|
  
- 积分
- 0
- 威望
- 0
- 包包
- 483
|

作者:Xiaobing Yua,b, Jonathan K. Aldera, Jong Ho Chuna, Alan D. Friedmana, Shelly Heimfeldc, Linzhao Chengb, Curt I. Civina作者单位:a Sidney Kimmel Comprehensive Cancer Center at Johns Hopkins, Department of Oncology, andb Stem Cell Program, Institute for Cell Engineering, Johns Hopkins University School of Medicine, Baltimore, Maryland, USA;c Clinical Research Division, Fred Hutchinson Cancer Research Center, Seattle, Washingto 8 b. i) ?' i, L6 k
& L! v7 t) Q6 J8 ^ W" d
3 i7 B. t: N8 j% _* Z# L
' ?; R- D+ B, L! d/ \& J, s
) a: y! V/ Q. T; a9 @ ; l+ ~) d! E1 o% u6 ]* N/ i/ A
9 ~- {& x: I1 u) |7 }' S
8 k6 Y, `5 ?: H. x 0 u; x8 S& K y( T8 d
2 c0 Q* g+ ]# Y: Y
1 B1 R, [7 K/ x/ ? , z9 ?0 c& E; i* \! M' C
1 ^+ b1 h! X$ l* z
【摘要】
4 y" {0 ~* l# l Notch signaling is implicated in stem cell self-renewal, differentiation, and other developmental processes, and the Drosophila hairy and enhancer of split (HES) 1 basic helix-loop-helix protein is a major downstream effector in the Notch pathway. We found that HES1 was expressed at high levels in the hematopoietic stem cell (HSC)¨Cenriched CD34 /¨C /low subpopulation but at low levels in more mature progenitor cell populations. When CD34 cells were cultured for 1 week, the level of HES1 remained high in the CD34 subset that had remained quiescent during ex vivo culture but was reduced in CD34 cells that had divided. To investigate the effects of HES1 in human and mouse hematopoietic stem¨Cprogenitor cells (HSPCs), we constructed conditional lentiviral vectors (lentivectors) to introduce transgenes encoding either wild-type HES1 or a mutant lacking the DNA-binding domain (BHES1). We found that lentivector-mediated HES1 expression in CD34 cells inhibited cell cycling in vitro and cell expansion in vivo, associated with upregulation of the cell cycle inhibitor p21cip1/Waf1 (p21). The HES1 DNA¨Cbinding domain was required for these actions. HES1 did not induce programmed cell death or alter differentiation in HSPCs, and while short-term repopulating activity was reduced in HES1-transduced mouse and human cells, long-term reconstituting HSC function was preserved. Our data characterize the complex, cell context¨Cdependent actions of HES1 as a major downstream Notch signaling regulator of HSPC function. % ?% ]4 g* M, F! K
【关键词】 HES Notch signaling pathway Hematopoietic stem cells Hematopoietic progenitor cells Stem cell self-renewal Cell cycle bHLH; d1 ?* c: }1 [
INTRODUCTION" G9 }! A- J& h3 z5 X
, O) G- k- M* p1 v% c HEvolutionally conserved Notch pathway signaling molecules have myriad effects in the proliferation, differentiation, and apoptosis of multiple stages and lineages of normal cells, as well as in the pathophysiologies of several diseases .
$ P, h. l4 \& p: U' p. s9 E' |; E) q2 ]; D( F" Y
Although the role of Notch signaling molecules in lymphopoiesis is clear . Dissection of the actions of individual downstream targets of ICN should help to clarify the actions of Notch signaling in hematopoiesis.7 x) M. n x& x7 l' i- e0 S4 E" l
# H: ?/ S7 }. |9 Q0 nMammalian homologs of Drosophila hairy and enhancer of split (HES) are prominent targets of Notch signaling .
* V% \3 V: ~3 ?9 H' h2 a9 u
8 H0 l2 y, K/ M# R3 |- sFigure 1. Endogenous HES1 expression was higher in quiescent than in proliferative CD34 cells. Cord blood CD34 cells were labeled with PKH26 membrane dye. A population of homogenously intensely fluorescent PKH26high/CD34 cells was then fluorescence-activated cell sorted (FACS) and cultured ex vivo. On day 7, cells were FACS sorted to obtain cells that were still CD34 and had undergone several cell divisions (CD34 /PKHlow) and cells that were still CD34 but had divided only 0¨C2 times (CD34 /PKHhigh). Endogenous HES1 mRNA expression in the CD34 /PKHhigh, CD34 /PKHlow, and total CD34 (control) cell populations was determined by quantitative RT-PCR. The relative level of HES1 in the PKHlow subset was normalized to 1.
% A4 u! w' _3 E5 X# y+ V" U
. d2 O- g+ Y2 [The mouse HES1 gene is expressed in embryonic and adult mouse BM, liver, spleen, thymus, and blood .. o$ t9 K+ E# M0 T+ P. O" B
- g) K4 q7 z3 ]8 lTo further investigate the role of HES1 in mouse and human hematopoiesis, we developed lentiviral vectors (lentivectors) that allow conditional activation of HES1 in vitro and in vivo after stable gene transfer into HSPCs. As mouse and human HES1 are highly conserved and functionally interchangeable, lentivectors expressing the human HES1 gene (and a mutated version lacking the DNA-binding domain that served as a control) were constructed and used to transduce human and mouse HSPCs. We found that functional HES1 transgene expression in mouse and human HSPCs inhibited cell proliferation in vitro and cell expansion in vivo. These effects were associated with upregulation of the cell cycle inhibitor p21cip1/Waf1 (p21) and were dependent on intact HES1 DNA¨Cbinding activity. Neither programmed cell death nor differentiation of HSPCs was induced by HES1-transgene expression, and HSC activity was still present in HES1-transduced cells after secondary and tertiary transplantation in mice. Thus, DNA binding by conditionally expressed HES1 appears to selectively downregulate the proliferation of hematopoietic progenitor cells and short-term reconstituting HSPCs but not long-term reconstituting HSCs.# N9 _ o- p$ ^8 r' j
$ R$ F" N) @$ }$ C! x0 Z# R. x
MATERIALS AND METHODS7 y, m) t4 U3 \
2 b1 E/ @6 m$ iPrimary Human Hematopoietic Cells
2 ?4 \0 {% @9 b* `. T
6 Y: _1 \0 g: h" }6 C6 j% f' d- E! nNormal human placental/umbilical cord blood (CB) CD34 cells were purchased from AllCells (Berkeley, CA, http://www.allcells.com). Normal BM and granulocyte-colony stimulating factor (G-CSF)¨Cmobilized peripheral blood stem cell (PBSC) CD34 cells were provided by the Hematopoietic Cell Processing Core of the National Heart, Lung, and Blood Institute Program of Excellence in Gene Therapy at Fred Hutchison Cancer Center. CD34 cells were purified by immunomagnetic selection (Miltenyi Biotech, Bergisch Gladbach, Germany, http://www.miltenyibiotec.com) and were >90% CD34 by fluorescence-activated cell sorting (FACS) reanalysis.9 l7 w/ ^/ h: d1 M! r
2 |$ K/ ~5 m7 o! _* H2 a0 w) QDual-Promoter Lentivectors and Transduction
" M. O& [) R7 I* N7 Q2 j+ h
7 S5 u1 c1 g& C7 rWild-type (wt) HES1 cDNA was generated by polymerase chain reaction (PCR). To disrupt the basic DNA-binding domain of HES1, amino acids E43, K44, and R47 in the basic region of wtHES1 were mutated by polymerase chain reaction (PCR) to alanines to produce the BHES1 construct. Similar DNA-binding defective mutations have been described in rat (a generous gift from Dr. Michael Caudy, Cornell University).
6 L8 O8 |& Y. w$ S' J$ p6 [- h, v# q$ Q0 B
Figure 2. Characterization of lentiviral vectors expressing the HES1 transgene. (A): Schematic of the human wtHES1 and BHES1 constructs. The FLAG epitope tag sequence was attached to the N-terminal coding sequence in each construct. (B): Schematic of constructs in which wtHES1 or BHES1 human coding sequence was fused to the ligand-binding domain of a modified ER. Each of these HES1 constructs was cloned into a dual promoter lentivector, with the HES1 transgene driven by the EF1 promoter and the GFP reporter gene driven by the Ubc promoter. (C): Functional analysis of these HES1 transgene expression vectors. Each HES1 vector was cotransfected into 293T cells with a plasmid expressing a luciferase reporter, known to be responsive to transcriptional activation by HES1. After 2 days of culture in the presence (filled bars) or absence (empty bars) of 4HT (200 nM), transfected cells were harvested, and luciferase activity was measured and normalized (units of RLU), and plotted. (D): Efficient nuclear translocation of BHES1-ER fusion protein only in the presence of 4HT. Only successfully transfected 293T cells (expressing the reporter GFP gene; green) expressed the BHES1-ER fusion protein, as detected by a Mab recognizing the FLAG tag (red). The nuclei were counterstained with DAPI (blue). Abbreviations: BHES1, DNA-binding mutant HES1; 4HT, 4-hydroxytamoxifen; ER, estrogen receptor; HES, hairy and enhancer of split; RLU, relative luciferase activity; wtHES1, wild-type HES1.
& {0 b3 b1 r& s* _( e% N2 P/ S0 c6 L$ B1 b v# b
Activation of ER Fusion Proteins In Vitro and In Vivo" P( Z* c8 E3 B
3 P$ o% n- v0 \1 `0 x: S4HT (Sigma-Aldrich, St. Louis, http://www.sigmaaldrich.com; 2 mM in 1% ethanol stock solution) was added to in vitro cultures (200 nM 4HT final concentration) to release sequestered ER fusion proteins .
1 z6 }. e' W) G; m
0 o6 `) c* Q, P1 ?Transduction of Human CD34 HSPCs
1 V$ B8 K5 ?8 Y# j( D2 m. g1 j2 E( A2 Y# r! c1 x1 W
Human CD34 cells were cultured at 5¨C10 x 105/ml in QBSF-60 serum-free medium (Quality Biologicals, Gaithersburg, MD, http://www.qualitybiological.com) containing FLT3 ligand (100 ng/ml), 20 ng/ml thrombopoietin, and 100 ng/ml KIT ligand (combination = FTK; all recombinant human cytokines from Peprotech, Rocky Hill, NJ, http://www.peprotech.com) and transduced with the lentivector on day 0 . Mouse lineage¨Cdepleted (Lin¨C) BM cells were cultured and transduced similarly, but in QBSF-58 (Quality Biologicals) serum-free medium containing recombinant mouse kit ligand (100 ng/ml), human FLT3 ligand (50 ng/ml) and human thrombopoietin (10 ng/ml). 48 hours after transduction, cells were either used directly or by FACS, based on GFP fluorescence using a FACS Vantage SE flow cytometer (BD, San Jose, CA, http://www.bd.com), for further studies.: g9 X+ R1 j$ G4 S4 M) f/ z
% }0 _# M; l- ^: t- f6 F! sQuantitative Real-Time-PCR Analysis3 { M* ]9 m- A. A o* n4 U
. l, X4 @% x2 _9 q. r0 @2 GTo determine levels of mRNA, quantitative real-time (RT)-PCR (qRT-PCR) analyses were carried out with the use of gene-specific primers and fluorescent labeled Taqman probes or SYBR green dye (Molecular Probes, Eugene, OR, http://www.probes.invitrogen.com) . Human HES1 primer and probe sequences were: Forward primer: 5' TG-GAAATGACAGTGAAGCACCT 3'; Reverse primer: 5' GT TCATGCACTCGCTGAAGC 3'; Probe: 5' FAM-CGCAGAT GACGGCTGCGCTG-TAMRA 3'. Human p21 primers were: Forward primer: 5' GCTGAAGGGTCCCCAGGT3'; Reverse primer: 5' GAAATCTGTCATGCTGGTCTGC3'.
- l, k* y1 w# h: _( s; A# Z; r- y" u
Flow Cytometric Assays
2 x7 T/ v# t8 X$ `, S: P9 ^, c. U9 b
. v, Q X$ Z! n, J7 B8 MPE-conjugated, PerCP-conjugated, and isotype-control mono-clonal antibodies (Mabs) against leukocyte differentiation antigens were purchased from BD. Annexin V/Viaprobe (BD) and propidium iodide (Sigma-Aldrich) analyses were done using FACS analysis as described previously , with DNA content analysis performed using the Dean-Jett-Fox model and FlowJo software (Tree Star Inc., Ashland, OR, http://www.treestar.com).
- i- _) I: Q; @$ x- A$ j |0 ~0 i( d7 K( ^6 c! s% p+ H
For the analysis of HSPCs that had divided extensively versus less-proliferative HSPCs, freshly purified CB CD34 cells were labeled with the red fluorescent membrane dye PKH26 (Sigma-Aldrich), and a band of uniformly PKH26-labeled CD34 cells were sorted using a FACS Vantage SE cell sorter, as previously described .8 P3 h3 a0 n! C1 k; W
. B v0 v; q' {# P/ w- {! qBromo-Deoxyuridine Incorporation for Analysis of Cell Proliferation$ \ I9 |# ?; o- J: Y
+ o9 n6 @" S, O. h: ?# YTransduced FACS¨Csorted GFP CB CD34 cells were allowed to recover during overnight culture in QBSF-60 medium containing FTK. These cells were then transferred into poly-D-lysine (BD) precoated 4-well slide chambers (Nalge Nunc International, Naperville, IL, http://www.nalgenunc.com), cultured for 2 hours, and labeled with 30 mM bromo-deoxyuridine (BrdU; Sigma-Aldrich) (15 minutes, room temperature). Cells were incubated with anti-BrdU Mab (Sigma-Aldrich), then Alexafluor 594-labeled secondary antimouse immunoglobulin antibody (Molecular Probes). After 5 minutes of DAPI staining (Molecular Probes), cells were counted and scored for BrdU staining., W9 f' Q; d, U/ w4 U
v: V# u3 c* G: ]+ @
Engraftment of Human HSPCs! G% x) d5 v3 S* \$ c0 o
; c7 m% N8 B; t4 w3 d
Nonobese diabetic-severe combined immunodeficient (NOD-scid) mice, originally provided by Dr. L. Shultz (Jackson Laboratory, Bar Harbor, ME), were bred and housed in the animal facility at the Sidney Kimmel Comprehensive Cancer Center at Johns Hopkins. Transduced HSPCs (4 x 105 human cells per mouse) were injected intravenously (iv) into tail veins of sublethally irradiated (300 cGy) 6¨C8-week-old NOD-scid mice. Mice were sacrificed 4 weeks after transplantation and BM harvested and assessed for human cell engraftment as previously described .
+ N6 A4 p& H0 m0 t. N8 V7 @' l: w. @5 Q( H
Serial Mouse Transplantation and Analysis of Donor Cell Engraftment
$ Y6 M% l! ^# G; _2 c R+ y' w4 b) B; R
Mice were obtained from the National Cancer Institute (Bethesda, MD) at 4¨C6 weeks of age. Donor BM cells from B6.SJL (CD45.1 ) mice were harvested at 5¨C7 weeks of age, and HSPCs enriched by immunomagnetic depletion of cells expressing mature hematopoietic Lin antigens defined by a cocktail of Mabs: CD5 (Ly-1), CD11b (Mac-1), CD45R (B220), Gr-1, and TER119 (StemCell Technologies, Vancouver, BC, Canada, http://www.stemcell.com). Cells were transduced with lentivectors on day 0 of ex vivo culture. On day 2, cells were transplanted iv into lethally irradiated (1,100 cGy) recipient C57BL6 (CD45.2 ) mice. A small aliquot of cells was maintained in culture for 5 days to determine the transduction efficiency. Eight weeks post-transplantation, three of eight primary transplanted mice from each group were sacrificed and BM cells pooled. GFP /CD45.1 BM cells were obtained by FACS sorting and mixed with untransduced marrow cells (such that each secondary transplanted mouse received 0.5 x 105 GFP cells from primary transplanted mice plus 4 x 105 BM cells from normal untransplanted B6.SJL mice); this cell mixture was transplanted iv into lethally irradiated naive secondary recipient C57BL6 (CD45.2 ) mice (five mice per group). Mice were bled every 2¨C3 weeks, and a percent of CD45.1 /GFP cells was measured by FACS. The above secondary competitive transplant experiment was repeated using three of the five remaining mice from each group at 9 weeks post-transplant. For tertiary competitive transplantation, BM cells were pooled from four mice at 8 weeks after secondary transplantation and GFP cells were obtained by FACS sorting. 105 CD45.1 /GFP cells from each group of secondary transplants were mixed with 3 x 105 untransduced B6.SJL (CD45.1 ) cells and transplanted iv into each lethally irradiated naive C57BL6 (CD45.2 ) recipient mouse (four mice per group).
5 v! Z( b% f' h [) d/ k7 T9 o3 w, K2 {0 H
Statistical Analysis! B0 T6 I+ q3 v. s5 X7 r6 `2 C" t: w3 z
# J$ M4 K4 Q! X) c! l, M! F
Data are expressed as mean ¡À standard error of the mean. Significance of differences was examined using the Student t-test. P values of less than .05 were considered to be significant. Statistical analysis was performed using GraphPad Prism version 4.0 (GraphPad Software, San Diego, CA, http://www.graphpad.com)." h/ T8 _% m7 O4 q' s: Q% n B
# |; M3 \3 [2 ]; o8 X
RESULTS
( l9 i/ h" W/ g/ f0 G! `# h8 |; A2 s# |) D! F
The HSC-Enriched Subset of the CD34 Cell Subpopulation Expressed a Higher Level of HES1 mRNA Than Did More Mature Progenitor Cell¨CEnriched Subsets q, [7 L) p: j" o8 n \/ a; _' B
5 E, p7 x: d* [4 r- e4 wUsing qRT-PCR, we examined the level of HES1 expression in FACS-sorted cell populations within the human CD34 HSPC population (Table 1). We found that HES1 expression in the HSC-enriched CD34 / ¨C/low sub-population (Table 1).) {' V7 c# Z7 [
$ o5 ~: R2 V8 e6 {) l- ^( n: JTable 1. Relative levels of hairy and enhancer of split 1 (HES1) expression in different subsets of human CD34 hematopoietic stem-progenitor cells (HSPCs)
8 Z. ]1 F( @& m8 d, o; d2 J E; g' ~/ u9 {% e, h5 k+ e
Nondividing or Slow-Dividing Human HSPCs in Culture Expressed a High Level of HES1 mRNA
# l. \+ P) m: d/ M. T2 j2 n. B9 K' S/ M, _
We next examined the levels of HES1 expressed in human HSPCs that had proliferated rapidly ex vivo versus in those that were more quiescent. To do this, CD34 HSPCs were labeled with PKH26 membrane dye and cultured in serum-free medium containing FTK. After 7 days, the cultured cells were FACS sorted to obtain CD34 /PKHlow cells that had divided several times and CD34 /PKHhigh cells that had divided 2 times. The level of HES1 mRNA was fivefold higher in the CD34 /PKHhigh cells than in the CD34 /PKHlow cells (Fig. 1).+ k. I5 |0 U% f6 ]2 N/ R$ B7 A
2 ?6 R* \: O, j0 h2 i' ]' o
Construction of Lentivectors Expressing HES1& ?0 t6 b! y, w( g+ k. l B7 e
6 ^' V" n1 a/ H6 r9 A
We used dual promoter lentivectors . As predicted, the wtHES1 construct repressed reporter activity; the activity of the inducible (ER) construct was dependent on the presence of 4HT; and the BHES1 constructs had hardly any effect (Fig. 2C), despite the fact the protein from the BHES1 transgene (FLAG tagged) was produced and translocated into the nucleus (Fig. 2D).
$ F' D- S, _+ T" ]& ]7 u7 b9 q
. X1 H9 [+ g& a$ @1 e& KEnforced HES1 Expression Inhibited Human BFU-E and CFU-G Colony Formation In Vitro
8 f# Y1 b% \' N0 v6 w9 o) I; Z: Q5 k2 u; J+ \# K
To determine the effects of enforced HES1 expression, human PBSC CD34 cells were transduced overnight with wtHES1 or control lentivector. After 48 hours, successfully transduced (GFP ) cells were enriched by FACS sorting and plated in standard methylcellulose-containing colony-forming cell (CFC) assays, except that, to reduce the complexity of the types of colonies formed, cultures contained only KIT ligand plus either EPO, G-CSF, or M-CSF (Fig. 3A, 3B). As compared to cells transduced with the control lentivector containing only GFP, wtHES1-transduced cells generated only 30% the numbers of BFU-E colonies and 50% the numbers of CFU-G colonies, but similar numbers of CFU-M colonies. Transduction of the BHES1 mutant had no significant effects. We also analyzed the HES1 transcript levels in the transduced cells. The FACS-sorted wtHES1- or BHES1-transduced (GFP ) cells expressed approximately sevenfold higher levels of HES1, as compared to the endogenous level of HES1 measured in control-transduced (GFP only) cells (Fig. 3C; as confirmed by Western blotting, data not shown). Similar levels of HES1 expression were detected in cells transduced with conditional ER lentivectors (data not shown).
* a: L0 F- K7 y9 T/ x2 C' f4 i0 J5 g9 M; J6 Y5 h; _
Figure 3. Enforced expression of wtHES1 inhibited erythroid and granulocytic colony formation. (A): Human PBSC CD34 cells were transduced with wtHES1, BHES1, or control (GFP) lentiviral vectors (lentivector) for 2 days, then successfully transduced GFP cells were enriched by fluorescence-activated cell sorting (FACS) and plated in single lineage¨CCFC assays. In cultures containing KIT ligand (50 ng/ml) plus EPO (five IU/ml), the few nonerythroid colonies were ignored and only BFU-Es were enumerated. Similarly, in cultures containing KIT ligand (50 ng/ml) plus either G-CSF (100 ng/ml) or M-CSF (10 ng/ml), only granulocytic (composed of round, bright, small cells) or monocytic colonies (composed of large cells with oval to round shapes) were enumerated, respectively. Three independent experiments were performed, and a representative data set is shown. p values were determined by Student t test (n = 3). (B) Human CB CD34 cells were transduced with wtHES1-ER, BHES1-ER, or parental control lentivector, and successfully transduced GFP cells were assayed for colony-forming cell assays as above, except in the presence or absence of 4-hydroxytamoxifen (200 nM). Colonies were scored as in (A). Three independent experiments were performed, and a representative data set is shown. p values were calculated via Student t test (n = 3). (C): The relative level of total HES1 gene expression was determined by quantitative RT-PCR in FACS-sorted GFP cells that had been transduced with wtHES1 or control lentivector (after normalization to ß-actin expression in those cells). (D): Enriched populations of either enriched mono/granulocytic progenitor cells (CD34 /low) were transduced. Successfully transduced GFP cells were assayed for BFU-E. *p
/ T% ?( S( V2 A+ c- s! S+ h. U7 Y$ h6 a$ r. \+ u* l$ c' z
We observed similar results when human CD34 cells from BM or CB were used. To limit the actions to committed progenitors instead of the entire CD34 cell population, we next examined the effect of enforced HES1 expression on subsets of mono/granulocytic or erythroid progenitor cells purified from PBSC CD34 cells. Enforced HES1 expression inhibited the numbers of CFU-GM from enriched mono/granulocytic progenitor cells (Fig. 3D) and more strongly inhibited BFU-E generated from enriched erythroid progenitor cells (Fig. 3E).
9 I# A, C: ^5 y% k+ K( s2 r% m
, Y% S8 B$ p, fEnforced HES1 Expression Did Not Induce Apoptosis but Reduced Proliferation of HSPCs In Vitro
/ o/ P2 o; D2 j! V4 X$ ?2 m: R* y) Q# k* v
The effects observed above in CFCs suggested that HES1 might induce apoptosis and/or reduce proliferation of human hematopoietic progenitor cells. To determine whether enforced HES1 expression resulted in cell death in progenitor cells, CD34 cells were transduced with wtHES1 or control lentivector as above, and transduced (GFP ) cells were examined on days 2¨C5 by FACS analysis for apoptosis. No differences in apoptosis/viability were observed in wtHES1 lentivector¨Ctransduced cells, as compared to controls (Fig. 4A). These results were further confirmed using the inducible lentivectors (data not shown).1 z5 M* n4 g4 l r
- {# |6 U; p/ BFigure 4. Enforced HES1 expression inhibited cell proliferation of HSPCs in vitro. (A): After transduction with wtHES1 or control lentiviral vectors (lentivector), aliquots of transduced CB CD34 cells were examined for viability daily on days 2¨C5. The percent of viable GFP transduced cells that lacked of binding by Annexin V on cell surface and of intracellular DNA by 7-amino-actinomycin D (7-AAD) was determined for the control (triangles) or the wtHES1-transduced (circles) group. Two independent experiments were performed. (B): Aliquots of the same transduced (GFP ) CD34 cells were sorted and then plated in duplicate in 96 well plates (500 cells/well). Cells were enumerated using a digital camera microscopic image of each entire well. wtHES1 lentivector¨Ctransduced cells (solid line, filled circles) underwent reduced cell proliferation, compared to control vector¨Ctransduced cells (dotted line, empty circles). One representative of four independent experiments is shown. (C): Aliquots of the same transduced cells were cultured overnight in the presence of BrdU. Then cells were fixed, permeabilized, and stained with an anti-BrdU antibody. The percentages of BrdU cells were determined by quantifying eight microscopic fields documented by digital camera images. 1,000¨C2,000 total cells per group were counted. p 8 H/ Q+ }! Z/ l7 d/ l, w7 p
7 T+ ?8 ~6 E% t) VAliquots of the FACS-sorted transduced GFP /CD34 cells from the above experiment were plated in suspension cultures containing the FTK cytokines to examine their cell proliferation potential. Nearly all the cells remained GFP and viable by microscopy (Fig. 4B) during the 3-day culture. Although cell numbers in every group expanded over time, the wtHES1 lentivector¨Ctransduced cell cultures proliferated most slowly. On day 3 of culture, the control lentivector¨Ctransduced cultures contained twice as many cells as the wtHES1 lentivector¨Ctransduced cultures. When cell proliferation was measured by BrdU incorporation in cultured cells, there were nearly threefold more BrdU cells in the control-transduced group than in the wtHES1-transduced group (Fig. 4C).
7 z, m/ x4 m) H6 h( D' T0 R, \" \8 l* W, |6 V
We also measured the total numbers of cells per colony in CFC assays (Fig. 4D). In this set of experiments, CD34 cells were transduced with wtHES1-ER or BHES1-ER¨Cinducible lentivectors. Transduced (GFP ) cells were FACS sorted and then assayed in CFC assays in the presence or absence of 4HT. After colonies were counted, single-cell suspensions were made from each methylcellulose culture, and total cells were enumerated. The total number of colonies was reduced in the wtHES1-ER (but not the BHES1-ER)-transduced group, only in the presence of 4HT (not shown). Average total cell numbers per colony were also reduced by ~50% in the wtHES1-ER group. Thus, the reduction of cell proliferation was dependent on the HES1 DNA¨Cbinding domain.
- M9 y5 O* C: [: F4 M) `8 W H6 ^' b1 w1 F7 A
p21 has been identified as a target gene downstream of HES1 and is well known to negatively regulate cell cycle progression and cell proliferation . Enforced expression of wtHES1, but not BHES1, in CD34 cells induced the level of p21 mRNA by fivefold (Fig. 4E).
" n, U6 y, `- q1 g- F9 ~: m* Y0 m& U8 g; v2 q% R
Enforced HES1 Expression Reduced the Engraftment Capacity of Human or Mouse HSPCs
1 D# p% t6 `; k5 Z% Y; G! j, O$ u* |6 l7 ~5 Y0 p( L0 ^8 k/ s
To evaluate effects in human HSPCs capable of in vivo hematopoietic reconstitution, CD34 cells from CB were transduced with wtHES1, BHES1, or control (GFP only) lentivector as above, and transduction was assessed by GFP expression 48 hours later (transduction efficiencies were ~25% in all groups). On the same day, transduced cells (without FACS sorting) were transplanted into sublethally irradiated NOD-scid mice. Four weeks after transplantation, BM cells from transplanted or non-transplanted mice were isolated and analyzed by FACS for the presence of the transduced human (GFP /hCD45 ) cells. The group transduced with the wtHES1 lentivector contained significantly lower numbers of GFP /hCD45 cells, as compared to the BHES1 (Fig. 5A) or control (GFP) lentivector group (data not shown). This effect of HES1 on short-term engrafting HSCs complemented results of our in vitro experiments that largely measured hematopoietic progenitor/precursor cells.
) o. V( F( k& \* W- J9 ^5 S, o* N- G8 r$ q7 T9 h
Figure 5. Enforced expression of wtHES1 in human or mouse HSPCs reduced hematopoietic engraftment after primary transplantation. (A): Human cord blood CD34 cells were transduced with wtHES1, BHES1, or the GFP control lentiviral vectors (lentivector). Then 4 x 105 cells/mouse were transplanted intravenously (iv) into sublethally irradiated NOD-scid mice. Four weeks after transplantation, mice were sacrificed and BM cells assayed by fluorescence-activated cell sorting (FACS) for cells coexpressing GFP and hCD45. Three independent experiments were performed, with five mice per group in each experiment. Empty bars indicate mean percent GFP cells on transplant day 0 (i.e., transduction efficiency 2 days after transduction), and filled bars indicate cells co-expressing GFP and hCD45 (percent GFP /hCD45 cells) in NOD-scid mouse bone marrow 4 weeks post-transplant. The data from the control vector group are not shown but were similar to those with BHES1. p values were determined by Student t test. (B): Mouse Lin¨C BM cells from CD45.1 mice were transduced with wtHES1, BHES1, or GFP control lentivector. Similar transduction efficiencies (~15%; week 0) were observed in each group. 5 x 105 treated (non-FACS sorted) cells were transplanted iv into each CD45.2 recipient mouse (eight mice per group). Every 2¨C3 weeks, blood was obtained and the percent cells coexpressing mCD45.1 (donor-derived) and GFP (transduced) were determined by FACS. p 9 I7 M8 E* f: h* {: U
6 O) F! Y( Y/ b
To determine the effects of enforced HES1 expression in mouse HSPCs, we utilized the mouse¨Cmouse marrow transplantation model where serial transplantation could be used to assess both short- and long-term engraftment. Mouse Lin¨C BM cells were transduced with wtHES1, BHES1, or control (GFP) lentivector for 2 days. Then transduced mCD45.1 cells, without FACS sorting, were transplanted into lethally irradiated mCD45.2 mice. After the primary transplantation, significantly lower levels of transduced donor (GFP /mCD45.1 ) cells were found in the wtHES1-transduced group, compared to the BHES1 or control (GFP)-transduced groups (Fig. 5B).
8 d4 P1 _+ |# k, V
) J* q0 M) |; L, |4 T# S% D$ f# C& ASimilar experiments were repeated using mouse BM cells transduced with the wtHES1-ER or BHES1-ER inducible vector. Starting at 1 week post-transplant, half of the mice from each group were treated with 4HT plus tamoxifen to induce maximal ER fusion protein activation. Three weeks later, the levels of GFP /mCD45.1 cells in blood from each transplanted mouse in each group (n = 10) were determined as above. In mice receiving no induction, the levels of GFP /mCD45.1 cells in blood in the wtHES1-ER and BHES1-ER groups were similar. (This result correlated well with the observation of similar transduction efficiency in all groups prior to transplant.) However, the levels of GFP /mCD45.1 cells in the blood of the wtHES1-ER transduced group after transgene activation dropped from 30% to ~15%, while those in the BHES1-ER transduced group did not change significantly. Conditional activation of HES1 eliminated possible explanations, such as that the reduction in donor cell engraftment in the wtHES1-trandsduced group was due to a defect in homing. In addition, enforced HES1 expression did not alter differentiation in any lineage (data not shown). Thus, the reduction of short-term cell repopulation by HES1-transduced cells complemented the in vitro data indicating that enforced HES1 expression reduced the proliferation of hematopoietic progenitor/precursor cells.: P9 ?$ L* H# ?$ B6 Z- p6 H, @" L
% D: ]7 G1 M7 w+ D3 ~HES1-Transduced HSPCs Generated Long-Term Hematopoiesis In Vivo in Secondary and Tertiary Transplants
t1 k. f5 P" X+ M2 X5 B# J; ~# \: k8 a
To study whether enforced HES1 expression affects long-term engraftment capacity, we performed serial transplantations of FACS-sorted transduced cells using the mouse¨Cmouse transplantation model. At 8 weeks post-transplant, BM cells were pooled from a group of primarily transplanted mice. GFP /mCD45.1 (i.e., transduced/donor-derived) cells were FACS sorted and mixed (1:8) with BM cells from naive (i.e., nontrans-planted) mCD45.1 mice. The latter cell population was provided to help assure the survival of lethally irradiated CD45.2 (secondary) recipient mice (Fig. 6A). In contrast to the results in the primary transplants (Fig. 5), the mice that underwent secondary transplants in the wtHES1-transduced group had higher levels of GFP /mCD45.1 blood cells over time than did the mice that underwent secondary transplants with the BHES1-or control-transduced group. To extend this observation, we performed tertiary competitive transplantations. At 8 weeks after secondary transplant, four mice from each group (Fig. 6A) were sacrificed, and pooled BM cells were FACS sorted to isolate GFP /mCD45.1 BM cells. These labeled donor cells from secondary recipients were mixed (1:3) with CD45.1 naïve BM cells and transplanted into the naive tertiary CD45.2 recipient mice. At 3 or 5 weeks after tertiary transplantation, GFP /mCD45.1 cells were barely detectable in mice that had been tertiary transplanted with BHES1- or control lentivector¨Ctransduced cells (Fig. 6B, 6C). However, GFP /mCD45.1 cells were easily detected in the blood of each recipient mouse (n = 4) in the wtHES1-transduced group (Fig. 6B, 6C).. l6 R7 R1 a/ z2 X. Y7 m' W
8 D/ h* v1 ] D4 wFigure 6. Enforced HES1 expression maintained levels of blood cells in serial competitive transplantation experiments. (A): 8 weeks post-transplantation, GFP BM cells pooled from three of eight primary transplanted mice from each group were mixed with untransduced BM cells from naïve CD45.1 mice. This cell mixture was transplanted iv into secondary recipient CD45.2 mice (five mice per group). Mice were bled every 2¨C3 weeks, and the percent GFP /mCD45.1 cells was measured by FACS. The above secondary competitive transplant experiment was repeated using three of five remaining mice from each group at 9 weeks post-transplant. p 4 L7 k% j( O3 W* q* [ o: ]
/ a6 D9 O; K1 [
We analyzed the cell-cycle status of donor cells, which had been transduced with the wtHES1, BHES1, or control (GFP) lentivectors. At 8 weeks after secondary transplant, an aliquot of pooled and sorted CD45.1 /GFP BM cells (most of which were used for tertiary transplants) was analyzed for cell cycle status (Fig. 6D). Five percent of the engrafted donor cells in the wtHES1-transduced secondary transplanted group were in S/G2/M phases. In contrast, 16.4% and 21% of the engrafted donor cells were in the S/G2/M phases in the control (GFP)- and BHES1-transduced groups, respectively.* a4 k" k. y' c7 ^2 ?/ C s$ J
! R! f! S% p L2 p: ?
DISCUSSION: i8 M3 V7 u6 g: z L0 |, u
) j; [6 R1 u6 ]6 g6 \3 y
In this study we found that HES1, a major downstream target of the Notch signaling pathway, was preferentially expressed in the small (CD34 /. In addition, HES1 expression was high in the fraction of the human CD34 cell subset that had remained quiescent during a 7-day ex vivo culture period but low in the CD34 cell fraction that had divided extensively. Constitutive or inducible expression of HES1 reduced the proliferation of human and mouse progenitor/precursor cells, as assayed by in vitro assays. Enforced expression of HES1 in HSPCs appeared to reduce short-term donor cell reconstitution in vivo but did not reduce long-term engraftment capacity. We detected no significant effect of HES1 on apoptosis; instead, enforced HES1 expression reduced cell cycling both in vitro and in vivo. These inhibitory effects on cell proliferation were dependent on the presence of the HES1 DNA¨Cbinding domain.
$ [8 b, [+ O& v: A% \* k' x# `5 O; _2 `, H* d; `+ s, |
Our observations are consistent with previous reports that HES1 inhibited erythropoiesis from in vitro cultured cells (by suppressing GATA-1) .) M8 P& E3 U' v- r8 U% g: u
# f; H( K G+ ^The inhibitory effect of HES1 on human and mouse HSPC proliferation is not fully understood. As a bHLH protein, HES1 could block other essential bHLH proteins either by heterodimerization or by transcriptional regulatory effects. Indeed, DNA-binding¨Cindependent activities have been shown for several bHLH transcription factors . Similarly, the inhibitor of differentiation subfamily of bHLH proteins lacking DNA-binding capacity can dimerize with and sequester various bHLH proteins and thereby block cell proliferation or differentiation. Our data do not support this protein¨Cprotein mechanism for the effects we observed with HES1, as transduction of the BHES1 mutant defective in DNA-binding function had no detectable effects in transduced HSPCs, in vitro or in vivo.0 P1 g' b' `+ k3 S0 \4 t
, A2 {. s* h) i: REnforced HES1 expression did not cause HSPC death, consistent with a previous report that blocking Notch signaling did not affect viability of nontransformed hematopoietic cells , the elevated p21 levels that we observed accompanying enforced HES1 expression may enhance quiescence and reduce exhaustion of HSCs.! _7 ^) U2 S2 k3 ]5 c$ }9 N# @
1 q" ~1 Y# {, }& A
Our model regarding the role of HES1 is consistent with considerable published data examining the function of HES1 and Notch signaling in hematopoiesis. Taking our results together with several other reports, it appears that relatively high levels of cellular HES1 inhibit hematopoietic progenitor/precursor cell proliferation, with reductions in proliferation and CFC numbers in vitro and short-term hematopoietic reconstitution in vivo recently reported that retroviral vector¨Ctransduced HES1 expression had little effect on hematopoietic CFCs assayed in vitro but enhanced short-term hematopoietic reconstitution in vivo.8 q! y, f- | `. o6 N4 o
1 y6 e" L ^5 m2 }3 l+ M# ]The following differences between our studies and those of Shojaei et al. should be considered. First, we used recently developed lentivectors, while Shojaei et al. used retroviral vectors. Consequently, Shojaei had to use a 6-day culture and stimulation protocol, as only proliferating cells can be transduced by retroviral vectors; using lentivectors, our transductions could be completed in 48 hours and a higher proportion of the earlier, less-proliferative cells were effectively transduced. Second, transduction efficiencies in the Shojaei study were quite low:
# `# N5 @1 S% k. `4 s; ], I
' x* g% Z+ a% v8 }/ @" fIn summary, our data indicate that expression of this single downstream Notch pathway effector, HES1, was sufficient to mediate the reported inhibition by Notch signaling of hematopoietic progenitor cell proliferation in vitro and short-term hematopoietic reconstitution in vivo. However, there was no inhibitory effect of enforced HES1 expression on long-term reconstitution.2 G1 r# ]3 I& r( y/ E* E% u
2 ^: ^# p* L% p- X' C1 `6 FACKNOWLEDGMENTS( A7 B- K9 @) q$ B* }. b4 \2 ~
# l+ a; P1 z2 Z; v* U
This research was supported in part by grants from the National Foundation for Cancer Research and NIH (CA070970 and HL072229 to C.I.C.; HL073781 to L.C.). We thank Dr. Vivek M. Tanavde for excellent technical advice and members of the Civin lab for helpful discussions. d2 ]% j0 T$ B- O
. I! z" ^6 e- R" F0 n! f n0 tDISCLOSURES& t: f3 E- H* [( I) y5 i, Q+ m+ `2 u- m
% D9 x4 @3 Z" x- _ J
The Johns Hopkins University holds patents on CD34 monoclonal antibodies and related inventions. Dr. Civin is entitled to a share of the sales royalty received by the university under licensing agreements between the university, Becton, Dickinson and Company and Baxter HealthCare Corporation. The terms of these arrangements have been reviewed and approved by the University in accordance with its conflicts-of-interest policies." D# o" ^9 ~! [9 _, v, J
【参考文献】0 G/ ]! L1 z+ k1 L3 Q8 r' @6 F
( j( q' e# _! d+ f& s. ]1 g1 [' p& K F8 P0 \
Selkoe DJ. Notch and presenilins in vertebrates and invertebrates: implications for neuronal development and degeneration. Curr Opin Neurobiol 2000;10:50¨C57.* K' x; M$ x/ [
+ @8 G: n. N1 ]: d8 |
Lewis J. Notch signalling and the control of cell fate choices in vertebrates. Semin Cell Dev Biol 1998;9:583¨C589." B' k) }$ B$ c+ k0 x
c5 j6 |3 q5 k0 T; k* A
Artavanis-Tsakonas S, Rand MD, Lake RJ. Notch signaling: cell fate control and signal integration in development. Science 1999;284:770¨C776.9 E* }) Q+ P: H7 k' n/ w" ]% Y7 e
" u n' u% J6 ^Ellisen LW, Bird J, West DC et al. TAN-1, the human homolog of the Drosophila notch gene, is broken by chromosomal translocations in T lymphoblastic neoplasms. Cell 1991;66:649¨C661.
: j# n1 x9 i; M |; @! B* o. N' L5 Q0 O
Gridley T. Notch signaling in vertebrate development and disease. Mol Cell Neurosci 1997;9:103¨C108.' L: j9 J5 S7 u# i h; ?
; W- `; I: u5 S$ l# w5 C, J& w% hJoutel A, Corpechot C, Ducros A et al. Notch3 mutations in CADASIL, a hereditary adult-onset condition causing stroke and dementia. Nature 1996;383:707¨C710.
) i' Z! [% k2 g0 L3 b* n& D
, Q& Q* {7 o6 G5 C! Q& ?, \Lee JM, Lee KH, Weidner M et al. Epstein-Barr virus EBNA2 blocks Nur77- mediated apoptosis. Proc Natl Acad Sci U S A 2002;99:11878¨C11883.
( t" t' @9 N! K! _- J' s" W7 b9 n* r+ L; q9 H; Q: a
Miele L, Osborne B. Arbiter of differentiation and death: notch signaling meets apoptosis. J Cell Physiol 1999;181:393¨C409.
0 h, q0 L- L8 A$ }7 J8 L1 ~+ ~2 A/ |8 ]
Qi H, Rand MD, Wu X et al. Processing of the notch ligand delta by the metalloprotease Kuzbanian. Science 1999;283:91¨C94.# O( B, ]" u* U
5 g }) j$ M( |2 XSchroeter EH, Kisslinger JA, Kopan R. Notch-1 signalling requires ligand-induced proteolytic release of intracellular domain. Nature 1998; 393:382¨C386.. w3 A% p2 h& ?
! v/ n. P- l0 c& X, u8 t2 iWu L, Aster JC, Blacklow SC et al. MAML1, a human homologue of Drosophila mastermind, is a transcriptional co-activator for NOTCH receptors. Nat Genet 2000;26:484¨C489.
: `* G$ b. Z8 l3 L- j. Q5 @& ~5 y" k5 |; [3 _
Cayouette M, Whitmore AV, Jeffery G et al. Asymmetric segregation of Numb in retinal development and the influence of the pigmented epithelium. J Neurosci 2001;21:5643¨C5651.3 Z/ b5 ^8 ~% K0 p+ ^% r
+ F. t# M R- e8 O1 h$ a2 n
Tsunematsu R, Nakayama K, Oike Y et al. Mouse Fbw7/Sel-10/Cdc4 is required for notch degradation during vascular development. J Biol Chem 2004;279:9417¨C9423.) S2 N6 i6 U; Q8 e' }; {
* g' W& S) [: \7 z% l8 h$ RZhou S, Hayward SD. Nuclear localization of CBF1 is regulated by interactions with the SMRT corepressor complex. Mol Cell Biol 2001; 21:6222¨C6232.
3 h! q5 Z9 z9 J& |% v0 Y; r7 Z* G8 N
Maillard I, Fang T, Pear WS. Regulation of lymphoid development, differentiation, and function by the Notch pathway. Annu Rev Immunol 2005;23:945¨C974.9 Y' U: A0 H* e
' E& j. J( t. j, H8 Q1 w1 n
Kumano K, Chiba S, Kunisato A et al. Notch1 but not Notch2 is essential for generating hematopoietic stem cells from endothelial cells. Immunity 2003;18:699¨C711.
' U! D& U7 u* R, v) _: K& e5 t( N1 r; S# h! u1 {4 [8 r: x
Radtke F, Wilson A, Stark G et al. Deficient T cell fate specification in mice with an induced inactivation of Notch1. Immunity 1999;10:547¨C558.: B; ?: }& r. y5 l
: S7 I/ ?! b1 v4 z, K1 Y
Kageyama R, Nakanishi S. Helix-loop-helix factors in growth and differentiation of the vertebrate nervous system. Curr Opin Genet Dev 1997;7:659¨C665.6 s/ D5 p9 R" T* I* _' f
, p! V A' b, N( gDavis RL, Turner DL. Vertebrate hairy and enhancer of split related proteins: transcriptional repressors regulating cellular differentiation and embryonic patterning. Oncogene 2001;20:8342¨C8357.- c4 m0 [% b2 F# X" s) ~, o
" M- O7 E8 t; }# G0 k' gGiagtzoglou N, Alifragis P, Koumbanakis KA et al. Two modes of recruitment of E(spl) repressors onto target genes. Development 2003; 130:259¨C270.- r$ y" s4 D0 S8 l+ n( S
l" ?1 r7 ~: {3 J4 A. f- W; jSasai Y, Kageyama R, Tagawa Y et al. Two mammalian helix-loop-helix factors structurally related to Drosophila hairy and enhancer of split. Genes Dev 1992;6:2620¨C2634.* S9 E n6 f& Z& ?, Z
6 C X o& A9 s4 o4 u" H
Alifragis P, Poortinga G, Parkhurst SM et al. A network of interacting transcriptional regulators involved in Drosophila neural fate specification revealed by the yeast two-hybrid system. Proc Natl Acad Sci U S A 1997;94:13099¨C13104. u, }0 @+ h' w1 }& r9 z
. S' t" [) K4 W1 W9 U7 z4 _, x, A0 [Chen H, Thiagalingam A, Chopra H et al. Conservation of the Drosophila lateral inhibition pathway in human lung cancer: a hairy-related protein (HES-1) directly represses achaetescute homolog-1 expression. Proc Natl Acad Sci U S A 1997;94:5355¨C5360." a) [8 I' _# n" @& l
1 A- D3 ~# y; ]$ ~4 k
Paroush Z, Finley RL, Jr., Kidd T et al. Groucho is required for Drosophila neurogenesis, segmentation, and sex determination and interacts directly with hairy-related bHLH proteins. Cell 1994;79:805¨C815.) P$ `. j" ~* B2 f/ |+ C7 c a
# Y' K) N& ?3 RNaar AM, Lemon BD, Tjian R. Transcriptional coactivator complexes. Annu Rev Biochem 2001;70:475¨C501.5 ^. R* f& [9 j- o S
$ Y1 e2 h% @( {) ]9 e" S3 ^Littlewood TD, Hancock DC, Danielian PS et al. A modified oestrogen receptor ligand-binding domain as an improved switch for the regulation of heterologous proteins. Nucleic Acids Res 1995;23:1686¨C1690.2 H4 r2 J" n! e, n' O5 ]
$ S( ^# u6 a1 d S$ t3 ~' {
Tomita K, Hattori M, Nakamura E et al. The bHLH gene Hes1 is essential for expansion of early T cell precursors. Genes Dev 1999;13: 1203¨C1210.% q# N B, @4 k
5 g9 r: Z# I4 A! I$ n' w; R! S5 fKawamata S, Du C, Li K et al. Overexpression of the Notch target genes HES in vivo induces lymphoid and myeloid alterations. Oncogene 2002; 21:3855¨C3863.1 W7 C- b- ?+ T! R4 A
6 [% K8 u6 w: k
Kunisato A, Chiba S, Nakagami-Yamaguchi E et al. HES-1 preserves purified hematopoietic stem cells ex vivo and accumulates side population cells in vivo. Blood 2003;101:1777¨C1783.8 X3 p8 d: C! V
: q3 w/ l9 T X) i" V% r
Castella P, Sawai S, Nakao K et al. HES-1 repression of differentiation and proliferation in PC12 cells: role for the helix 3-helix 4 domain in transcription repression. Mol Cell Biol 2000;20:6170¨C6183.
( K. X/ s' X9 N' D& D! j8 v" j. Y
) i! e, j. x2 ^; nFurukawa T, Mukherjee S, Bao ZZ et al. rax, HES1, and notch1 promote the formation of Muller glia by postnatal retinal progenitor cells. Neuron 2000;26:383¨C394.
# @# i; r* L, ?0 f2 \( A+ w3 p7 _4 T, t
Yu X, Zhan X, D¡¯Costa J et al. Lentiviral vectors with two independent internal promoters transfer high-level expression of multiple transgenes to human hematopoietic stem-progenitor cells. Mol Ther 2003;7:827¨C838.9 p, S% j% y: y; f. N- T) w
3 O& L+ h& q, U, ^& H& c" S$ N' C1 ~
Lois C, Hong EJ, Pease S et al. Germline transmission and tissue-specific expression of transgenes delivered by lentiviral vectors. Science 2002; 295:868¨C872.
5 n( t6 f, B2 o5 s. D S+ I/ c6 R2 o5 c2 k( \! ~: ?+ Q) A
Blyth K, Stewart M, Bell M et al. Sensitivity to myc-induced apoptosis is retained in spontaneous and transplanted lymphomas of CD2-mycER mice. Oncogene 2000;19:773¨C782.' ~6 j8 a6 a m5 h7 _ g6 ^
, j0 o6 y3 x4 }$ t8 gPelengaris S, Khan M, Evan GI. Suppression of Myc-induced apoptosis in beta cells exposes multiple oncogenic properties of Myc and triggers carcinogenic progression. Cell 2002;109:321¨C334.. R3 U# Z+ h; j) U2 I
' W7 S$ t$ n) t) m! q; g2 m# O; J8 j8 lYu X, Shacka JJ, Eells JB et al. Erythropoietin receptor signalling is required for normal brain development. Development 2002;129:505¨C516.
1 ~2 Y( y% _( N5 C$ ~5 e) g3 T6 J' @- w* z3 ~, w, \3 ^6 d6 [+ V
Cao W, Britos-Bray M, Claxton DF et al. CBF beta-SMMHC, expressed in M4Eo AML, reduced CBF DNA-binding and inhibited the G1 to S cell cycle transition at the restriction point in myeloid and lymphoid cells. Oncogene 1997;15:1315¨C1327.
- J; y) v( Z8 x/ P) d7 b1 [% y8 V6 c' w: l& _6 J* n& k- t# A
Tanavde VM, Malehorn MT, Lumkul R et al. Human stem-progenitor cells from neonatal cord blood have greater hematopoietic expansion capacity than those from mobilized adult blood. Exp Hematol 2002;30: 816¨C823.5 |2 ]: f) | R. u, [( N: t& S+ ?
6 `" n+ \9 G) o, s/ i
Uchida N, He D, Friera AM et al. The unexpected G0/G1 cell cycle status of mobilized hematopoietic stem cells from peripheral blood. Blood 1997;89:465¨C472.
, Q3 f1 y6 \8 u6 u1 m8 u0 G/ q! f" W- o4 i2 Z
Gothot A, Pyatt R, McMahel J et al. Functional heterogeneity of human CD34( ) cells isolated in subcompartments of the G0 /G1 phase of the cell cycle. Blood 1997;90:4384¨C4393. f: |7 w9 v# G4 b8 q
' u: E1 g3 s1 g0 L" {' @Srour EF, Tong X, Sung KW et al. Modulation of in vitro proliferation kinetics and primitive hematopoietic potential of individual human CD34 CD38-/lo cells in G0. Blood 2005;105:3109¨C3116.3 D+ }% L0 G3 ~" V( y' o6 E0 K0 @( L' @
% |+ ^- \3 `- o3 _* n0 _
Ishiko E, Matsumura I, Ezoe S et al. Notch signals inhibit the development of erythroid/megakaryocytic cells by suppressing GATA-1 activity through the induction of HES1. J Biol Chem 2005;280:4929¨C4939.2 b; s9 Q0 e' c& O1 Q+ z( n* O, J
( K3 C( F Z( p: L* Z
Stier S, Cheng T, Dombkowski D et al. Notch1 activation increases hematopoietic stem cell self-renewal in vivo and favors lymphoid over myeloid lineage outcome. Blood 2002;99:2369¨C2378.
& R5 z9 {2 j% v- l/ G* [5 c: A- e% H8 J7 ^% M
Vercauteren SM, Sutherland HJ. Constitutively active Notch4 promotes early human hematopoietic progenitor cell maintenance while inhibiting differentiation and causes lymphoid abnormalities in vivo. Blood 2004; 104:2315¨C2322.
3 I E" r E+ e6 N' `3 k. w; K6 a/ z$ R s( j* S; ~0 b+ A4 W* S5 S
Delaney C, Varnum-Finney B, Aoyama K et al. Dose-dependent effects of the Notch ligand Delta1 on ex vivo differentiation and in vivo marrow repopulating ability of cord blood cells. Blood 2005;106:2693¨C2699. n2 w" _% h) z' f- j9 l3 T8 l) G$ k
8 ], o* o( T5 q5 [5 ?8 R/ t* {
Zweidler-McKay PA, He Y, Xu L et al. Notch signaling is a potent inducer of growth arrest and apoptosis in a wide range of B-cell malignancies. Blood 2005;106:3898¨C3906.
/ J- n5 ]8 j9 e: I' F! |7 U* V3 B y$ k5 V+ K
Atchley WR, Fitch WM. A natural classification of the basic helix-loop-helix class of transcription factors. Proc Natl Acad Sci U S A 1997;94: 5172¨C5176.4 K8 k: z- p/ e4 D0 s
9 Z" Q# {4 R8 }1 l) B# n( c
Porcher C, Liao EC, Fujiwara Y et al. Specification of hematopoietic and vascular development by the bHLH transcription factor SCL without direct DNA binding. Development 1999;126:4603¨C4615.9 E9 A/ \# Y- B
) d- F( M% D( u6 v
O¡¯Neil J, Billa M, Oikemus S et al. The DNA binding activity of TAL-1 is not required to induce leukemia/lymphoma in mice. Oncogene 2001; 20:3897¨C3905.
, z! a! n- r! z& k/ k
! `. W% f' P4 ^' eDuncan AW, Rattis FM, DiMascio LN et al. Integration of Notch and Wnt signaling in hematopoietic stem cell maintenance. Nat Immunol 2005;6:314¨C322.& y* a' P& G& G' t! z
/ g# K; t( ^! C6 y8 J4 }* xSherr CJ, Roberts JM. CDK inhibitors: positive and negative regulators of G1-phase progression. Genes Dev 1999;13:1501¨C1512.( n5 s4 V! e) D, @, B* X: Q3 Q
1 a" m1 B' i+ \ zCheng T, Rodrigues N, Shen H et al. Hematopoietic stem cell quiescence maintained by p21cip1/waf1. Science 2000;287:1804¨C1808.
/ z. ]+ F' q. U% ^/ k( b) O6 q" H$ }3 ^$ `
Liu M, Lee MH, Cohen M et al. Transcriptional activation of the Cdk inhibitor p21 by vitamin D3 leads to the induced differentiation of the myelomonocytic cell line U937. Genes Dev 1996;10:142¨C153.0 l" r- ~3 u- e2 t7 {1 P+ v: n
# U3 H) f' n- t8 v
Zhang W, Grasso L, McClain CD et al. p53-independent induction of WAF1/CIP1 in human leukemia cells is correlated with growth arrest accompanying monocyte/macrophage differentiation. Cancer Res 1995; 55:668¨C674.
. ^& v5 c2 T, X
/ I( }2 Z2 o# P& @Mantel C, Luo Z, Canfield J et al. Involvement of p21cip-1 and p27kip-1 in the molecular mechanisms of steel factor-induced proliferative synergy in vitro and of p21cip-1 in the maintenance of stem/progenitor cells in vivo. Blood 1996;88:3710¨C3719.& G) S- E L0 ?
! R3 n9 t; O: r3 H$ f+ s$ ?7 yBraun SE, Mantel C, Rosenthal M et al. A positive effect of p21cip1/waf1 in the colony formation from murine myeloid progenitor cells as assessed by retroviral-mediated gene transfer. Blood Cells Mol Dis 1998;24:138¨C148.: `- b2 b# y% m$ I- ~' z3 s h
- J* ]* g+ `5 h, xMurata K, Hattori M, Hirai N et al. HES1 directly controls cell proliferation through the transcriptional repression of p27Kip1. Mol Cell Biol 2005;25:4262¨C4271.
7 Q' _$ i( B; ~1 r8 P* S
% Q2 c5 I$ g0 A* e3 ]Hock H, Hamblen MJ, Rooke HM et al. Gfi-1 restricts proliferation and preserves functional integrity of haematopoietic stem cells. Nature 2004; 431:1002¨C1007.
' V. p5 G( G, v$ z& q; j2 g4 t6 c' f. ~, |7 m
Ishiko E, Matsumura I, Ezoe S et al. Notch signals inhibit the development of erythroid/megakaryocytic cells by suppressing GATA-1 activity through the induction of HES1. J Biol Chem 2005;280:4929¨C4939.
2 J. C" v- [# k& Z; {5 [3 t) L
& e( k! A& G& h+ [! U" b9 O( TShojaei F, Trowbridge J, Gallacher et al. Hierarchical and ontogenic positions serve to define the molecular basis of human hematopoietic stem cell behavior. Dev Cell 2005;8:651¨C663.
. k+ i# Y- G+ q2 ?" K5 y( x" f' W# J! f+ ]% d
Cheng L, Du C, Lavau C et al. Sustained gene expression in retrovirally transduced, engrafting human hematopoietic stem cells and their lympho-myeloid progeny. Blood 1998;92:83¨C92.
- Y: z- w2 {8 @1 j4 L& r/ |* E7 A6 l, ~
Klug CA, Cheshier S, Weissman IL. Inactivation of a GFP retrovirus occurs at multiple levels in long-term repopulating stem cells and their differentiated progeny. Blood 2000;96:894¨C901.3 w; B8 M8 P* q3 e9 e# ~: H
, K4 p% A+ p7 J7 n+ dKaneko S, Onodera M, Fujiki Y et al. Simplified retroviral vector gcsap with murine stem cell virus long terminal repeat allows high and continued expression of enhanced green fluorescent protein by human hematopoietic progenitors engrafted in nonobese diabetic/severe combined immunodeficient mice. Hum Gene Ther 2001;12:35¨C44. |
|