3 x+ ?/ M( ~! i1 C2 M
; J# `1 I, u3 e+ s* S N- q6 ^- z2 SQuantitative PCR. Total RNA was extracted with the use of a StrataPrep Total RNA mini-prep kit (Stratagene, La Jolla, CA), per the manufacturer?s protocol. Expression levels of various transcripts were determined by quantitative PCR ( 45 ). RNA (2 µg) was first reverse transcribed into cDNA. A 1/50 ( 10 ng) reverse transcription mixture was utilized for 40-cycle three-step PCR in an ABI Prism 7900HT (Applied Biosystems, Foster City, CA) in 20 mM Tris (pH 8.4), 50 mM KCl, 5 mM MgCl 2, 200 µM dNTPs, 0.5 x SYBR green I (Molecular Probes, Eugene, OR), 200 nM each primer, and 0.5 U Platinum Taq DNA polymerase (Invitrogen).
! Y0 R: X3 C/ @5 L8 |
7 z1 e7 \. S% E& z+ dThe target signal was plotted against the number of PCR cycles, and comparisons between samples were made at the point at which all of the sample reactions were in the linear phase of amplification (the crossing threshold). The intersection of each amplification curve with the threshold yielded a threshold cycle (C T ) value that reflected the relative amount of the original mRNA and cDNA. The initial normalized value in each sample was represented by the C T (target C T - GAPDH C T ). The results were then calculated as the difference between each normalized reporter signal in a treated sample vs. that in control tubes, yielding the C T (treatment C T - control C T ). These were expressed as the increase (in fold) at each time point over the respective GAPDH controls (calculated as 2 CT). Means ± SE were calculated from pooled data from separate experiments, each with triplicate replicates. The method was validated by demonstrating a single band of the expected size for each PCR amplicon by agarose gel electrophoresis ( 45 ). Primer quality was checked routinely by obtaining single sharp peaks with melting point association analysis. These tests established the specificity of each PCR reaction, enabling accurate mRNA quantitation.
1 o- M* a3 D/ R8 J8 Z1 D
, c3 T3 K, }( N% ~: y6 ^6 bRESULTS
! r- U( T. ]- h" z( F
8 l0 F7 j4 }; G3 g% c/ hExpression studies. We first explored whether osteoclast precursors express the calcineurin isoforms. Figure 1 A shows a single PCR band for each of the three isoforms of calcineurin A (,, and ) and the two isoforms for calcineurin B (1 and 2) in RAW-C3 osteoclast precursors. We next quantitated the expression of the calcineurin isoforms, the four isoforms of NFATc (1 through 4), and the NF- B subunits p65, p50, c- Rel, I B, and I B during osteoclastogenesis triggered by RANK-L ( Fig. 1, B - D ). In all cases, results (in fold) are shown with respect to "control conditions," i.e., at day 0 (without RANK-L), and are normalized to GAPDH. At both days 3 and 5 after induction, there was little change in calcineurin isoform expression, except for a modest approximately twofold elevation in calcineurin A and A expression at day 3 ( Fig. 1 B ). However, the expression of NFATc1 was increased by up to 40-fold ( Fig. 1 C ). In contrast, other NFAT isoforms were not affected. No major changes were observed with the NF- B subunits ( Fig. 1 D ). Together, the results suggest that calcineurin expression remains relatively constant throughout osteoclastogenesis, whereas there is a dramatic upregulation of its primary substrate NFATc1.. r) x0 V R; L4 Q
5 B! Y& [. e% e5 e: Q: ^7 \
Fig. 1. Expression of calcineurin A (CNA) and calcineurin B (CNB) isoforms in osteoclast precursors and osteoclasts. A : PCR bands showing the expression of calcineurin isoforms A, A, A, B1, and B2 in RAW-C3 cells. Quantitative PCR (qPCR) results show the expression of the calcineurin ( B ) and nuclear factor of activated T cell (NFAT; C ) isoforms and NF- B components (I B, I B, p65, p50, and c -Rel ) ( D ) in RAW-C3 cells at day 0 (solid bars), 3 (open bars), and 5 (hatched bars) after exposure to receptor activator of NF- B ligand (RANK-L). Results were normalized to GAPDH (control gene) and are expressed as fold increase above day 0. Statistical comparisons were made by unpaired Student?s t -test: * P
# q5 H% _0 [4 L P5 t# J- B8 Z0 g6 h& v( x8 V* a6 y" t# E) n
Gain-of-function studies. For gain-of-function experiments, osteoclast precursors were incubated with TAT-calcineurin A (10 min at 37°C) and stained, following glutaraldehyde fixation, with both anti-TAT (red) and anti-calcineurin A (green) antibodies. Cells transduced with vehicle alone showed only anti-calcineurin A (green) immune labeling, representing endogenous calcineurin A ( Fig. 2 A, top ). However, transduction with TAT-calcineurin A resulted in a precise colocalization of the red and green immunostains within the same cells ( Fig. 2 A, bottom ); this is consistent with the influx of exogenously applied fusion protein that was detected by both antibodies.2 g z1 B0 m' f+ o
) E F6 a: G' Z0 s/ Q; v
Fig. 2. Gain-of-function studies showing the effects of overexpressing calcineurin A (CnA ) as a TAT fusion protein on osteoclast differentiation. A : immunohistochemical detection of TAT-calcineurin A with anti-calcineurin A antiserum (PPB2A, green) and anti-TAT antibody (red) in RAW-C3 cells transduced with TAT-calcineurin A fusion protein (200 nM) or vehicle for 10 min at 37°C. Note the overlapping red and green staining (yellow) after transduction, indicating localization of the fusion protein. Retention time of 90% cellular uptake of TAT-calcineurin A have been demonstrated previously ( 13 ). B : qPCR of RNA isolated from cells transduced with TAT-calcineurin A or TAT-hemaglutinnin (TAT-HA, control) to demonstrate a stimulation of NFATc1 at 3 days after RANK-L exposure. Cyclosporin A (CsA, 1 µg/ml), a calcineurin inhibitor, was used as a control to abolish all endogenous calcineurin activity. C : qPCR of RNA isolated from cells transduced with TAT-calcineurin A with or without dominant-negative NFAT (NFAT dn ) or separately with constitutively active NFAT (NFAT ca ) or empty vector (EV). Cells were first transfected with NFAT dn and then exposed to TAT-HA or TAT-calcineurin A (200 nM each) for 10 min. The expression of osteoclast differentiation markers, namely NFATc1, tartrate-resistant acid phosphatase (TRAP), and integrin 3, were studied at day 5 after RANK-L exposure. In B and C, results were normalized to GAPDH (control gene) and RANK-L-only cells. Open bars in C represent untreated controls. Statistics used unpaired Student?s t -test: * P ) Z+ |! K# e0 Q. }! m2 m5 L
! [/ @/ Q! k: Q5 C5 x
Transduced cells were grown under differentiating conditions in the presence of RANK-L for 5 days. Figure 2 B shows a significant 2.5-fold increase in NFATc1 and I B expression in cells treated with TAT-calcineurin A compared with TAT-HA-treated control cells. Inhibition of calcineurin A by cyclosporin A (1 µg/ml) abrogated NFATc1 expression ( Fig. 2 B ), again establishing specificity.
/ k- d2 @: ?( @$ W
# X( P3 ~; ~! @/ [2 `8 V9 f2 tIn separate experiments, we quantitated the expression of markers of osteoclast differentiation, namely, TRAP and integrin 3. Compared with TAT-HA (control construct) or RANK-L-only cultures, TAT-calcineurin A produced a significant increase in the expression of both TRAP and integrin 3 ( Fig. 2 C ). TAT-HA itself did not increase marker expression compared with RANK-L-only cells. Likewise, transfection of cells with NFAT ca resulted in an increase in both TRAP and integrin 3 expression compared with control empty vector or RANK-L-only cells at day 5, indicating that NFAT directly regulates osteoclast differentiation ( Fig. 2 C ).3 G6 [; V' F9 P1 c0 h5 K- ]0 i( q
# s+ W3 y O; H, l0 I) P8 z* Y
To test whether the effects of NFAT were downstream of calcineurin, osteoclast precursors were cotransduced with TAT-calcineurin A and NFAT dn. The latter almost abolished the stimulation of NFATc1 and TRAP expression at day 5 and significantly attenuated the rise of integrin 3 ( Fig. 2 C ). The results show that calcineurin A promotes osteoclast differentiation via NFATc1.6 F8 t1 \$ D2 T3 Y- q
7 E# k: \4 v% c. W# @
Loss-of-function studies. In parallel loss-of-function studies, we first measured osteoclast formation from bone marrow-derived hematopoetic progenitor cells isolated from calcineurin A / , A /-, and A -/- mice, as well from normal mice after treatment with cyclosporin A or FK506 (0.01, 0.1, or 1 µg/ml). After incubation in the presence of M-CSF and RANK-L for 5 days, hematopoetic precursors differentiated into large, usually multinucleated TRAP-positive osteoclasts ( Fig. 3 A, top ). These cells have been shown previously to resorb bone and express classical osteoclast markers, including calcitonin and vitronectin receptors ( 1 ). Figure 3 A, bottom, and Fig. 3 C indicate that the number of TRAP-positive osteoclasts was significantly reduced in both calcineurin A /- and A -/- mice compared with wild-type littermates. Similarly, Fig. 3, B and D, shows that both calcineurin inhibitors (cyclosporin A and FK506) caused a concentration-dependent decrease in osteoclast formation (shown for FK506 in Fig. 3 B at a lower magnification).
8 X: B& k: r( G2 Y; g' ~' ?/ |0 A) H& o+ K0 k
Fig. 3. Loss-of-function studies. Effect of either calcineurin A gene deletion ( A and C ) or the inhibition of calcineurin enzyme activity by FK506 and calcineurin A ( B and D ) on TRAP-positive osteoclast formation in Ficoll-purified hematopoetic cell cultures treated with M-CSF and RANK-L for 5 days. In D, wild-type and A -/- osteoclast precursors were treated with calcineurin A and FK506 to abrogate all calcineurin activity; results are expressed as percentage of vehicle-treated controls. Solid bars, wild-type controls; open bars, calcineurin-deficient mice. Statistical comparisons, using unpaired Student?s t -test, were made between wild-type and knockout cells (*) or between wild-type groups (^). * P or ^ P % f ~) u9 W& X# O7 A' |5 k0 K
+ t; d. g$ @" W" h8 g4 G# {/ W1 KTo establish specificity, we examined the effect of cyclosporin A and FK506 on osteoclast differentiation in calcineurin A -/- mice. Note that, because these mice have the - and -isoforms intact, we expected a greater attenuation (rather than an abolition) of the response to either drug. Figure 3 D shows that, at every concentration of cyclosporin A and FK506 (except with 1 µg/ml), there was a significantly greater reduction in osteoclast formation in calcineurin A -/- cells than in wild-type cells. This shows that the effects of calcineurin are also exerted, in part, through the - and -isoforms that are suppressible by cyclosporin A and FK506 but remain intact in the A -/- mouse.6 O) }- ?" L' a/ l7 K
# z. \; s4 b0 V2 a- P/ J4 U
To confirm that calcineurin A was a key regulator of osteoclast differentiation, we knocked down this isoform significantly both at the mRNA ( Fig. 4 B ) and protein level ( Fig. 4 A ) using anti-calcineurin A U1 snRNA. Normalized against control empty vector, NFATc1, TRAP, and integrin 3 expression declined significantly at day 5, despite no change in cathepsin K mRNA expression ( Fig. 4 ). This indicated that the calcineurin A was likely the main regulator of NFATc1, TRAP, and integrin 3 expression during osteoclastogenesis. It is also possible that cathepsin K expression was regulated by the other isoforms; this requires further testing.
2 Q6 b3 A( i2 ]' X2 S; Y0 d
& w' U2 R6 n& w1 d& yFig. 4. Specific knock down of calcineurin A using U1 small nuclear RNA (snRNA). Effect of transfecting RAW-C3 cells with anti-calcineurin A (CnA ) U1 snRNA on osteoclast differentiation markers NFATc1, TRAP, integrin 3, and cathepsin K (Cath K) 5 days after RANK-L treatment (open bars) is shown. Note that there is a 50% reduction in the expression of calcineurin A mRNA ( B ) and protein ( A, Western blot) in U1 calcineurin A -transfected cells compared with empty vector transfectants (U1 snRNA). Results have been normalized to GAPDH (control gene) and are expressed as fold increase relative to day 1. Statistical comparisons, using unpaired Student?s t -test, were made with day 1 : * P
) ?$ {" H, ^, x& i" D' T7 j
" L6 B5 N& A# Z: Z4 \! F9 V4 k( u! NFinally, to definitively establish a role for NFAT in RANK-L-induced osteoclastogenesis, osteoclast precursors were transduced with NFAT dn. The first 130 amino acids of NFAT construct abolishes the binding of all NFAT isoforms to calcineurin, thus impairing their nuclear localization and preventing effects on gene transcription ( 7 ). Up to day 4 after induction with RANK-L, NFAT dn -transfected cells formed fewer osteoclasts than vector-only cells ( Fig. 5 ). At day 5, there was no significant difference between the two groups. Together, the results establish that osteoclast differentiation in response to RANK-L is exerted, at least in part, via calcineurin and NFATc1.( d' E5 H) V: a) E: f; \/ |
/ O( {' p! o1 E9 G2 B" D
Fig. 5. Effect of inhibiting NFAT using NFAT dn (open bars) on TRAP-positive osteoclast formation in RAW-C3 cell cultures treated with RANK-L for 5 days. Statistical comparisons, using unpaired Student?s t -test, were made relative to empty vector-transfected cells (solid bars) at all time points: ** P
/ n; z; I% S6 P1 p2 y7 w3 Q
% F6 g# W4 i/ R+ Q: N; Q6 JDISCUSSION
" k1 `4 O T( I7 l
' E" E6 j* m. u7 c WThe study demonstrates that calcineurin, present in the osteoclast precursor, is necessary for a full osteoclastogenesis response. Gain-of-function experiments with TAT-calcineurin A, a transducible fusion protein, showed that calcineurin stimulated osteoclast differentiation, as well as the expression of its major substrate, NFATc1. Likewise, NFAT ca stimulated osteoclast differentiation and NFATc1 expression. The latter finding confirms previous reports indicating that NFATc1 can regulate its own expression as a positive feedback mechanism ( 2 ).6 t/ ^- b- ?( u) v
: B& C8 a& Q+ _6 z9 N' C! p0 Z3 l
NFAT dn, in contrast, inhibited the osteoclast differentiation induced by calcineurin A, indicating that NFAT was downstream of calcineurin. Furthermore, loss-of-function experiments showed that osteoclast differentiation was impaired or abrogated in 1 ) calcineurin A -null osteoclasts, 2 ) bone marrow precursors treated with the calcineurin inhibitors cyclosporin A and FK506, 3 ) RAW-C3 osteoclast precursors transfected with anti-calcineurin A snRNA, and 4 ) osteoclast precursors transfected with NFAT dn. Together, the findings suggest that calcineurin is critical for osteoclastogenesis and that its effect is in part mediated by NFATc1. The studies also suggest that calcineurin regulates the expression of NFATc1 in osteoclasts, in addition to known effects on nuclear translocation ( 3 ).
+ z1 F! c5 H) t; s' F5 x! I" P* Q1 X* U4 Z8 s/ J
Molecular regulation of bone resorption.1 w7 h2 d7 ~; a: l3 b4 ]
4 Q0 ]" Y' c* n) tWe have shown previously that calcineurin inhibits the resorptive activity of mature osteoclasts ( 39 ) and, through this mechanism, likely transduces the effects of intracellular Ca 2 elevations that we have found consistently inhibit osteoclast function ( 26 ). By implication, calcineurin might be a downstream transducer of the effects of the high extracellular Ca 2 concentrations generated during bone resorption ( 35 ). Activated calcineurin could, in this case, dephosphorylate I B, an alternate substrate ( 4 ), thus preventing the nuclear localization of NF- B. The latter is expected to reduce resorption by mature osteoclasts. Our present data show, however, that calcineurin stimulates the differentiation of osteoclasts, as does Ca 2 (unpublished observations). We thus speculate that calcineurin has a dual role in regulating bone resorption: it enhances osteoclast differentiation, while inhibiting the resorptive activity of mature cells ( 39 ). This hypothesis is internally consistent with histomorphometric data from the calcineurin A -/- mouse showing unaffected resorption surfaces in vivo ( 38 ). Precursor cells from this mouse, however, show reduced osteoclastogenic activity in ex vivo cultures. Therefore, it is possible that the inhibition of osteoclast differentiation resulting from calcineurin deletion is balanced by stimulated resorptive activity, with no net effect on resorption surfaces in vivo.
' }( l3 |$ |1 a% C& k
2 P% O( J+ i2 g( r D' Y" b! BWe further hypothesize that NFATc1 is the major substrate for calcineurin during osteoclastogenesis. Consistent with this, there is a dramatic increase in NFATc1 at days 3 and 5. An interesting aspect is that, in addition to activating the nuclear translocation of NFATc1 ( 3 ), a known function of calcineurin, the enzyme also stimulates further expression of its substrate, using NFAT itself. Thus overexpression and abrogation of calcineurin, respectively, stimulate and inhibit NFATc1 expression. Furthermore, the calcineurin-induced enhancement of NFATc1 expression is sharply attenuated by NFAT dn, suggesting that NFAT is downstream of calcineurin. There is also a modest increase of calcineurins A and A during osteoclastogenesis at which time NFATc1 levels are elevated by 40-fold. Finally, calcineurin overexpression also stimulates I B expression in day 5 cultures. This makes biological sense if mature osteoclasts were to use I B as an alternate substrate. In fact, cross-linking studies show that I B competes with NFATc1 for calcineurin binding in vitro ( 4 ). The common PEST domain is required for calcineurin-I B binding, and it is possible that I B uses the same mechanism ( 4 ).
6 {3 e( ^# ^6 ^1 T" r0 y5 s. R, v
Pathophysiological insights.
* z- [, F. C7 F2 t L
2 Y/ `; Q* I! bThese observations are relevant to understanding the pathophysiology of the osteoporosis that is seen with calcineurin (activity) inhibitors cyclosporin A and FK506 ( 11, 14, 15, 32 ). Either drug, used together with high-dose glucocorticoids, causes profound bone loss in both animal models and humans, in the latter having a fracture risk approaching 70% ( 8, 14, 15 ). It has been shown that the osteoporosis, at least at the outset, is of a high-turnover variety, characterized by histomorphometric and biochemical evidence of increased bone resorption ( 11, 32 ). This high-turnover osteoporosis could only be explained by a direct and acute acceleration of the resorptive function of mature osteoclasts occurring as a result of not only calcineurin inhibitor action but also effects of glucocorticoids at high doses ( 12 ). Alternatively, osteoclast activation may be mediated by T lymphocytes as the bone loss is attenuated in T cell-deficient rats ( 32 ). Over time, however, this high-turnover osteoporosis converts to a low-turnover form characterized by low bone formation rates and accompanying decrements in bone resorption. Likely, osteoclastogenesis, and hence bone resorption, becomes impaired with long-standing calcineurin deficiency, as we note in the chronically calcineurin-deprived A -/- mouse ( 38 ). This mouse also develops a profound bone formation defect due to inhibited osteoblast differentiation and is thus severely osteoporotic. This may in fact be relevant to the development of the adynamic phenomenon postrenal transplantation with the use of cyclosporin and FK506 where bone loss is mainly due to a profound impairment of bone formation, even in the face of few active osteoclasts ( 31 ).
, M; R. Y2 l0 ?7 S# W \8 W
/ w; e' i' B& A! WFinally, an interesting clinical paradigm has emerged recently that significantly enhances the importance of our discovery of a key role for calcineurin in bone remodeling. It is now known that the DSCR1 gene, a potent inhibitor of calcineurin activity located on the human chromosome 21, is overexpressed in Down syndrome as a result of trisomy ( 16 ). It is believed that such overexpression results in defects in the development of the brain, immune system, heart, and skeleton in these children. Localization of calcineurin to skeletal cells and the demonstration of its function in bone remodeling might therefore be a first step in understanding the molecular pathophysiology of the skeletal phenotype of Down syndrome.$ V% N( q* U6 Q/ d
0 l5 _ V! G, N1 `" m/ ]- cGRANTS
) B5 V$ |: U' B( r1 A! A8 m2 p& \! W7 ]4 ]; l1 G, B1 l
The study was supported by grants to M. Zaidi from the National Institutes of Health (Grants RO1 AG-14197, DK-70526, and AG-23176). M. Zaidi and B. S. Moonga also acknowledge support from the Department of Veterans Affairs (Merit Review).
' J. j! |, X* j" C% P$ N5 `2 P% H! ^6 p( ?, b
ACKNOWLEDGMENTS
: L6 ]6 X4 Z3 f
- W$ @0 e; g5 u( QWe are grateful to Drs. D. O?Conner and J. G. Seidman (Harvard Medical School) for providing the A -/- knockout mouse. We also acknowledge Dr. William C. W. Chow from Albert Einstein College of Medicine for providing the mutated NFAT constructs.
( A3 P4 ^8 T' _, i& F 【参考文献】 z2 ~8 X: |0 Z' T4 c( P& ?# A0 G
Abe E, Marians RC, Yu W, Wu XB, Ando T, Li Y, Iqbal J, Eldiery L, Rajendren G, Blair HC, Davies TF, Zaidi M. TSH is a negative regulator of skeletal remodeling. Cell 115: 151-162, 2003.
+ x' Y' B3 T- I1 X: r8 t! O: V1 }
; r# A" O" j2 q7 s. P0 D
0 J# r* u$ X, v& K9 IAsagiri M, Sato K, Usami T, Ochi S, Nishina H, Yoshida H, Morita I, Wagner EF, Mak TW, Serfling E, Takayanagi H. Autoamplification of NFATc1 expression determines its essential role in bone homeostasis. J Exp Med 202: 1261-1269, 2005.
, G8 S2 C) p+ S6 U( l! x5 B& V& S& k* {8 b3 R
{/ \2 i0 V5 w! }2 ]8 G6 N
) c# D2 J+ l9 ?' x0 JBeals CR, Clipstone NA, Ho SN, Crabtree GR. Nuclear localization of NF-ATc by a calcineurin-dependent, cyclosporin-sensitive intramolecular interaction. Genes Dev 11: 824-834, 1997.8 T7 ~8 D+ [" t- d, r. `
: [& X3 \" m3 B/ o, `6 v6 r
5 B6 v6 T* k8 z! T1 v8 A6 L
. k3 j# Z: ]% k" n$ ~; w' }
Biswas G, Anandathreethavarada HK, Zaidi M, Avadhani NG. Mitochondria-to-nucleus stress signaling: a distinctive mechanism of NF B/Rel activation through calcineurin mediated inactivation of I B. J Cell Biol 161: 507-519, 2003.+ I; G6 W: Z$ B4 A. i0 K* X* \
* _3 d6 I& F1 \0 `8 R6 z) I
+ d1 L' ?: I9 _) I# Z. P( v
, Y, _5 ~0 F, I/ g4 X6 G
Bodine PV, Billiard J, Moran RA, Ponce-de-Leon H, McLarney S, Mangine A, Scrimo MJ, Bhat RA, Stauffer B, Green J, Stein GS, Lian JB, Komm BS. The Wnt antagonist secreted frizzled-related protein-1 controls osteoblast and osteocyte apoptosis. J Cell Biochem 96: 1212-1230, 2005.
- c: R/ n4 G3 P" @& `! Y, s8 I1 ]$ d
2 y' X$ O0 _0 g& {: L
( _6 p4 H5 j" f3 `# |4 x* NBodine PV, Zhao W, Kharode YP, Bex FJ, Lambert AJ, Goad MB, Gaur T, Stein GS, Lian JB, Komm BS. The Wnt antagonist secreted frizzled-related protein-1 is a negative regulator of trabecular bone formation in adult mice. Mol Endocrinol 18: 1222-1237, 2004.
. ]$ ^* @, f7 O# H; L2 a
. l$ v1 a7 ], [: K, B8 [. q0 s6 g* C8 B9 \6 n0 [9 W2 q! p; ]
- u& M# Q7 F! o2 C8 V3 e5 cChow CW, Rincon M, Davies RJ. Requirement for transcription factor NFAT in interleukin-2 expression. Mol Cell Biol 19: 2300-2307, 1999.
+ u' H$ Y$ b$ T `# t+ S6 P+ g
, {/ J* r1 M8 f3 x4 I: W: Q$ o# [ B$ f
/ U: S; U) j8 U3 q1 B1 u4 zCohen A, Sambrook P, Shane E. Management of bone loss after organ transplantation. J Bone Miner Res 19: 1919-1932, 2004.
) G$ D9 B9 [; q; _& T+ s9 j
& B2 P& L; V2 N6 \% s6 |. ?6 t! }
: [5 M/ A; |4 `) J& C
Crabtree GR. Calcium, calcineurin, and the control of transcription. J Biol Chem 276: 2313-2316, 2001.
/ R, `$ i1 a, ]0 \- N1 p0 k# h$ X* }& `1 ^1 P
$ o# J! {5 u: I7 t$ I" m% o
8 j- T5 B+ k; t. Q+ p! y$ uCrotti TN, Flannery M, Walsh NC, Fleming JD, Goldring SR, McHugh KP. NFATc1 regulation of the human 3 integrin promoter in osteoclast differentiation. Gene 372: 92-102, 2006.5 }0 O" W" {- K
! c T2 k7 m+ }" B
6 m1 A$ G4 O8 e* X, x! i- \0 O8 b8 b; [" X9 t4 e
Cvetkovic M, Mann GN, Romero DF, Liang XG, Ma Y, Jee WS, Epstein S. The deleterious effects of long-term cyclosporine A, cyclosporine G, and FK506 on bone mineral metabolism in vivo. Transplantation 57: 1231-1237, 1994.
' i' b1 x( S1 E- B/ f9 q0 ]" A% n r' i/ a3 V! {9 G) g0 s
/ o9 u" k! [2 \1 ~- B
, W3 _; k/ g4 k9 e4 A7 \2 T& cDalle Carbonare L, Bertoldo F, Valenti MT, Zenari S, Zanatta M, Sella S, Giannini S, Cascio VL. Histomorphometric analysis of glucocorticoid-induced osteoporosis. Micron 36: 645-652, 2005.5 a0 K4 k' {% t! h
) r: X/ H+ [& D( `1 Z( d! t ]; Z) x9 \) p: F/ c" x# h" ]0 c* p
5 t7 w& C- n$ y* ]! r- b' k6 ?5 w8 f' a
Dolgilevich S, Zaidi N, Song J, Abe E, Moonga BS, Sun L. Transduction of TAT fusion proteins into osteoclasts and osteoblasts. Biochem Biophys Res Commun 299: 505-509, 2002.
. T8 Q# S: H8 S! f/ W/ u5 s2 G) n* j4 C0 V7 B7 Y7 A
- t0 `! s% k4 l" e' ]: {5 o/ ~7 [) s4 r1 |/ T
Epstein S, Shane E, Bilezikian JP. Organ transplantation and osteoporosis. Curr Opin Rheumatol 7: 255-261, 1995.
b( j; K1 k4 R( l" [$ A F
5 }3 Y# n' u4 `4 l' {) {- W, g7 _ u: I
! l: V5 P) b; r* BEpstein S, Inzerillo AM, Caminis J, Zaidi M. Disorders associated with acute rapid and severe bone loss. J Bone Miner Res 18: 2083-2094, 2003.
8 J3 ]1 Q- x. x2 c3 W' ?6 |: o e2 q, z3 S" Q5 [, h$ d' u
% s+ ?( k8 ` d+ _& l
: F" x* K O; X6 uFuentes JJ, Genesca L, Kingsbury TJ, Cunningham KW, Perez-Riba M, Estivill X, de la Luna S. DSCR1, overexpressed in Down syndrome, is an inhibitor of calcineurin-mediated signaling pathways. Hum Mol Genet 9: 1681-1690, 2000.* h- x& c4 e4 }) D
9 t% Y [! `2 b
0 n3 N1 Y# \" K' D) O% M
4 E- p: v, o- d, HGohda J, Akiyama T, Koga T, Takayanagi H, Tanaka S, Inoue J. RANK-mediated amplification of TRAF6 signaling leads to NFATc1 induction during osteoclastogenesis. EMBO J 24: 790-799, 2005.7 l3 H+ ^5 Q& Z7 Q( A# \! o+ D
+ D3 i/ V9 ?( o) u; Z! t0 F W' S$ Y" W/ H
3 o: m0 c9 u7 B' b7 } L2 v
Hirotani H, Tuohy NA, Woo JT, Stern PH, Clipstone NA. The calcineurin/nuclear factor of activated T cells signaling pathway regulates osteoclastogenesis in RAW264.7 cells. J Biol Chem 279: 13984-13992, 2004.2 l% G! ^! U+ k6 o
' U! u; M- _+ {0 u8 e5 C' m3 v
' A" e/ ?! P2 E' o6 D9 E+ m2 S
7 S' v: P# X8 v7 ^Ikeda F, Nishimura R, Matsubara T, Tanaka S, Inoue J, Reddy SV, Hata K, Yamashita K, Hiraga T, Watanabe T, Kukita T, Yoshioka K, Rao A, Yoneda T. Critical roles of c-Jun signaling in regulation of NFAT family and RANKL-regulated osteoclast differentiation. J Clin Invest 114: 475-484, 2004.
( D2 ]* U2 A$ U/ ]! q
5 a3 l/ v0 v$ Q6 g# X. T' Q' Q
1 p0 T0 Z- n9 l$ u8 U2 \3 s
# t5 M1 C' c- qKayyali US, Zhang W, Yee AG, Seidman JG, Potter H. Cytoskeletal changes in the brains of mice lacking calcineurin A. J Neurochem 68: 1668-1678, 1997.
. ]2 m/ C' d7 d" T: j5 Y& n/ A- e6 X4 y
4 L/ T' j t) B- s8 v o3 u1 A6 j: |, J( \. A7 B
Kim Y, Sato K, Asagiri M, Morita I, Soma K, Takayanagi H. Contribution of nuclear factor of activated T cells c1 to the transcriptional control of immunoreceptor osteoclast-associated receptor but not triggering receptor expressed by myeloid cells-2 during osteoclastogenesis. J Biol Chem 280: 32905-32913, 2005.
& X) u; B, b6 s% Q# Y) D# C/ q' S1 a7 x
! k! y1 [' \- m; R* u; ?" P
' h) u: Q8 |5 cKlee CB, Crouch TH, Krinks MH. Calcineurin: a calcium- and calmodulin-binding protein of the nervous system. Proc Natl Acad Sci USA 76: 6270-6273, 1980.
/ A& t0 P! a7 C. f& x8 G% L5 W# l" H9 N% A$ @0 v0 L; \/ [
# w \/ ]+ g/ }$ t! x
% t; }( j$ V' O+ v- oKlee CB, Draetta GF, Hubbard MJ. Calcineurin. Adv Enzymol Relat Areas Mol Biol 61: 149-200, 1988.
& N, u# h5 v$ [2 p' g: o' _, y3 E8 V, p
# B( _/ W/ K: W
5 ^( }7 w2 B# p2 O [7 A# ~
Liu P, Gucwa A, Stover ML, Buck E, Lichter A, Rowe D. Analysis of inhibitory action of modified U1 snRNAs on target gene expression: discrimination of two RNA targets differing by a 1 bp mismatch. Nucleic Acids Res 30: 2329-2339, 2002.6 K5 f, r$ p9 y N- |
8 L g3 r; W7 |1 q0 R4 J I& m: J% S& D6 B! u) c& q. w( v; r6 M1 `: z
0 q7 A3 H3 _/ B+ Y$ _. T
Matsuo K, Galson DL, Zhao C, Peng L, Laplace C, Wang KZ, Bachler MA, Amano H, Aburatani H, Ishikawa H, Wagner EF. Nuclear factor of activated T-cells (NFAT) rescues osteoclastogenesis in precursors lacking c-Fos. J Biol Chem 279: 26475-26480, 2004.8 z& W. F3 [: S
! x6 `1 }& j+ I" x# L3 d. T
# {- B7 W1 A% `1 J+ q( W4 R4 @: }2 g0 h# b- f& ?; x7 q+ p
Moonga BS, Moss DW, Patchell A, Zaidi M. Intracellular regulation of enzyme secretion from rat osteoclasts and evidence for a functional role in bone resorption. J Physiol 429: 29-45, 1990.0 b* D5 w K' X9 W* ?
0 J3 d5 Z. I, \* b$ D% v; j8 D5 i9 ?8 l8 F8 j4 {- h
1 H. N" w% s8 d8 @Norris CM, Kadish I, Blalock EM, Chen KC, Thibault V, Porter NM, Landfield PW, Kraner SD. Calcineurin triggers reactive/inflammatory processes in astrocytes and is upregulated in aging and Alzheimer?s models. J Neurosci 25: 4649-4658, 2005.
9 S( j* d) U! g/ \: P& \7 f) ?' C7 d' d! r
5 @: e k# E5 E$ x5 z! ?
3 J7 B- n% K- _8 X. i
Ohnaka K, Tanabe M, Kawate H, Nawata H, Takayanagi R. Glucocorticoid suppresses the canonical Wnt signal in cultured human osteoblasts. Biochem Biophys Res Commun 329: 177-181, 2005.
) e4 O5 Y7 ], e1 U" {" B u! O- @, T' w' x2 @5 v# W7 m' L
$ o4 @# m/ k* W8 P4 C8 \/ C
/ b+ G* `* R# k, x. F: D; v/ ^: j" o4 Z
Ohnaka K, Taniguchi H, Kawate H, Nawata H, Takayanagi R. Glucocorticoid enhances the expression of dickkopf-1 in human osteoblasts: novel mechanism of glucocorticoid-induced osteoporosis. Biochem Biophys Res Commun 318: 259-264, 2004.
1 R2 @, L7 x: q$ H+ Q; f7 U: q4 ^! S: @
5 s$ C% h2 q, C, y6 A
" w- p0 Y+ R% }7 G2 P* @Ranger AM, Grusby MJ, Hodge MR, Gravallese EM, de la Brousse FC, Hoev T, Mickanin C, Baldwin HS, Glimcher LH. The transcription factor NF-ATc is essential for cardiac valve formation. Nature 392: 186-190, 1998.
) Y, u' v' z# H& J3 i S3 y w% }0 n9 y. N- l
U5 e! ~4 P5 ^ u0 _6 N" H7 w8 }4 o
Sanchez CP, Salusky IB, Kuizon BD, Ramirez JA, Gales B, Ettenger RB, Goodman WG. Bone disease in children and adolescents undergoing successful renal transplantation. Kidney Int 53: 1358-1364, 1998.# R# _, s0 H$ i1 S, x Y/ s; |0 S
; q: _* v0 q9 ~" Z4 l' q D
# _" B6 K# n3 O& M& A8 s( m4 D/ E" V. C7 `
Sass DA, Bowman AR, Yuan Z, Ma Y, Jee WS, Epstein S. Alendronate prevents cyclosporin A-induced osteopenia in the rat. Bone 21: 65-70, 1997.
. C0 t& C2 @! n+ W7 @8 T( \1 T( p$ @* w! [) O; q2 w
* M9 l5 c! k: w
. O. e8 y1 ^8 @% a5 l6 r1 F
Shibasaki F, Hallin U, Hiroyuki U. Calcineurin as a multifunctional regulator. J Biochem (Tokyo) 131: 1-15, 2002.
! d: `# ~2 d. m/ J0 |- P9 c. B m! b* }: O9 v' X
/ Z+ N! T2 z9 @
# \3 w6 z+ d- Q K" @5 z6 B) c
Shibasaki F, Price ER, Milan D, McKeon F. Role of kinases and the phosphatase calcineurin in the nuclear shuttling of transcription factor NF-AT4. Nature 382: 370-373, 1996.
6 r2 f# F4 b( Z7 h
- O+ D; D3 `/ z! N I4 w8 x& @6 K# M) @& z
: H P1 Z# m/ BSilver IA, Murrills RJ, Etherington DJ. Microelectrode studies on the acid microenvironment beneath adherent macrophages and osteoclasts. Exp Cell Res 175: 266-276, 1988.5 v; g; I ~- i7 K! P) x
9 E* N7 L# \$ i4 A
/ A$ g! S ]( w, `# ^) t- {; b
/ N2 x# N: h+ X, g7 ]/ T% ~6 sSmith E, Frenkel B. Glucocorticoids inhibit the transcriptional activity of LEF/TCF in differentiating osteoblasts in a glycogen synthase kinase-3 -dependent and-independent manner. J Biol Chem 280: 2388-2394, 2005.
& \* r# V6 }4 M0 f. W( N' w* P. }- s" K# e! }6 z4 I
3 \/ W. ^ m3 D5 g# B' \. X
2 l1 e/ @" k2 g8 u" U) |+ ^Sugiura R, Sio SO, Shuntoh H, Kuno T. Molecular genetic analysis of the calcineurin signaling pathways. Cell Mol Life Sci 55: 278-288, 2001.
- m6 c0 R8 i5 m
4 R& v" C. C$ |0 o1 @* V" |! t$ \; P$ u+ B. U
+ k, Y' {+ Z3 n1 A! j% s! O
Sun L, Blair HC, Peng Y, Zaidi N, Adebanjo OA, Wu XB, Wu XY, Epstein S, Abe E, Blair HC, Moonga BS, Zaidi M. Calcineurin regulates bone formation by the osteoblast. Proc Natl Acad Sci USA 102: 17130-17135, 2005.
5 q2 `2 U* B7 ~( z9 j& q
) J# z6 x4 u- c# M: G
a" P; b" v9 R" l' `
% B! E1 o- @; f6 p" nSun L, Moonga BS, Lu M, Zaidi N, Iqbal J, Blair HC, Epstein S, Abe E, Troen BR, Huang CLH, Zaidi M. Molecular cloning, expression, and function of osteoclastic calcineurin A. Am J Physiol Renal Physiol 284: F575-F583, 2003.$ d7 e2 p: c- ?, N' S. \) M+ `. S
/ X+ n' }0 W' {; F, X
9 v# Z; H4 H- F J4 v
# j6 n; e- V8 i9 G3 v' B! hTakayanagi H. Mechanistic insight into osteoclast differentiation in osteoimmunology. J Mol Med 83: 170-179, 2005./ K6 Z4 c: M; v- |3 T- w/ J+ q5 g, d
9 N$ m7 @5 y& s& e( T4 z( O' N, l0 ~) w
: F, c. {, ~6 H9 f
. |- n. F1 |" k7 ?3 V( m2 vTakayanagi H, Kim S, Koga T, Nishina H, Isshiki M, Yoshida H, Saiura A, Isobe M, Yokochi T, Inoue J, Wagner EF, Mak TW, Kodama T, Taniguchi T. Induction and activation of the transcription factor NFATc1 (NFAT2) integrate RANKL signaling in terminal differentiation of osteoclasts. Dev Cell 3: 889-901, 2002.
3 @8 s5 Y7 z+ s3 R/ P2 b, {4 p i# b( d) c# C$ f2 Y, |
! f9 E, k6 Z6 j0 B8 b) q, y! U5 T: h
Wisniewska M, Pyrzynska B, Kaminska B. Impaired AP-1 dimers and NFAT complex formation in immature thymocytes during in vivo glucocorticoid-induced apoptosis. Cell Biol Int 28: 773-780, 2004.+ O: O1 ^ J& r* Z$ J
5 @6 m2 z1 f8 P2 k, g' Q& m+ \6 F& W+ `
; @0 b a q# c
Zaidi M, Adebanjo OA, Moonga BS, Sun L, Huang CLH. Emerging insights into the role of calcium ions in osteoclast regulation. J Bone Miner Res 14: 669-674, 1999.4 V5 T& g% x# n1 v2 y! B4 r+ T+ g
9 Q( Q& Z( B! O/ i4 g" S& }5 B6 Z* i) Q# F: x
% _$ W$ m1 N) a4 F& w! Y
Zhang W, Zimmer G, Chen J, Ladd D, Li E, Alt FW, Wiederrecht G, Cryan J, O?Neill EA, Seidman CE, Abbas AK, Seidman JG. T cell responses in calcineurin A -deficient mice. J Exp Med 183: 413-420, 1996.
- O* ~ U- @2 I" I: M1 c8 V7 t3 W8 S' J; M$ I- t3 N
5 R& a1 y! J7 H8 s6 K) }
+ R# d, ]; L9 y) n1 ]* ^
Zhu LL, Zaidi S, Moonga BS, Troen BR, Sun L. RANK-L induces the expression of NFATc1, but not of NF B subunits during osteoclast formation. Biochem Biophys Res Commun 326: 131-135, 2005. |
|