Bone Marrow Cells Transdifferentiate to Cardiomyocytes When Introduced into the - 《stemcells》干细胞学杂志干细胞之家



免疫细胞治疗专区	欢迎关注干细胞微信公众号

12 3 4 5 6 7 8 9 10 ... 28 下一页

返回列表

查看: 580804\|回复: 277	go Bone Marrow Cells Transdifferentiate to Cardiomyocytes When Introduced into the [复制链接]

江边孤钓

版主

Rank: 7 Rank: 7 Rank: 7

积分: 0
威望: 0
包包: 483

楼主

发表于 2009-3-5 00:06 |只看该作者 |倒序浏览 |打印

作者：Carol A. Eisenberga, John B.E. Burchb, Leonard M. Eisenberga作者单位：a Department of Cell Biology and Anatomy, Medical University of South Carolina, Charleston, South Carolina, USA;b Cell Developmental Biology Program, Fox Chase Cancer Center, Philadelphia, Pennsylvania, USA   ?( E1 {& _7 u) m  t. V, n
   ) t9 r: J: D" {
   ! z0 @5 ?$ A* t. h: I

                       c1 M! _7 G4 S


         ) \# R- t7 k: A% t! D) G7 ~



      ' L+ ?/ O  U4 h) c2 p3 ?

      【摘要】
   Since rates of cardiomyocyte generation in the embryo are much higher than within the adult, we explored whether the embryonic heart would serve as useful experimental system for examining the myocardial potential of adult stem cells. Previously, we reported that the long-term culturing of adult mouse bone marrow produced a cell population that was both highly enriched for macrophages and cardiac competent. In this study, the myocardial potential of this cell population was analyzed in greater detail using the embryonic chick heart as recipient tissue. Experiments involving the co-incubation of labeled bone marrow cells with embryonic heart tissue showed that bone marrow (BM) cells incorporated into the myocardium and immunostained for myocyte proteins. Reverse transcription-polymerase chain reaction analysis demonstrated that the heart tissue induced bone marrow cells to express the differentiated cardiomyocyte marker -cardiac myosin heavy chain. The cardiomyocyte conversion of the bone marrow cells was verified by harvesting donor cells from mice that were genetically labeled with a myocardial-specific &szlig;-galactosidase reporter. Embryonic hearts exposed to the transgenic bone marrow in culture exhibited significant numbers of &szlig;-galactosidase-positive cells, indicating the presence of bone marrow-derived cells that had converted to a myocardial phenotype. Furthermore, when transgenic mouse BM cells were injected into living chick embryos, donor cells incorporated into the developing heart and exhibited a myocardial phenotype. Immunofluorescence analysis demonstrated that donor BM cells exhibiting myocyte markers contained only nuclei from mouse cells, indicating that differentiation and not cell fusion was the predominant mechanism for the acquisition of a myocyte phenotype. These data confirm that adult mouse bone marrow contain cells with the ability to form cardiomyocytes. In addition, the predominance of the macrophage phenotype within the donor bone marrow cell population suggests that transdifferentiation of immune response cells may play a role in cellular regeneration in the adult. 5 D1 W' b6 m) L# n$ `
      【关键词】 Cardiac Myocardium Transdifferentiation Stem cells Bone marrow Macrophages
   INTRODUCTION

Evidence has been presented by several laboratories that stem cells exist in the adult bone marrow, possessing the capacity to generate new cardiomyocytes . However, several other factors may account for the divergent experimental outcomes, because the procedures are complex, and significant experimental variations may exist among the different studies. For example, variables that may contribute to distinct experimental outcomes include the extent and localization of the induced infarct, variations in the stem cell populations used, and the precise protocol for delivering the stem cells into the wounded myocardium. Another possible variable is the processing of the hearts following the experimental interventions, because the use of frozen sections may not have fully preserved the damaged cardiac tissue and could account for negative assessments on the contributions of injected stem cells to the infarcted myocardium. Thus, the complexities of the procedures involved using infarcted adult heart tissue may constrict its use as an assay for directly assessing the myocardial potential of a cell population.& w% _* L4 l# X- Z7 c/ S

An environment that may be more conducive in permitting cardiac-competent cells to realize their myocardial potential is the embryonic heart. Since the rate of cardiomyocyte generation within the embryo is far greater than within the adult . Upon exposure to the embryonic heart explants, bone marrow cells displayed an ability to incorporate into the cardiac tissue and express muscle proteins. Although we observed evidence of cardiomyocyte formation from hematopoietic stem cells, surprisingly, the bone marrow cell population that appeared to exhibit the most consistent ability to transdifferentiate to a myocardial phenotype were macrophages. To follow up on that intriguing but preliminary observation, we have undertaken a more rigorous examination of the myocardial competence of adult mouse bone marrow macrophages, both by exposing these cells to embryonic heart tissue in culture and by direct microinjection into the hearts of living chick embryos. The results presented here conclusively show that cells from the adult bone marrow possess myocardial potential and demonstrate the utility of the embryonic chick as a vehicle for testing cell phenotypic potential.
+ ?1 k$ g  F7 Z/ p. x
MATERIALS AND METHODS0 H2 X( k+ _8 b. J4 L, l
+ v( L; }0 G) ~) g2 W
Bone Marrow Isolation and Culture8 p* x0 u) y: b! v: v
7 T: b  m3 }) {9 G+ Q7 S7 O7 [
Whole bone marrow was isolated from femurs of 8¨C12-week-old wild-type ICR, transgenic enhanced green fluorescent protein (EGFP) .

Coculture of Embryonic Cardiac Tissue Explants and Bone Marrow
  [, x$ B7 O$ T$ m! E5 }
Chick eggs were incubated for 2¨C2.5 days to develop embryos corresponding to Hamburger and Hamiliton (HH) stage 16 .

Microinjection and Culture of Embryos8 s5 z* H* c, f7 n. @' [9 ]+ N
0 N* Q7 ]1 C2 b; G0 M2 D+ E& S
Fertilized chicken eggs were allowed to develop in a 37¡ãC egg incubator until HH stage 19¨C21. On the 3rd day, the eggs were cracked, and the entire contents including the albumen, yolk, and developing embryo carefully transferred to a plastic weigh boat, with the embryo oriented to lie on top. With the aid of a dissecting microscope, mouse donor cells were injected via a beveled-edged glass needle connected to a syringe, with microinjection volumes ranging from 0.5 to 10 µl. After injection, embryos were covered with a round 100-mm Petri dish and returned to the incubator for 2¨C3 more days.

Xgal and Immunofluorescent Staining
: e) a4 e/ e/ ]- R/ `/ |+ u
lacZ expression was determined by assaying for ß-galactosidase activity, as visualized by Xgal staining. Explants and embryos were fixed in 4% paraformaldehyde and rinsed several times with 100 mM sodium phosphate (pH 7.3), 2 mM MgCl2, 0.01% sodium deoxycholate, 0.02% NP-40. Subsequent staining reactions with 5 mM potassium ferrocyanide and 1 mg/ml Xgal were closely monitored for color changes, which were stopped using 10% formalin. For the embryos, clearing of the tissue with methyl salicylate was required. Immunohistochemistry was performed using previously described protocols . Cultures were methanol- or paraformaldehyde-fixed and then exposed to individual primary antibodies for specific molecular detection. The mouse monoclonal antibodies used to detect the nuclear marker QCPN, titin (9D10), and sarcomeric myosin heavy chain (MF20) were generated by Bruce Carlson, Jean Carlson, Marion Greaser, and Donald Fischman and obtained from the Developmental Studies Hybridoma Bank (developed under the auspices of the NICHD and maintained by The University of Iowa, Department of Biological Sciences, Iowa City, IA, http://www.uiowa.edu/~dshbwww/). Tissue was also stained with mouse and rabbit antibodies purchased from Sigma that were specific for sarcomeric -actinin and N-cadherin, respectively. For ß-galactosidase detection, a protein-specific antibody (Rockland Immunochemicals, Inc, Gilbertsville, PA, http://www.rockland-inc.com) was added to live cells. Live cultures were washed once with sterile Dulbecco¡¯s phosphate-buffered saline (DPBS) following by a 30-minute incubation on ice with the primary antibody diluted 1:50 in DPBS with 10% dimethyl sulfoxide plus 10% goat serum. After two washes in DPBS, cultures were fixed with 4% buffered paraformaldehyde for 30 minutes at room temperature. Immunostaining for these various molecules was visualized following a 1 hour incubation at room temperature with the appropriate fluorescein- and rhodamine-labeled secondary antibodies (Jackson Immunoresearch Laboratories, West Grove, PA, http://www.jacksonimmuno.com) and several DPBS washes. Secondary antibodies used in this study were anti-mouse IgG (for QCPN, MF20, and -actinin), anti-mouse IgM (for titin), and anti-rabbit IgG (for N-cadherin and ß-galactosidase). After immunostaining, selected cultures were counterstained with 4',6-diamidino-2-phenyindole (DAPI; In-vitrogen, Carlsbad, CA, http://www.invitrogen.com) to detect nuclei.2 `2 X1 T2 i1 {6 y9 }% k, @9 J9 ~% s: O

Reverse Transcription-Polymerase Chain Reaction Analysis1 A7 A# q' U, C! d6 B7 ?$ W& U
5 m/ w; j8 v( Y
RNA was harvested from cultures and excised embryonic hearts using RNeasy kits (Qiagen, Valencia, CA, http://www1.qiagen.com). OneStep reverse transcription-polymerase chain reaction (RT-PCR) kits (Qiagen) were then used to amplify RNA template. Template concentrations were first normalized by 25 cycles of RT-PCR amplification for both mouse and chick homologs of glyceraldehyde-3-phosphate dehydrogenase (GAPDH). Thereafter, equal amounts of template were subjected to 30 amplification cycles with cardiac gene-specific primers, with each reaction run in parallel using the iCycler gradient thermal cycler (Bio-Rad, Hercules, CA, http://www.bio-rad.com). The hybridization temperatures for amplifying each of the cardiac genes were previously optimized for the individual primer sets. Primer sequences used in this study were mouse GAPDH (accacagtccatgccatcac tccaccaccctgt-tgctgta), mouse -cardiac myosin heavy chain (MyHC) (ggaagagtgagcggcgcatcaagg ctgctggagaggttattcctcg), chick GAPDH (acgccatcactatcttccag cagccttcactaccctcttg), and chick Nkx2.5 (ccttccccggcccctactac ctgctgcttgaaccttctct). To verify the size of the amplified DNA fragments, PCRs were run in parallel with molecular weight markers on gels made from DNA agar (Marine BioProducts, BC, Canada, http://www.marbio.com).

RESULTS
3 l4 z, Z8 I3 J* ?0 x  ?
Coculture of Bone Marrow Macrophages with Embryonic Heart Tissue
! w$ \' D4 r! X4 G8 I& `
Macrophages were obtained from adult mouse bone marrow by selection of cells that are able to survive long-term incubation on hydrophobic, bacterial-grade plastic dishes. As reported previously, these cultures produced highly enriched populations of macrophages, as established by both functional assays and phenotypic analyses . Moreover, when these cells were placed in methylcellulose cultures and histochemically stained, they displayed the typical vacuolated phenotype of a macrophage (Fig. 1). No other cell phenotypes were observed under these conditions. Thus, by these criteria, macrophages appear to be the predominant cell type selected in the LT-BM cultures.

Figure 1. Long-term bone marrow (LT-BM) cells exhibit a macrophage phenotype. LT-BM cells were harvested, placed in methylcellulose cultures, and stained with May-Gr¨¹nwald-Giemsa (MGG) dye. Low-magnification (A) and high-magnification (B) views of MGG-stained methylcellulose cultures of LT-BM cells demonstrate a phenotypically pure population of cells that exhibit the gray cytoplasm, purple nucleus, and vacuolated morphology typical of a differentiated macrophage. Scale bars = 25 µm.  K- P& W+ [) D( K. F; }* u

The myocardial potential of the adult mouse bone marrow macrophages was examined by their co-incubation with embryonic chick heart tissue. Hearts were removed from tubular stage chick embryos (HH stage 16) and briefly exposed to trypsin to produce small fragments of contractile tissue. Following the attachment of the cardiac tissue to the culture plastic, LT-BM cells were added to the wells, and the cocultures were incubated for 4 days prior to immunohistochemical analysis. To facilitate their identification within the cocultures, bone marrow cells were obtained from enhanced green fluorescent protein (EGFP)-expressing transgenic mice. Figures 2A and 2B show confocal microscopy optical z-series projections of contractile chick heart fragments within the cocultures, which have been stained for expression of either sarcomeric MyHC or sarcomeric -actinin, respectively. As is typically observed, multiple BM cells will rest either on top of or circumferential to individual cardiac fragments. In addition, some of these cells will integrate into the cardiac tissue and appear to exhibit muscle protein expression. Better evidence for this latter assertion is provided by images of optically sectioned tissue, which show EGFP-labeled cells that had incorporated into the heart explants (Fig. 2C¨C2F). In these instances, the LT-BM cells that had integrated into myocardial tissue stained positive for sarcomeric -actinin.& T  p3 m% l; S6 e* X: B

Figure 2. Long-term bone marrow (LT-BM) cells incorporate into cardiac tissue and express cardiac proteins. LT-BM cells obtained from enhanced green fluorescent protein (EGFP)-expressing transgenic mice were co-incubated with embryonic chick heart tissue for 4 days. Cultures were stained for sarcomeric MyHC (A) or -actinin (B¨CF) (red) and imaged by confocal microscopy. (A): Cocultured tissue displayed as a z-series projection showing the association of multiple EGFP-labeled LT-BM cells with the heart tissue. (B): Low-magnification view of an -actinin-immunostained heart fragment displaying a cluster of EGFP-positive cells (arrow), which shown at high magnification (C) in optical section appears to exhibit cells displaying dual EGFP and -actinin fluorescence (arrows). (D): An optical section of a cocultured heart explant showing an EGFP-marked adult mouse bone marrow cell (arrow) that has integrated into the myocardium and exhibits -actinin expression. (E, F): Optically sectioned contractile cardiac tissue fragment, which contains an EGFP-positive mouse donor cell (arrow). For this explant, the optical section is exhibited for -actinin staining only (E) or both -actinin and EGFP labeling (F). The juxtaposition of (E) and (F) demonstrates that the LT-BM cell exhibits positive reactivity for the sarcomeric protein. Scale bars = 20 µm.
: v, U$ N" k% v+ m% `
Another means to identify cell origin is to immunostain cultures for markers that are expressed by mouse but not chick tissue. Surprisingly, we found such a marker in the QCPN antibody, which has been well characterized previously for its ability to label cells of quail but not chick origin . The shared N-cadherin positive cell borders of QCPN-stained mouse cells with neighboring cardiomyocytes indicated that donor cells had truly integrated into the contractile explants (Fig. 3C¨C3F).
2 k+ j; Q& x, U- d* N/ {8 M
Figure 3. Integration of long-term bone marrow (LT-BM) cells into cardiac tissue. LT-BM cells obtained from wild-type mice were incubated in the absence (A, B) or presence (C¨CF) of embryonic chick heart tissue. (A, B): Phase and fluorescent image of a mouse LT-BM culture stained with the QCPN antibody (red). Note that this antibody, which does not react to chick cells, labels nuclei of all mouse cells. (B¨CF): Confocal microscopy images of cocultured mouse LT-BM cells and chick cardiac tissue, which was immunostained for both N-cadherin (green) and QCPN (red). (B): Low magnification view of a contractile cardiac tissue fragment showing prominent cell membrane expression of N-cadherin. The immunostaining with QCPN antibody reveals that multiple cells of mouse origin have become incorporated into the heart tissue. (D¨CF): Higher magnification views of the boxed areas in (C) demonstrate that QCPN-reactive mouse cells (arrows) share N-cadherin-positive cell borders with neighboring chick cardiomyocytes, indicating that LT-BM-derived cells have integrated into the cardiac tissue. Scale bars = 20 µm.

Gene Expression Analysis of Cocultures, t& J: ]9 Z3 S, y- v
, n1 c( ^2 M' V
To verify the myocardial differentiation of mouse LT-BM cells that were co-incubated with heart tissue, RNA was isolated from the cocultures and assayed for species-specific gene expression (Fig. 4). For these experiments, parallel cultures were set up consisting of either adult mouse LT-BM cells only, embryonic chick heart tissue only, or both mouse LT-BM cells and chick heart tissue. Four days later, RNA was harvested from the cultures and PCR-amplified using species-specific oligonucleotide primers. As a further control, RNA was also harvested from embryonic day (ED) 16 mouse hearts. To normalize template concentration, we first performed separate amplification reactions to mouse or chick GAPDH housekeeping genes. Thus, concentrations of RNA template for both the ED16 mouse heart and mouse bone marrow only controls were normalized to volumes of the mouse bone marrow/chick heart coculture RNA that produced equal amounts of mouse GAPDH expression, whereas RNA concentrations of the chick heart-only cultures were matched to the amount producing equal amounts of chick GAPDH expression with the cocultures. Subsequently, all four RNA samples were subjected to RT-PCRs that independently amplified chick and mouse orthologs of cardiac-specific genes. Samples were amplified for the chick ortholog of the cardiac-transcription factor Nkx2.5 as a control for the presence of chick cardiac tissue. To detect the presence of fully differentiated cardiomyocytes of mouse origin, samples were assayed for expression of the mouse ortholog of -cardiac MyHC. As shown in Figure 4, control amplification reactions produced the expected results. RNA isolated from cultures containing chick heart tissue and normalized to GAPDH exhibited similar levels of chick Nkx2.5 message, whereas neither chick-specific GAPDH nor Nkx2.5 sequences were detected in samples containing mouse RNA only. Accordingly, control mouse GAPDH primers prominently detected expression in the mouse heart, mouse bone marrow, and mouse bone marrow/chick heart coculture samples, but were unable to amplify sequence from chick heart only RNA. The control mouse and chick heart samples produced the expected positive and negative amplification with the mouse -cardiac MyHC-specific primers. As anticipated, -cardiac MyHC expression was not detected when mouse bone marrow cells were cultured by themselves. However, the mouse homolog of -cardiac MyHC was readily amplified from the mouse bone marrow/chick heart cocultures. Thus, co-incubation with embryonic chick heart tissue provoked -cardiac MyHC expression from adult mouse LT-BM cells, providing strong evidence that bone marrow cells will give rise to differentiated cardiomyocytes when exposed to a myocardial environment.

Figure 4. Myocardial gene expression of mouse long-term bone marrow (LT-BM) and chick heart cocultures. From left to right are shown reverse transcription-polymerase chain reaction-amplified RNA from embryonic day 16 mouse heart and 4-day cultures of either adult mouse LT-BM cells, embryonic chick heart, or both chick heart and adult mouse LT-BM cells. Amplification reactions used either mouse-specific primers for -cardiac MyHC and GAPDH or chick-specific primers for Nkx2.5 and GAPDH. Abbreviations: cHt, embryonic chick heart; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; mBM, adult mouse long-term bone marrow cells; mHt, mouse heart; MyHC, myosin heavy chain.
) E3 _) Y* Y6 ~* H' }0 a
Bone Marrow from Transgenic Mice with Myocardial-Specific lacZ Expression" ^) |' F1 L. p. t4 u/ B

The initial experimentation presented above suggested that co-culture with embryonic heart explants provides a promising in vitro model for examining the capacity of adult bone marrow cells to integrate and differentiate into myocardial tissue. However, there is difficulty in characterizing unequivocally the phenotype of individual cells within a larger tissue using dual fluorescent analysis. Therefore, to determine definitively whether the bone marrow-derived cells actually assumed a cardiomyocyte phenotype, donor cells were isolated from transgenic mice that exhibit a myocardial-specific reporter gene. The donor mice used in the remainder of this study (referred to as TG1852 mice) were generated by inserting into the genome an Escherichia coli lacZ (i.e., ß-galactosidase) transgene, whose expression is driven by a myocardial-specific enhancer from the GATA6 gene . In the developing TG1852 mouse embryo, lacZ expression is first turned on within the precardiac mesoderm and then displayed subsequently throughout the entire myocardium. For the present study, adult TG1852 mice were used as a source of bone marrow to establish cultures of LT-BM cells. When cultured by themselves, TG1852 LT-BM cells did not exhibit lacZ expression, as determined by absence of staining with the chromogenic substrate Xgal (Fig. 5A). As a further control, transgenic LT-BM cells were cocultured with noncardiac tissue¡ªin this case, stromal cells from wild-type mice. Again, Xgal staining was not apparent (Fig. 5B, 5C). However, when LT-BM cells from the transgenic mice were co-incubated with embryonic chick cardiac tissue, many Xgal-stained cells were observed in the cultures. As shown in Figure 5D¨C5G, each contractile cardiac tissue fragment contained multiple cells that were lacZ-positive, indicating cells of adult mouse bone marrow origin that now exhibited a myocardial phenotype.& I6 Q6 ?  w' j0 g3 E

Figure 5. Expression of myocardial-specific genetic reporter by mouse bone marrow cells. Long-term bone marrow (LT-BM) cells obtained from adult TG1852 mice were cultured for 4 days and Xgal-stained (blue) to reveal expression of myocardial-specific lacZ expression. (A): Mouse LT-BM cells cultured by themselves were Xgal-negative, because they exhibited 1 per 104 total LT-BM cells. Scale bars = 60 µm.
" w: a& N- v" L0 ]
To further assess the differentiation of TG1852 LT-BM cells in the cardiac cocultures, cell phenotype was examined by fluorescent staining with antibodies specific for ß-galactosidase. As shown above when assayed by Xgal staining (Fig. 5A), the absence of ß-galactosidase immunoreactivity indicated that TG1852 LT-BM cells do not express the lacZ reporter gene when cultured by themselves (Fig. 6A, 6B). However, co-incubation of TG1852 LT-BM cells with embryonic cardiac explants did produce multiple ß-galactosidase immunoreactive cells that were associated with each of the contractile heart tissue aggregates (Fig. 6C¨C6E). Some of the ß-galactosidase-positive mouse cells were negative for sarcomeric protein expression (Fig. 6F), indicating that they were specified to the myocardial lineage but still possessed a precardiac phenotype. However, other cells were identified that dual stained for both ß-galactosidase and sarcomeric proteins (Fig. 6G¨C6I), which demonstrates that cells marked with a myocardial lineage-specific reporter gene can undergo conversion to a differentiated myocyte phenotype.( Z4 U# p5 z- a0 M- v
/ u! h5 L$ M3 Y9 x, h. z1 I! y
Figure 6. Co-expression of myocardial-specific reporter and sarcomeric proteins by mouse bone marrow cells. Long-term bone marrow (LT-BM) cells obtained from TG1852 mice were incubated either by themselves and stained with ß-galactosidase-specific antibody (green) (A, B) or in the presence of embryonic chick heart tissue and dual-immunostained for ß-galactosidase (green) and the sarcomeric protein titin (red) (C¨CI). (A, B): Phase and fluorescent image of a mouse LT-BM culture demonstrates that these cells do not normally exhibit ß-galactosidase immunoreactivity. (C¨CE): After 4 days of coculture, cardiac tissue fragments exhibited prominent titin-positive myofibrils and displayed multiple ß-galactosidase immunoreactive cells, which are cells of mouse origin that have transdifferentiated to the myocardial lineage. Examples of these latter cells are shown in subsequent panels, which are high-magnification views of the areas highlighted by the boxes in (E). (F): A ß-galactosidase-positive mouse cell (arrow) that did not exhibit titin staining, indicating a cell specified to the myocardial lineage but still possessing a precardiac phenotype. (G): Optical sectioning also demonstrated the presence of mouse donor cells with more differentiated cardiomyocyte phenotypes, as indicated by the display of a striated titin expression pattern by the ß-galactosidase-positive cell (arrow). (H, I): Another area of the same cardiac tissue fragment exhibited in optical section, shown for titin reactivity only or both titin and ß-galactosidase staining, respectively. The juxtaposition of these two latter panels demonstrates that the LT-BM cell (arrow) has converted to a differentiated cardiomyocyte phenotype and has integrated into the cardiac tissue. Scale bars = 40 µm.

Transdifferentiation of LT-BM Cells to Myocytes Without Cell Fusion
0 h3 a+ j  K: p0 n; A
A common caveat offered to explain phenotypic plasticity is that the acquisition of phenotypic markers by a given cell may be due to its fusion with a differentiated cell . To address this concern, we changed the experimental design to determine whether we could prove definitively that adult bone marrow cells could acquire a myocardial phenotype by differentiation without cell fusion. As was done in the previous experimentation, cocultures of embryonic chick heart tissue and TG1852 mouse LT-BM cells were established and incubated for 4 days. However, following the incubation period, cultures were lightly exposed to trypsin, which produced suspensions of single cells and small cell clusters. The cell suspensions were replated at low density, allowed to reattach to the culture plastic for an additional 16 hours, and thereafter immunostained for both ß-galactosidase and QCPN expression. In addition, these cultures were counterstained with DAPI, which labels all cell nuclei regardless of species origin. Figure 7A¨C7C shows a cellular field containing an individual ß-galactosidase-positive cell possessing a single nucleus that is QCPN-positive. Figure 7D¨C7F shows a cell undergoing division that is highly immunoreactive for ß-galactosidase, with both of its dividing nuclei exhibiting QCPN-immunoreactivity. Further evidence for the transdifferentiation of mouse LT-BM cells is indicated by expression of sarcomeric proteins by cells exhibiting individual QCPN nuclei (Fig. 7G¨C7I). In none of the experiments we performed was any evidence observed of a myocyte that exhibited both mouse and chick nuclei.8 d, P4 F; w) r6 C; @

Figure 7. Display of a myocardial phenotype by bone marrow cells does not involve cell fusion. After 4-day incubations of TG1852 mouse long-term bone marrow (LT-BM) cells with chick cardiac tissue, the cultures were exposed briefly to trypsin and replated. Following an additional overnight incubation, the cultures were fluorescently stained for ß-galactosidase (green), 4',6-diamidino-2-phenyindole (DAPI) (blue), and QCPN (red) (A¨CF) or titin (green), DAPI (blue), and QCPN (red) (G¨CI). (A): A cellular field shown in phase contrast, with the corresponding ß-galactosidase plus DAPI staining (B) and QCPN immunofluorescence (C). Arrows indicate an individual ß-galactosidase-positive cell with a single nucleus that is QCPN-reactive. Note that this field also contains cells that only stained with DAPI, which are cells of chick origin. (D): Another cellular field shown in phase contrast, with the corresponding ß-galactosidase plus DAPI staining (E) and QCPN immunofluorescence (F). Arrows indicate an individual ß-galactosidase-positive cell undergoing cell replication, with both separating nuclei being QCPN-reactive. (G): A small cluster of cardiac tissue displayed in phase contrast, with the corresponding titin plus DAPI staining (H) and QCPN immunofluorescence (I). Arrows indicate an individual titin-positive cell with a single nuclei that is QCPN-reactive. Note that the titin-positive cardiac tissue fragment contains multiple cells that label with QCPN. These images, documenting the presence of cells whose nuclei are strictly of mouse origin and express either a myocardial-specific ß-galactosidase reporter or sarcomeric proteins, demonstrate that cell fusion could not account for this acquisition of a cardiomyocyte phenotype. Scale bars = 20 µm.8 Y3 J. z: e7 w, `1 l  Q8 q
& V0 N% \- n: ?) h
Microinjection of LT-BM Cells into the Developing Embryo, d& \+ y1 B7 `" q+ G

The experiments described above demonstrate that cells from adult mouse bone marrow can differentiate to cardiomyocytes in culture. As a next step, we extended this analysis by testing the capacity of adult mouse bone marrow cells to undergo myocardial differentiation within a living whole animal. Thus, LT-BM cells were injected into the hearts of tubular heart stage chick embryos and allowed to develop for an additional 48 hours before the embryos were processed for Xgal staining. As shown in Figure 8, donor mouse cells integrated into the chick myocardium and exhibited a cardiomyocyte phenotype, as indicated by lacZ expression. These data demonstrate that cells obtained from adult mouse bone marrow are capable of undergoing cardiac differentiation in situ. Taken together, these data confirm that cells within the adult bone marrow possess myocardial potential and have the capacity to generate new cells for the myocardium.
- V( |0 D3 f2 n  r/ l( L
Figure 8. Myocardial differentiation of mouse bone marrow cells in situ. Long-term bone marrow (LT-BM) cells obtained from adult TG1852 mice were injected into the hearts of living chick embryos. After 2 days of further development, embryos were fixed and stained for Xgal. (A): Whole embryo view showing the heart (indicated by the box) with several blue cells. (B, C): Higher-magnification views of the heart from the same embryo showing blue cells in the myocardial wall. Xgal-positive cells are adult mouse bone marrow cells that have shifted to a cardiomyocyte phenotype after exposure to the myocardium. Scale bars = 90 µm.: e2 \8 M5 F( a0 D
9 Z! a, h* b& t
DISCUSSION

A subject that has been mired in controversy concerns whether adult stem cells have utility for generating new myocytes in the diseased or damaged adult heart. This issue has been principally investigated by examining the ability of stem cells to repair experimentally induced myocardial infarcts within adult mice. Although some laboratories have reported success in using stem cells from the bone marrow to regenerate myocytes within a damaged myocardium . For these reasons, we considered the embryonic environment as an alternative experimental system for determining the phenotypic capacities of adult donor cells.
( b( j4 ^5 q# C# [
The Embryonic Chick as a Model for Examining Adult Stem Cell Potential
  c' b5 A8 |. C" W% _
The present study demonstrates that the embryonic chick is an effective vehicle for studying the cardiac competence of adult mouse bone marrow cells. Several attributes make the chick embryo a practical experimental model to study myocardial cell potential. The cellular and structural composition of the mammalian and avian heart is highly similar . Precisely staged embryos are much more easily obtained from bird eggs than they are from the mammalian uterus. Cardiac tissue can be readily harvested from the chick embryo for explant studies, which serve as a screen for testing the myocardial potential of donor cells within an in situ-like environment. Donor cells can be microinjected into living chick embryos with minimal difficulty. Microinjected embryos can subsequently develop normally within a resealed eggshell or cultured in a plastic vessel. Thus, the living chick embryo is particularly advantageous as a recipient for cell grafting studies, because the experimentation (including the microinjections, the survival rates of the recipients, and subsequent data analysis) is easier and much less likely to produce complications than would grafting directly into adult mammalian hearts.
5 m$ l7 b# d& u( |
The experiments described here employed the embryonic chick as both a source of tissue explants for culture experimentation and as a whole animal model system. When prelabeled adult mouse bone marrow cells were co-incubated with embryonic chick heart tissue, some of the bone marrow cells integrated into the cardiac tissue and adopted a cardiomyocyte phenotype, as indicated by the dual fluorescence of immunostained sarcomeric proteins and donor tissue-specific label. The presence of bone marrow cell-derived cardiomyocytes was verified by harvesting cocultures following the incubation period and replating at low cell density, which allowed for the unambiguous identification of multifluorescent cells. The myocyte phenotype of mouse bone marrow cells within the cocultures was further substantiated by gene expression analysis using RT-PCR primers specific for the mouse ortholog of -cardiac myosin. Myocardial differentiation was also observed when mouse bone marrow cells were directly injected into the hearts of developing chick embryos, which confirmed the myocardial competence of the donor cells using a whole animal model. Moreover, the ability to use the QCPN antibody to distinguish mouse from chick nuclei enabled us to confirm that mouse bone marrow-derived cells are able to acquire a myocardial phenotype by transdifferentiation. These data demonstrate that the embryonic heart is a supportive environment for both accepting and nurturing newly introduced cells and an excellent vehicle for testing stem cell potential. The utility of this model was further augmented using donor cells carrying a cardiomyocyte lineage-specific molecular tag., i$ ?! X" e- F, t

Tagging Bone Marrow Cells with a Myocardial-Restricted Transgene Reporter

When stem cells are introduced into a tissue, either in culture or within an animal, a method for marking the cellular graft must be employed. For example, stem cells can be prelabeled with fluorescent dye or obtained from transgenic animals that universally and constitutively express a reporter gene, and then placed within wild-type tissue. After a period of incubation, changes in the phenotype of the transplanted stem cells can be assessed by dual fluorescence analysis for the label on the grafted cells and an immunostained differentiation marker. The problem associated with this experimental approach is that the unambiguous identification of the transplanted, labeled cells within a tissue is not always possible, even when the tissue is optically sectioned by confocal microscopy or physically sectioned. A common criticism of these types of studies is that what may appear to be a single cell exhibiting dual fluorescence is actually a labeled, nondifferentiated donor cell superimposed above an immunostained host cell. The way to lessen the experimental ambiguity is to harvest donor cells from transgenic animals that only exhibit a differentiation-specific label. Thus, for studies examining the myocardial potential of adult bone marrow cells, we used as a source of donor cells TG1852 transgenic mice that express a lacZ reporter gene exclusively in cells that are undergoing myocardial differentiation .

Obtaining bone marrow from TG1852 mice allowed for the unambiguous identification of donor cells that had undergone myocardial differentiation within cardiac tissue. This phenotypic conversion of bone marrow cells was observed both within chick cardiac explant cocultures and upon the direct delivery of donor mouse cells within the hearts of living chick embryos. In the whole embryo, lacZ-expressing donor bone marrow cells were clearly observed within the outer wall of the developing heart. Within chick heart cocultures, the myocardial-specific lacZ tag detected greater numbers of positive mouse donor bone marrow cells than did sarcomeric protein immunoreactivity. That this result was not due to leakiness of the lacZ marker was indicated by the lack of both Xgal staining and ß-galactosidase immunoreactivity when bone marrow cells were cultured in the absence of cardiac tissue. Instead, it is likely that this finding is reflective of the lacZ expression in TG1852 embryos, which marks both differentiated cardiomyocytes and myocardial-committed cells within the precardiac mesoderm . Thus, this lacZ marker is capable of identifying cells in the earliest stages myocardial differentiation and indicates that the myocardial competence of cells within the bone marrow may be significantly greater than what is apparent by only characterizing differentiated myocyte phenotypes. It should be noted that the assays used in this study were not intended to optimize cardiac conversion but were designed primarily to provide an unambiguous visual demonstration of BM cell transdifferentiation to cardiomyocytes. Future experimentation that accurately quantifies the frequency of these events will allow for a more informed evaluation of the biological importance of transdifferentiation.5 `9 G( H: y' S7 Y
- D" T" M1 ~9 E& b, C* P8 U
Macrophage Transdifferentiation to Cardiomyocytes
/ }/ U3 w# X$ x1 C! _( E$ e
A principal conclusion of this study is that there are cells within the adult mammalian bone marrow capable of integrating into the myocardium and forming cardiomyocytes. Based on the experimental results presented here, this conclusion appears valid. However, our data have, in addition, led us to a further postulate. The donor cells used in these studies were harvested from long-term cultures of adult mouse bone marrow grown on bacterial grade Petri dishes. Based on both phenotypic and functional analyses, the predominating cell type within the long-term bone marrow cultures were macrophages . Admittedly, it is possible that a contaminating stem cell within these cultures is the cardiac-competent population. However, given the macrophage predominance, the invoking of a distinct sparsely present myocardial progenitor within the cultures would necessitate a stem cell population exhibiting unprecedented rates of myocardial conversion. As an alternative, we suggest that the cardiomyocytes arising from LT-BM cultures were obtained via the transdifferentiation of macrophages. This is not to imply that macrophages are the only bone marrow cells possessing myocardial competence, because multiple cell types may have the ability to form cardiomyocytes. Instead, we believe our data suggest that the macrophage is a cell possessing an appreciable myocardial potential.* i4 J- q$ }4 X; V+ f! ~  O, z

Why should macrophages possess myocardial potential? Previously, we proposed that the plasticity of cell potential is related to how new cell phenotypes were generated throughout evolution . As more complex organisms evolved, more distinct types of specialized cells were spawned. Although the generation of new specialized cell types may have been the result of selective mechanisms acting on stem cells, the emergence of new differentiated cell types by variation from existing differentiated phenotypes would appear to be a more direct and less complicated mechanism for promoting evolutionary diversification.  P2 Z8 c' S1 d! g& x: v

In the adult, the greatest amount of cellular regeneration occurs during the wound healing response . Accordingly, we speculate that new cell phenotypes arose during evolution as variations of the macrophage, which may account for the ability of this cell to transdifferentiate into other specialized cell types.7 D' h. t" ~% z8 C$ G, e
' ]: O5 X6 [  m5 K  W5 H
ACKNOWLEDGMENTS3 w. R  d: E& S6 {* `# ]
# r* T, I5 [5 T% l
We thank Lisa Martin and Marlisa Sooy for expert technical assistance and Dr. Steve Kubalak for generous help. This work was supported by grants from the American Heart Association (0555522U), National Aeronautics and Space Administration Experimental Program to Stimulate Competitive Research (NCC5-5775), NIH IDeA Networks of Biomedical Research Excellence (2P20RR016461-05A1), and NIH National Heart, Lung, and Blood Institute (P01-HD39946 R01-HL55373, and R01-HL073190).
! [1 b% b* \* o0 p, Y# c
DISCLOSURES
/ ~( S. j  T+ m& K1 k# j3 S! ~, L6 n
The authors indicate no potential conflicts of interest.+ n3 j- |! L# M5 t9 p1 |
      【参考文献】+ C' a  k! H6 R( {) Q. C

Deb A, Wang S, Skelding KA et al. Bone marrow-derived cardiomyocytes are present in the adult human heart. A study of gender-mismatched bone marrow transplantation recipients. Circulation 2003;107:1247¨C1249.
- e( {" n& J. B0 ~0 s( \4 U
Eisenberg LM, Burns L, Eisenberg CA. Hematopoietic cells from the bone marrow have the potential to differentiate into cardiomyocytes in vitro. Anat Rec 2003;274A:870¨C882.8 j. L, M" M7 {

Eisenberg LM, Eisenberg CA. Adult stem cells and their cardiac potential. Anat Rec 2004;276A:103¨C112.

Hattan N, Kawaguchi H, Ando K et al. Purified cardiomyocytes from bone marrow mesenchymal stem cells produce stable intracardiac grafts in mice. Cardiovasc Res 2005;65:334¨C344.

Kajstura J, Rota M, Whang B et al. Bone marrow cells differentiate in cardiac cell lineages after infarction independently of cell fusion. Circ Res 2005;96:127¨C137.

Liu J, Hu Q, Wang Z et al. Autologous stem cell transplantation for myocardial repair. Am J Physiol Heart Circ Physiol 2004;287:H501¨CH511.

Orlic D, Kajstura J, Chimenti S et al. Bone marrow cells regenerate infarcted myocardium. Nature 2001;410:701¨C705.( _# X& R8 i- R

Toma C, Pittenger MF, Cahill KS et al. Human mesenchymal stem cells differentiate to a cardiomyocyte phenotype in the adult murine heart. Circulation 2002;105:93¨C98./ m5 v9 H8 b  m7 M1 d
. Z7 z. d% Z, U1 K! Z( U  E( B
Tomita S, Li R-K, Weisel RD et al. Autologous transplantation of bone marrow cells improves damaged heart function. Circulation 1999;100: II247¨CII256.

Balsam LB, Wagers AJ, Christensen JL et al. Haematopoietic stem cells adopt mature haematopoietic fates in ischaemic myocardium. Nature 2004;428:668¨C673.2 g  t; A/ \, C9 G, j* R  I& e

Deten A, Volz HC, Clamors S et al. Hematopoietic stem cells do not repair the infarcted mouse heart. Cardiovasc Res 2005;65:52¨C63.7 T, ~0 s0 p5 D; o5 N% t/ C

Murry CE, Soonpaa MH, Reinecke H et al. Haematopoietic stem cells do not transdifferentiate into cardiac myocytes in myocardial infarcts. Nature 2004;428:664¨C668.

Chien KR. Stem cells: Lost in translation. Nature 2004;428:607¨C608.

Eisenberg LM, Markwald RR. Cellular recruitment and the development of the myocardium. Dev Biol 2004;274:225¨C232.
3 C( g, o; z: B2 S, J- l
Eisenberg LM, Moreno R, Markwald RR. Multiple stem cell populations contribute to the formation of the myocardium. Ann N Y Acad Sci 2005;1047:38¨C49.

Masuya M, Drake CJ, Fleming PA et al. Hematopoietic origin of glomerular mesangial cells. Blood 2003;101:2215¨C2218.% f* z8 I3 a3 W. I2 z6 d9 S8 X

Davis DL, Wessels A, Burch JBE. An Nkx-dependent enhancer regulates cGATA-6 gene expression during early stages of heart development. Dev Biol 2000;217:310¨C322.

He CZ, Burch JB. The chicken GATA-6 locus contains multiple control regions that confer distinct patterns of heart region-specific expression in transgenic mouse embryos. J Biol Chem 1997;272:28550¨C28556.
/ i8 m$ c1 t. {7 ~" J0 q9 R/ Z" q
Fleit SA, Fleit HB, Zolla-Pazner S. Culture and recovery of macrophages and cell lines from tissue culture-treated and untreated plastic dishes. J Immunol Methods 1984;68:119¨C129.
1 q' s) Q4 @: H- W
Wood PR, Simes RJ, Nelson DS. Activity of mouse macrophages purified by adherence to, and removal from, a plastic surface. J Immunol Methods 1979;28:117¨C124.

Hamburger V, Hamilton HL. A series of normal stages in the development of the chick embryo. J Morphol 1951;88:49¨C92.

Leenen PJ, Jansen AM, van Ewijk W. Murine macrophage cell lines can be ordered in a linear differentiation sequence. Differentiation 1986;32: 157¨C164.' ]6 g* k2 R. P7 j. e5 }0 H5 y

Sawano A, Iwai S, Sakurai Y et al. Flt-1, vascular endothelial growth factor receptor 1, is a novel cell surface marker for the lineage of monocyte-macrophages in humans. Blood 2001;97:785¨C791.3 ~% V( _) H9 |
+ k2 \6 _7 {9 R4 Z
Burns AJ, Douarin NM. The sacral neural crest contributes neurons and glia to the post-umbilical gut: Spatiotemporal analysis of the development of the enteric nervous system. Development 1998;125:4335¨C4347.

Huang R, Zhi Q, Christ B. The relationship between limb muscle and endothelial cells migrating from single somite. Anat Embryol (Berl) 2003;206:283¨C289.. c* D2 ]+ P* J6 ]. Y) u
. ^" P% Y  _. y8 f: I
Linask KK. N-cadherin localization in early heart development and polar expression of Na ,K( )-ATPase, and integrin during pericardial coelom formation and epithelialization of the differentiating myocardium. Dev Biol 1992;151:213¨C224.

Nygren JM, Jovinge S, Breitbach M et al. Bone marrow-derived hematopoietic cells generate cardiomyocytes at a low frequency through cell fusion, but not transdifferentiation. Nat Med 2004;10:494¨C501.

Rodic N, Rutenberg MS, Terada N. Cell fusion and reprogramming: Resolving our transdifferences. Trends Mol Med 2004;10:93¨C96.$ ^! z  |* a4 e) t

Lindsey ML, Mann DL, Entman ML et al. Extracellular matrix remodeling following myocardial injury. Ann Med 2003;35:316¨C326.

Takahashi S, Barry AC, Factor SM. Collagen degradation in ischaemic rat hearts. Biochem J 1990;265:233¨C241.
0 M) T* o! B+ b" T
Sedmera D, Pexieder T, Vuillemin M et al. Developmental patterning of the myocardium. Anat Rec 2000;258:319¨C337.

Eisenberg LM, Eisenberg CA. Stem cell plasticity, cell fusion, and transdifferentiation. Birth Defects Res C Embryo Today 2003;69:209¨C218.

Monaco JL, Lawrence WT. Acute wound healing an overview. Clin Plast Surg 2003;30:1¨C12.. B4 g8 J" J! r8 p5 t* [

Park JE, Barbul A. Understanding the role of immune regulation in wound healing. Am J Surg 2004;187:11S¨C16S.
4 v+ a6 T+ R8 `8 A/ n1 n; C
Mevorach D. The immune response to apoptotic cells. Ann N Y Acad Sci 1999;887:191¨C198.

Gross PS, Al-Sharif WZ, Clow LA et al. Echinoderm immunity and the evolution of the complement system. Dev Comp Immunol 1999;23:429¨C442.8 o9 T  W2 B0 ?& N

Iwanaga S. The molecular basis of innate immunity in the horseshoe crab. Curr Opin Immunol 2002;14:87¨C95.

收藏0 分享0 顶0 踩0