|
  
- 积分
- 0
- 威望
- 0
- 包包
- 483
|

作者:Jia Wei Liua, Gilles Pernoda,b, Sylvie Dunoyer-Geindrea, Richard J. Fisha, Hong Yanga, Henri Bounameauxa, Egbert K. O. Kruithofa作者单位:a Division of Angiology and Haemostasis, University Hospital, Geneva, Switzerland;b Unit dHmostase, Grenoble, France 9 n) F: M; W- Z& P* b6 P% I
; g% G9 Z& }% _# x% ]
# W( ~6 x6 ?8 j- W, D' y8 F
0 r* o, u5 L+ Q& w2 J% S& ~" G) f8 I+ }
' x8 I" F! M+ p
* R' |! X4 L% K1 l$ |7 c
9 T6 i$ \+ I3 A, [! B8 ~' d; Y
4 M# ?: K+ V0 }
* ]$ l! s8 I- A* ? # p9 D7 j( E( y
& @. ^# y8 a$ G$ N2 }6 ?
( D) \/ W9 ~4 F' L6 ?! x
# z0 {# I8 p* d- q1 J
【摘要】) j" n ?% U- Q: }
Peripheral blood¨C derived endothelial progenitor cells (EPCs) have considerable potential for the autologous therapy of vascular lesions or ischemic tissues. By introducing stable genetic modifications into these cells, this potential might be further enhanced. We investigated to what extent transgene expression can be controlled by using different transgene promoters. This was investigated in early- or late-outgrowth human EPCs obtained by culturing blood mononuclear cells for 1 or 4 weeks on type 1 collagen in medium containing endothelial growth supplements. A large fraction of these cells were stably transduced using lentiviral vectors for expression of the enhanced green fluorescent protein (EGFP). Transgene expression in vitro or in vivo after injection into nude mice was highest when under the control of the cytomegalovirus (CMV) promoter, intermediate with the EF1 promoter, and lowest with the phosphoglycerate kinase promoter. When blood mononuclear cells were cultured for 1 week in the absence of endothelial growth supplements, CMV promoter¨C driven expression of EGFP was two orders of magnitude lower than in similarly transduced EPCs. Our results show that lentiviral vectors are useful tools for the stable introduction of exogenous genes into EPCs and for their expression at desired levels using the appropriate gene promoter. . W) L! U; \+ e2 {) m4 Y
【关键词】 Lentiviral vector Endothelial progenitor cell Gene therapy' Y3 Q6 L8 ?% H; y Y
INTRODUCTION& e+ A. v, ~: ?, Q
) V' o1 h4 ?0 `. \; c
Human blood contains bone marrow¨Cderived endothelial progenitor cells (EPCs). Although the exact characteristics of these cells and optimal isolation procedures are still being debated, their potential to migrate to regions of ischemia is well established .! ^( @1 t C6 V: z% F8 h
4 a9 O. ^. ^- Y' EEPCs have been used to increase blood flow in experimental models of limb ischemia or ischemic heart disease .
% X- p/ b- f( Y# y3 o- g. M2 ^5 K( G/ x Z% o' h6 }. e: y5 U
By using gene transfer techniques, the therapeutic potential of EPCs might be enhanced. Thus, after transfer of the vascular endothelial growth factor gene into human EPCs, an increased neovascularization was obtained in an experimental model of limb ischemia in athymic mice .
: K, a& C0 `+ v" X, Q+ i, }; t# {5 h5 I
For therapeutic applications, it is imperative to express transgenes at desired and stable levels. The present study was designed to compare the potency of various gene promoters in early- and late-outgrowth EPCs derived from blood mononuclear cells. We observed that the level of stable transgene expression in lentivirus-transduced EPCs could be modulated over several orders of magnitude, with the cytomegalovirus (CMV) promoter exhibiting the highest activity.
: w/ `5 D2 D& t" U: {& }; a( N+ R/ s: [( o: `
MATERIALS AND METHODS7 s i# {6 q5 d' R
( D) g5 z3 `4 Y$ g: m9 E i
Cell Culture4 b! X4 R7 M% p1 l% v7 b! s
% M7 b% |0 v& S' F& ]+ sEndothelial Progenitor Cells Mononuclear cells were isolated from human blood by centrifugation on Histopaque 1077 (Sigma-Aldrich, St. Louis, http://www.sigmaaldrich.com) and plated on 6- or 12-well culture dishes coated with type 1 collagen (BD Biosciences, San Jos¨¦, CA, http://www.bdbiosciences.com). The culture medium was composed of endothelial basal medium (EBM-2) (Cambrex, Verviers, Belgium, http://www.cambrex.com) supplemented with 2% decomplemented fetal calf serum and an endothelial growth supplement (EGM-2 SingleQuots, Cambrex), which is a mixture of human VEGF, epidermal growth factor, fibroblast growth factor-beta, insulin-like growth factor-1, hydrocortisone, ascorbic acid, and heparin . Nonadherent cells were removed after 48 hours and every second day thereafter. The cells obtained after 1 week in culture are henceforth designated early-outgrowth EPCs, and the cells obtained after 4 weeks in culture are designated late-outgrowth EPCs. In some experiments, the cells were incubated in Dulbecco¡¯s modified Eagle¡¯s medium (DMEM) containing 10% decomplemented fetal calf serum (Invitrogen, Basel, Switzerland, http://www.invitrogen.com) instead of EGM-2.
6 `2 d: H: ]5 T& n, w. c
: r( E; W* b, l4 l( HHuman Umbilical Vein Endothelial Cells Human umbilical vein endothelial cells (HUVECs) were isolated and cultured as described previously . HeLa and 293T cells were grown in RPMI, 10% fetal calf serum and DMEM, 10% fetal calf serum, respectively. The blood and umbilical cord samples were obtained with written informed consent from the donors or mothers, with local hospital ethics committee approval.
2 q9 r" X0 ^2 u4 N4 X5 G, F6 h5 y: O" X; j1 ^
Lentiviral Vector Production and Titer Determination For lentiviral vector production, three plasmids were used: pC-MVR8.91 encodes HIV structural genes, pMD.G bears the VSV-G envelope cDNA, and pLoxGFP transfer vectors carry the enhanced green fluorescent protein (EGFP) gene under the control of the cytomegalovirus (CMV) promoter, the human elongation factor (EF1) promoter, or phosphoglycerate kinase (PGK) promoter (all plasmids were gifts from Dr. D. Trono, University Medical Center, Geneva, Switzerland, and have been described in detail elsewhere . Sixteen hours after transfection, the medium was changed. Conditioned medium was collected 48 hours later, centrifuged (900g, 5 minutes), passed through 0.45-µm sterile filters, concentrated 100 times by passage through an Amicon Ultra 100,000 MCO filter (Millipore, Billerica, MA, http://www.millipore.com), and stored at ¨C80¡ãC.
6 w' O& u! v, ~; O' P: \2 a) N' h: i- V& d* `4 D$ x5 z @
Vector titers were determined by flow cytometry analysis of EGFP expression in HeLa cells. Each vector was mixed with polybrene (8 µg/ml) and added to the cells. The cell-containing plates were centrifuged for 1 hour at 1,400g at 25¡ãC, and the cells were further incubated with vector for 72 hours at 37¡ãC in a CO2 incubator. GFP expression was analyzed by flow cytometry, and titers are expressed as transduction units per milliliter (TU/ml). The recombinant DNA work and production of lenti-viral vectors were done according to "Swiss federal guidelines for work with genetically modified organisms."3 Z. h! g& I) G$ k# b) N* `
8 F; z0 k3 g+ Z% R5 mIn Vitro Transduction of HUVECs and EPCs: S2 A1 C7 Q7 @/ P9 ]! e/ q
6 R* S. @0 o6 {! _6 hHUVECs A total of 105 cells were seeded in 24-well plates coated with 0.1% gelatin. The next day, lentiviral vectors, mixed with polybrene (8 µg/ml), were added to the cells at different multiplicities of infection (MOI), centrifuged for 1 hour at 1,400g and 25¡ãC, and incubated for 16 hours at 37¡ãC in 500 µl medium. After incubation, cells were cultured in 1 ml fresh medium. At the specified time points, HUVECs were washed and fixed in 2.5% paraformaldehyde and 2% glucose in phosphate buffered saline (PBS) before flow cytometry analyses for EGFP expression on a FACScan instrument (Becton, Dickinson and Company, Mountain View, CA, http://www.bd.com).
8 X& ?9 V# y/ H' O# J4 S
N* C4 L3 V- S% uEPCs Cells were transduced with lentiviral vectors at a MOI of 10 in the presence of polybrene (8 µg/ml). For early-outgrowth EPCs, this was done 2 days after isolation, and for late-outgrowth EPCs, this was done 4 weeks after isolation. After 1 hour of centrifugation at 1,400g at 25¡ãC and 16 hours of culture at 37¡ãC in a CO2 incubator, medium was changed and cells were further cultured for up to 5 days, with medium changes every 2 days. Cells were washed, fixed in 2.5% paraformaldehyde containing 2% glucose in PBS, and analyzed by flow cytometry for EGFP expression.* c7 p- Q: r7 n
6 c4 M* v8 c$ V! @% X
To determine whether EGFP expression was maintained over time, late-outgrowth EPC blood was transduced with lentiviral vectors encoding EGFP under control of the CMV promoter. Four days after transduction, EGFP-positive cells were isolated on a FACStar instrument (Becton, Dickinson and Company). Cells were further cultured for 4 weeks in EGM-2 medium and then analyzed for EGFP expression on a FACScan instrument.
- v8 S! w6 Z, M3 x& F( Q9 e0 o1 @0 V/ p; A0 G9 u) r
Flow Cytometry Analysis and Immunofluorescence Staining
! R- x2 \" c- b" U/ ~* j5 N' C. m( Q. s' |2 J& S; M. O2 `
Antibodies Polyclonal rabbit anti-human von Willebrand factor (vWF) was from DakoCytomation (A0082; Glostrup, Denmark, http://www.dakocytomation.com). The following murine monoclonal antibodies were used: anti-CD31 (JC/70A) from DakoCytomation; anti¨CVE-cadherin (CD144; TEA1/31) from Beckman Coulter (Marseille, France, http://www.beckmancoulter.com); and anti-human CD45 (MEM-28) from Alexis Biochemicals (Lausen, Switzerland, http://www.alexis-corp.com). Isotype-matched control antibodies were from DakoCytomation. Goat anti-rabbit immunoglobulin G (IgG) conjugated with fluorescein isothiocyanate (FITC) and goat anti-mouse IgG conjugated with FITC, phycoerythrin, rhodamine, or Alexa 647 were from Sigma-Aldrich or Molecular Probes (Eugene, OR, http://probes.invitrogen.com).5 w( c: k! l: {
0 [/ O/ l/ }& M& d6 CFlow Cytometry Analysis Cells were washed in PBS, trypsinized, washed in PBS containing 5% fetal calf serum, and then incubated with primary antibodies (10 µg/ml in PBS-0.5% bovine serum albumin) for 1 hour, washed, and incubated with secondary antibodies for 30 minutes. All steps were performed at 4¡ãC. Cells were washed, fixed in 2.5% paraformaldehyde and 2% glucose in PBS, and analyzed on a FACScan instrument (Becton, Dickinson and Company) using CellQuest software (Becton, Dickinson and Company). Isotype-matched murine antibodies were used as negative controls.+ ~& v* \2 H. k4 b
Q7 v7 @; v! r& {, g( {
Indirect Immunofluorescence Staining Early- or late-outgrowth EPCs were grown on 0.1% type 1 collagen-coated glass coverslips and analyzed for the cellular location of vWF, as described previously . Mounted cover-slips were examined with an inverted Zeiss-Axiovert 100 fluorescence microscope (Carl Zeiss, Jena, Germany, http://www.zeiss.com). Pictures were acquired with a Hamamatsu C4742-95-10 digital charge¨Ccoupled device camera (Hamamatsu Photonics, Osaka, Japan, http://www.hamamatsu.com) and analyzed using Openlab software (Scientific Software, Pleasanton, CA, http://www.scisw.com).
; H1 v$ m% {: _+ T. h- |1 o1 W( M1 }* V5 H* ?# ~0 B: [1 b( f
Cellular Uptake of Acetylated Low-Density Lipoprotein Early- and late-outgrowth EPCs were incubated in EGM-2 medium containing 10 µg/ml 1,1'-dioctadecyl-3,3,3',3'-tetra-methyl-indocarbocyanine perchlorate¨Clabeled acetylated low-density lipoprotein (diI-Ac-LDL) (Molecular Probes, L3484) for 5 hours at 37¡ãC. After washing with PBS, these cells were viewed and photographed as described above.4 j: j0 G# x/ T: b5 | P, H+ R
& k4 [1 q1 l7 n& y+ j8 y; a, b' u
Quantitative Polymerase Chain Reaction Analysis of Chromosomal Transgene Incorporation Mononuclear cells obtained from human peripheral blood were grown in medium containing endothelial growth supplements (EGM-2) or in DMEM with 10% fetal bovine serum. At day 3, the cells were transduced with lentiviral vectors encoding EGFP under control of the CMV promoter and further incubated in EGM-2 or DMEM, 10% fetal calf serum. Five days after transduction, the adherent cells were washed with PBS, trypsinized, and then collected for total genomic DNA extraction. Quantitative polymerase chain reaction (PCR) was performed using 2, 0.2, and 0.02 ng genomic DNA of each sample and primers for a segment of gag that is close to the 5' end of the integrated transgene (forward: GGAGCTAGAACGATTCGCAGTTA; reverse: GGTTGTAGCTGTCCCAGTATTTGTC). The beta-actin gene served as a control gene (forward: TCACCCACACTGTGCCCATCTACGA; reverse: CAGCGGAACCGCTCATTGCCAATGG).
' [, j y5 T! \. c( `( E
' I; s! ?; ^1 _In Vivo Matrigel Assay A total of 5 x 105 early-outgrowth EPCs, transduced with lentiviral vectors for EGFP expression, were collected in 100 µL of PBS, mixed with 500 µl of Matrigel (BD Biosciences), and injected subcutaneously into the back of female nude mice. After 7 days, the Matrigel plugs were collected and snap frozen in OCT compound (Sakura, Torrance, CA, http://www.sakura-americas.com). Ten-micrometer sections were cut from the frozen plugs, mounted on microscope slides, and fixed in 4% paraformaldehyde. The slides were photographed using fluorescence microscopy as described above.
6 l4 l1 ~: U& R4 [6 ?9 x2 W+ L
9 s, J* |: U* r6 ARESULTS6 G$ t1 i& e$ |* y4 c/ X
. s) a) j( Y8 }7 T+ F) cAnalysis of Early- and Late-Outgrowth Human Blood-Derived Endothelial Progenitor Cells
. u* t: w# h4 Q/ m
4 f4 r( w( s% J6 Y% eHuman blood mononuclear cells were cultured for 1 or 4 weeks on type 1 collagen-coated tissue culture plates in the presence of the endothelial cell growth supplement EGM-2. The early-outgrowth EPCs were much smaller than the late-outgrowth EPCs and had a rounded or spindle-shaped morphology, whereas the late-outgrowth EPCs exhibited a cobblestone morphology when confluent. Both cell types were positive for VE-cadherin, for vWF, and for diI-labeled acetylated LDL uptake (Fig. 1). All early-outgrowth EPCs were positive for CD31, as demonstrated by the complete shift of the symmetric peak obtained with the anti-CD31 antibodies compared with the isotype-matched control antibodies. The partial overlap of the symmetric CD31 and control peaks is comparable to that reported previously . Compared with early-outgrowth EPCs, the level of CD31 expression by late-outgrowth EPCs was at least one order of magnitude higher.4 @! b3 u" l+ W
: X$ ^: o M2 k
Figure 1. Isolation and characterization of human blood¨Cderived endothelial progenitor cells. Mononuclear cells were isolated from human peripheral blood, plated on a type 1 collagen-coated surface, and cultured in medium containing the endothelial growth supplement EGM-2 for 1 week (early-outgrowth EPC, left) or 4 weeks (late-outgrowth EPC, right) and analyzed by flow cytometry for expression of CD31 or VE-cadherin (filled histograms). The open histograms represent results with isotype-matched antibody controls. The cells analyzed are from the gated areas in the forward and side-scatter plots shown in the center of the figure. Small-size cell debris was gated out from the scatter plots. The presence of von Willebrand factor and cellular uptake of diI-labeled acetylated low-density lipoprotein was analyzed by fluorescence microscopy. Note the marked difference in cell size between the early- and late-outgrowth EPCs. Scale bar = 20 µm. Abbreviations: EPC, endothelial progenitor cell; vWF, von Willebrand factor.
3 v) g U" H0 `0 M3 a9 c
" q/ S( s+ o6 B# G0 e0 BEffect of Gene Promoter on EGFP Expression in Transduced HUVECs9 ^8 A, ]8 _' c9 `; h+ u3 u- Q' y2 d
, K# N* T8 Y M& Q. K; aTo determine relative promoter efficacies in endothelial cells, we first used mature HUVECs. EGFP expression was studied at different MOIs and times after transduction with lentiviral vectors for expression of EGFP under the control of the CMV promoter, the EF1 promoter, or the PGK promoter. We observed that EGFP expression was highest when under the control of the CMV promoter, intermediate with the EF1 promoter, and lowest with the PGK promoter. These relative promoter potencies were observed at all MOIs and time points studied (Fig. 2).
5 u" {# _. H( z) N$ U7 @% _
8 F f! h5 \' h( `( g% l8 c& |Figure 2. Effect of gene promoter on EGFP expression in HUVECs after lentiviral vector¨Cmediated gene transfer. A total of 105 HUVECs were transduced with lentiviral vectors carrying the EGFP gene under the control of CMV promoter (diamonds), EF1 promoter (squares), or PGK promoter (triangles). After washing, cells were cultured in fresh medium and analyzed by flow cytometry for EGFP expression. The results are represented as mean fluorescence intensity (mean ¡À standard error; n = 4 experiments). Left: effect of MOI on level of EGFP expression. After transduction, the cells were cultured for 72 hours before analysis of EGFP expression. Right: level of EGFP expression at various times after transduction. Cells were transduced at a MOI of 5, and EGFP expression was analyzed by flow cytometry 24, 48, and 72 hours after transduction. The significance of the differences between the data points of the three promoters was analyzed by one-way analysis of variance, and all differences had p values
w5 o, e! v9 D+ F a. H# {( w, L$ Y& e
Effect of Gene Promoter on EGFP Expression in Endothelial Progenitor Cells
6 u6 g% D2 O- H7 a |* G
; _5 ?5 f/ Z& C! U0 R% _Role of Transgene Promoter We investigated lentiviral vector¨Cmediated gene transfer in early- and late-outgrowth peripheral blood¨Cderived EPCs and compared promoter efficacies. The cells were transduced with lentiviral vectors for expression of EGFP driven by the CMV, EF1, or PGK promoters. Based on the results obtained for transduction of HUVECs, a MOI of 10 was chosen and EGFP expression was evaluated 72 hours after transduction. For both early-outgrowth EPCs (Fig. 3A) and late-outgrowth EPCs (Fig. 3B), expression of EGFP was highest when driven by the CMV promoter, whereas expression from the EF1 or PGK promoter was one and two orders of magnitude lower, respectively.
) c: y0 q* K! P% F
: P9 d# R% u2 c: [# sFigure 3. Effect of gene promoter on EGFP expression in EPCs after lentiviral vector¨Cmediated gene transfer. Mononuclear cells were isolated from blood and transduced with lentiviral vectors in which EGFP expression was under control of the PGK promoter, the EF1 promoter, or the CMV promoter. Transduced cells are represented by filled histograms, and control, nontransduced cells are represented by nonfilled histograms. (A): Transduction of early-outgrowth EPCs. Two days after isolation of blood mononuclear cells and growth in medium with the endothelial supplement EGM-2, the cells were transduced with lentiviral vectors at a MOI of 10. Thereafter, the cells were cultured for 1 week more in medium containing EGM-2. EGFP expression was analyzed by flow cytometry. The bottom right shows fluorescence of blood mononuclear cells cultivated in Dulbecco¡¯s modified Eagle¡¯s medium containing 10% fetal bovine serum, but no EGM-2, and transduced under the same conditions with the lentiviral vector for EGFP expression under control of the CMV promoter (CMV w/o EGM-2). (B): Transduction of late-outgrowth EPCs. Cells were obtained by 4 weeks of culture in EGM-2 medium and transduced with lentiviral vectors at a MOI of 10. Seventy-two hours later, EGFP expression was analyzed by flow cytometry. Note that both for early- and late-outgrowth EPCs, EGFP expression was highest when under control of the CMV promoter, intermediate with the EF1 promoter, and lowest with the PGK promoter. Abbreviations: CMV, cytomegalovirus; EGFP, enhanced green fluorescent protein; EPC, endothelial progenitor cell; MOI, multiplicity of infection; PGK, phosphoglycerate kinase.9 C% C; }' n/ b
7 G+ d0 @5 N' w+ `. _Effect of Endothelial Growth Supplement on EGFP Expression Under Control of the CMV Promoter
~' I1 n( X/ \
4 I8 a- O! q2 S0 z4 z+ GWe investigated to what extent incubation in EGM-2 had an effect on EGFP expression driven by the CMV promoter. Peripheral blood¨Cderived mononuclear cells were cultured on type 1 collagen in DMEM containing 10% fetal calf serum but without EGM-2. Two days after isolation from blood, the cells were transduced with a lentiviral vector for EGFP expression driven by the CMV promoter. Three days later, the level of EGFP was 100-fold less than that in early-outgrowth EPCs grown in parallel in EGM-2¨Ccontaining medium (Fig. 3A). Two possible explanations can be put forward to explain the low EGFP expression by cells cultured without EGM-2: a low promoter efficacy or a resistance to transduction. To discriminate between these two possibilities, we analyzed the amount of transgene DNA incorporated into the chromosomes of blood mononuclear cells grown with or without EGM-2. Quantitative real-time PCR was used to quantify DNA corresponding to a gag fragment situated at the 5' end of the transgene, whereas actin DNA was used as control. We observed 129 incorporated transgene copies in cells grown with EGM-2 and 74 copies in cells grown without EGM-2. The 1.7-fold higher incorporation in the cells grown with EGM-2 does not explain the 100-fold higher level of EGFP expression.
) `8 u$ ~9 L2 J. S
4 ^1 A! N& Z2 X# aStability of EGFP Expression in Late-Outgrowth EPCs
0 M4 u( e" I# \$ J3 i
) l w! i9 P( T( CTo determine to what extent EGFP expression was stable, we transduced late-outgrowth EPCs with a lentiviral vector for expression of EGFP under control of the CMV promoter. EGFP-positive cells were isolated by flow cytometry cell sorting, and EGFP expression was analyzed 4 weeks later. At this time point, greater than 90% of the cells were still positive (Fig. 4).# V8 A1 H2 f9 X# q) o2 p+ d$ Z- g
4 J, J& T- P, d2 F3 L9 g# j
Figure 4. Maintenance of EGFP expression in transduced late-outgrowth endothelial progenitor cells. Cells were obtained by 4 weeks of culture in EGM-2 medium and then transduced with lentiviral vectors at a multiplicity of infection of 10. Four weeks later, EGFP expression was analyzed by flow cytometry. Transduced cells are represented by dark histograms, and control, non-transduced cells are represented by white histograms. Abbreviation: EGFP, enhanced green fluorescent protein.! w9 f5 c# T% L( `4 ^( V
' z2 V6 F/ @5 h" R
EGFP Expression and CD45
2 v: q7 t0 {) \8 R1 x* A1 M4 Q5 Y8 |1 ]5 {: b: e' O$ u6 g
Early-outgrowth EPCs have been reported to express the leukocyte marker protein CD45 . Because not all early-outgrowth EPCs expressed high levels of EGFP, we considered whether there was a relation between CD45 expression and high EGFP expression from the CMV promoter. To study this we transduced blood mononuclear cells with a lentiviral vector for EGFP expression under control of the CMV promoter. Half of the transduced cells were cultured in EGM-2 medium, and the other half were transduced in DMEM medium containing 10% fetal bovine serum. After 1 week in culture, we determined by flow cytometry the level of EGFP expression in these cells and CD45 expression at their surface. We observed that the cells cultured in the presence of EGM-2 were positive for EGFP and expressed CD45 (Fig. 5, left). The level of CD45 in these cells was comparable to that in cells cultured in the absence of EGM-2, which expressed 10-fold lower levels of EGFP (Fig. 5, right).
9 [- y4 X( [& A( ^6 i7 @- U0 Y. e* B, T
Figure 5. Expression of CD45 and EGFP by transduced early-outgrowth endothelial progenitor cells. Mononuclear cells were isolated from human blood and transduced with a lentiviral vector for EGFP expression under control of the cytomegalovirus promoter. Half of the cells were cultured in medium containing EGM-2 (left); the other half were cultured in Dulbecco¡¯s modified Eagle¡¯s medium containing 10% fetal calf serum (right). After 1 week in culture, cells were analyzed by flow cytometry for EGFP expression and CD45 expression. Abbreviation: EGFP, enhanced green fluorescent protein.6 y! A4 ^, \, A/ U0 W
( r7 L3 p* m% d4 HPromoter Efficacies in EPCs In Vivo
" z$ W4 c" O# K' B. X' \! a( [, F! ?" g0 Q* n( }$ B! X
To determine whether the relative promoter efficacies observed in vitro were maintained in vivo, we transduced early-outgrowth EPCs with lentiviral vectors for expression of EGFP under control of the CMV, EF1, or PGK promoter. The transduced cells were injected subcutaneously in a Matrigel plug in the back of female nude mice. One week later, the plugs were recovered and EGFP-related fluorescence was analyzed on 10-µm tissue slices. Highest levels of EGFP expression were observed when under control of the CMV promoter, intermediate levels were observed with EF1 promoter, and low levels were observed with the PGK promoter (Fig. 6).# I: S4 I0 m0 @+ L4 u2 B
f' F! @! _& d( D) uFigure 6. Effect of gene promoter on EGFP expression in early-outgrowth endothelial progenitor cells in vivo. Mononuclear cells were isolated from human blood, transduced at day 2 with a lenti-viral vector for EGFP expression, and cultured in the presence of EGM-2. After 1 week, the transduced cells were mixed with Matrigel and injected subcutaneously in nude mice. After 7 days, the Matrigel plug was retrieved, frozen, sectioned, and mounted on microscope slides. These were photographed using a fluorescent microscope. The figure shows EGFP expression under control of the cytomegalovirus promoter (top), the EF1 promoter (center), or the phosphoglycerate kinase promoter (bottom). White bar = 100 µm.
; w; W9 D3 A9 `+ ^2 ^* M% Y( m: A, I5 B* Y. c& J
DISCUSSION
1 A! Y3 g) U7 X3 R8 ^
' t0 H8 Y* M' Z" Q/ @; v) yEndothelial progenitor cells, preferably of autologous origin, have considerable potential for the treatment of vascular disorders and have been isolated from adult blood, cord blood, and bone marrow. Of these, adult peripheral blood is the most accessible source of EPCs for autologous therapy. By appropriate gene transfer into EPCs, it may be possible to change the behavior of the endothelium in which these cells are incorporated or to directly secrete proteins of therapeutic interest into the blood circulation. For our studies, we used two different types of EPCs. The characteristics of the cells obtained after 1 week in culture (early-outgrowth EPCs) were comparable to those previously described by Dimmeler et al. . Both early- and late-outgrowth EPCs were positive for CD31, VE-Cadherin, vWF, and uptake of diI-labeled Ac-LDL. However, expression of CD31 by early-outgrowth EPCs was one order of magnitude lower than that of late-outgrowth EPCs. Furthermore, early-outgrowth EPCs exhibited a spindle-shaped or rounded morphology and were much smaller than late-outgrowth EPCs, which exhibited a cobblestone morphology when confluent. Taken together, our data imply that early- and late-outgrowth EPCs correspond to distinct cell types.2 |6 C2 B2 a* ]$ ^7 }& \3 P
6 f, ?) G% @4 }7 TWe investigated the potential of lentiviral vectors for stable gene transfer in early- and late-outgrowth EPCs. In recent years, lentivirus-mediated gene transfer was shown to be an efficient method to stably introduce genetic modifications in target cells, even if these are in a nonproliferative state . Here we show that lentivirus-mediated gene transfer allows efficient and stable transgene expression in peripheral blood¨Cderived EPCs and that transgene expression levels can be varied over two orders of magnitude by using different well-characterized gene promoters. These differences in promoter efficacies were observed both for early- and late-outgrowth EPCs. Highest expression of EGFP was observed with the CMV promoter, intermediate expression was observed with the EF1 promoter, whereas expression observed with the PGK promoter was very weak. The clear shift in the symmetric fluorescence intensity peak of PGK-EGFP¨Ctransduced cells, compared with nontransduced cells, implies that all cells had been transduced and that the weak EGFP expression was due to an intrinsic low activity of the PGK promoter in these cells. The ability to adjust transgene expression to desired levels is important because, depending on the protein to be expressed, optimal therapeutic effects may not coincide with the highest level of transgene expression.
( ]/ h' X2 o) f T
$ ^+ Y/ `$ q& | r9 {6 NTo determine to what extent the endothelial growth supplement EGM-2 favored the outgrowth of cells characterized by a high EGFP expression from the CMV promoter, we also cultured blood mononuclear cells on type 1 collagen in medium without EGM-2 and transduced these cells with a lentiviral vector for EGFP expression under the control of the CMV promoter. The adherent cells that were retained by this procedure only expressed low EGFP levels. The low expression could not be explained by a resistance of these cells to transduction because levels of DNA incorporation were 1.7-fold lower whereas the level of EFGP expression was one hundred-fold lower. The use of the CMV promoter, which is also the strongest promoter of the three tested, is therefore attractive in situations where a high level of transgene expression is to be obtained selectively in EPCs and not in the small number of leukocytes that may contaminate the EPCs isolated from blood mononuclear cells. The weak activity of the CMV promoter in mononuclear cells cultured on type 1 collagen in the absence of endothelial growth supplements extends the results of Salmon et al. , who observed that the CMV promoter has low activity in CD34 hematopoietic progenitor cells and some derived hematopoietic lineages. In the latter study, the low activity from the CMV promoter could not be explained by a low frequency of cell transduction.
$ T5 ~* y4 R4 Z0 {+ F/ U- B* b9 E4 i! C1 F3 q5 `
The use of the promoters described here is appropriate for conditions where EPCs are isolated from peripheral blood or bone marrow, transduced ex vivo, and then reintroduced into ischemic tissues or used to seed vascular grafts. In contrast, because the CMV promoter is active in many nonleukocyte cell types, endothelial cell¨Cspecific promoters, such as the tie2 promoter enhancer , seem to be more appropriate when the endothelium is to be modified by direct injection of lentiviral vectors into the vascular system.3 Y9 F& q" y! q- {
+ J; v" Q. w; m% `+ w, CIn our report, we investigated two different EPCs, early outgrowth and late outgrowth. These two types of EPCs express similar endothelial marker proteins but most likely represent two distinct cell types of different origins . We observed that culturing blood mononuclear cells for 1 week in the presence of EGM-2 made the cells responsive to the CMV promoter but did not lead to the loss of CD45. From these results we may conclude that treatment of blood mononuclear cells with endothelial growth supplements favors a differentiation (and possibly selective outgrowth) of progenitors toward an angiogenic phenotype.
/ f$ W% h# w1 K6 P% k. P7 w3 F( _& R) ~
For autologous treatment, early-outgrowth EPCs are very interesting because relatively large amounts of these cells can be obtained after a short period of in vitro cell culture. By introducing stable genetic modifications in these cells, their therapeutic potential may be further increased. In contrast, the therapeutic potential of late-outgrowth EPCs seems to be limited at present. First, it takes at least 1 month to obtain limited amounts of late-outgrowth EPCs, which may be too long to be clinically relevant. Second, the amount of circulating precursors of late-outgrowth EPCs, as well as their proliferative capacity, seems to be low in adults in whom therapy with EPCs is most likely to be used .
" ~8 b) g9 k8 f8 m' d1 U+ Y& V& G: ^6 ?: ]! s+ ]0 {
In conclusion, lentiviral vector¨Cmediated gene transfer is an appropriate technology for overexpression of transgenes in early- or late-outgrowth EPCs or mature ECs. Our results suggest that transgene expression levels can be titered by using different promoters.% h$ }& h, g% |1 u% E- n
5 z2 m# X2 Y8 qACKNOWLEDGMENTS4 W* J+ A: d7 X
8 b) `1 m; S* U
This work was supported by grants from the Swiss National Science Foundation (32.061510 and 3100-68322), Oncosuisse (KFS1059¨C09-2000), the Swiss Cardiology Foundation, l¡¯Association pour la Recherche contre le Cancer (France), and GEFLUC (Is¨¨re, France)., r% V N$ N/ i4 ^. x# \2 g
( e$ M0 J: r9 y. S# H6 {
DISCLOSURES
) Q a9 K) X' {' p2 ]0 H. l' \- c$ E" u, a5 G
The authors indicate no potential conflicts of interest.& g; r( ~& `4 P3 e
【参考文献】0 ^ @$ R! `3 ]
' P. R1 G' Y; d' v& ?
( q3 e$ [- N# Z9 o7 l: QRafii S, Lyden D. Therapeutic stem and progenitor cell transplantation for organ vascularization and regeneration. Nat Med 2003;9:702¨C712.1 s) Y* S, P0 r% V" ]& _/ e0 s
3 T4 E6 r# |+ q6 M1 H& }Urbich C, Dimmeler S. Endothelial progenitor cells: characterization and role in vascular biology. Circ Res 2004;95:343¨C353.+ a$ [( _, K" x
) A0 R% ?0 F7 bRabelink TJ, de Boer HC, de Koning EJ et al. Endothelial progenitor cells: more than an inflammatory response? Arterioscler Thromb Vasc Biol 2004;24:834¨C838.* ?- o J }" H2 a
* J; ^0 e9 N, P* ? C7 P1 V; h WRehman J, Li J, Orschell CM et al. Peripheral blood "endothelial progenitor cells" are derived from monocyte/macrophages and secrete angiogenic growth factors. Circulation 2003;107:1164¨C1169./ `8 C1 |7 M& L) b, I; e" {) Q
w! Q& x7 y0 y8 O1 w- E/ D `6 `
Dimmeler S, Aicher A, Vasa M et al. HMG-CoA reductase inhibitors (statins) increase endothelial progenitor cells via the PI 3-kinase/Akt pathway. J Clin Invest 2001;108:391¨C397." _ L. B6 `6 h- u, A' n/ S# K6 C, |
E6 h* N7 p5 m0 b5 ALin Y, Weisdorf DJ, Solovey A et al. Origins of circulating endothelial cells and endothelial outgrowth from blood. J Clin Invest 2000:10:71¨C77.
" n2 H& E& d D* T- h$ [" r: @& n* T& n/ _
Ingram DA, Mead LE, Tanaka H et al. Identification of a novel hierarchy of endothelial progenitor cells using human peripheral and umbilical cord blood. Blood 2004;104:2752¨C2760.
" ]/ Y+ ?7 ?( q+ A5 v
" l+ i. P3 R( S" VKawamoto A, Tkebuchava T, Yamaguchi J et al. Intramyocardial transplantation of autologous endothelial progenitor cells for therapeutic neovascularization of myocardial ischemia. Circulation 2003;107:461¨C468.
1 O( }0 g9 e5 V8 ]& ^) u9 q$ \ y7 t6 I [& c+ T Q
Kaushal S, Amiel GE, Guleserian KJ et al. Functional small-diameter neovessels created using endothelial progenitor cells expanded ex vivo. Nat Med 2001;7:1035¨C1040.$ p7 N' h0 W8 M4 {6 O
& a' S; B. B2 q# m( i& \Griese DP, Ehsan A, Melo LG et al. Isolation and transplantation of autologous circulating endothelial cells into denuded vessels and prosthetic grafts: implications for cell-based vascular therapy. Circulation 2003;108:2710¨C2715.( x3 [0 F" v0 u& ^+ z4 L$ r
6 k# V% R9 l/ y5 o: {) v3 MReyes M, Dudek A, Jahagirdar B et al. Origin of endothelial progenitors in human postnatal bone marrow. J Clin Invest 2002;109:337¨C346.& o8 z: }$ V+ @5 ~
: v' h2 g+ z- A# G7 u
Lyden D, Hattori K, Dias S et al. Impaired recruitment of bone-marrow-derived endothelial and hematopoietic precursor cells blocks tumor angiogenesis and growth. Nat Med 2001;7:1194¨C1201.: O( y7 o$ e, P. |
" i) k" F, y. N9 k0 u$ J* T8 V( tWei J, Blum S, Unger M et al. Embryonic endothelial progenitor cells armed with a suicide gene target hypoxic lung metastases after intravenous delivery. Cancer Cell 2004;5:477¨C488., `% o7 E; j% c$ U
3 ~% G3 F4 Q/ G
Tateishi-Yuyama E, Matsubara H, Murohara T et al. Therapeutic angiogenesis for patients with limb ischaemia by autologous transplantation of bone-marrow cells: a pilot study and a randomised controlled trial. Lancet 2002;360:427¨C435.6 g2 q# B6 ]3 v; L. Y
2 Q% N* j* I# k/ L8 YSchächinger V, Assmus B, Britten MB et al. Transplantation of progenitor cells and regeneration enhancement in acute myocardial infarction: final one-year results of the TOPCARE-AMI trial. J Am Coll Cardiol 2004;44:1690¨C1699.$ u0 R4 _8 w3 t: H. A
8 p7 i& ]1 g! KOtt I, Keller U, Knoedler M et al. Endothelial-like cells expanded from CD34 blood cells improve left ventricular function after experimental myocardial infarction. FASEB J 2005;19:992¨C994./ f4 E: ~$ w" I; K+ _0 r5 J0 p
, A# s6 B, v X7 t
Iwaguro H, Yamaguchi J, Kalka C et al. Endothelial progenitor cell vascular endothelial growth factor gene transfer for vascular regeneration. Circulation 2002;105:732¨C738.
; P" Q3 f& G# F8 {4 |' d0 @
# H4 } h- J: kFerrari N, Glod J, Lee J et al. Bone marrow-derived, endothelial progenitor-like cells as angiogenesis-selective gene-targeting vectors. Gene Ther 2003;10:647¨C656.# W7 _, v6 x5 f- z" P: d ]
; p, M: U+ T" d9 T/ f0 ALin Y, Chang L, Solovey A et al. Use of blood outgrowth endothelial cells for gene therapy for hemophilia A. Blood 2002;99:457¨C462.
6 w$ n( A% V+ y: G
, Y7 m2 f9 ~' |8 N) _Herder C, Tonn T, Oostendorp R et al. Sustained expansion and trans-gene expression of coagulation factor VIII-transduced cord blood-derived endothelial progenitor cells. Arterioscler Thromb Vasc Biol 2003; 23:2266¨C2272.+ G l3 u8 ^" E/ X: j! C& C
' ?/ C) C+ |6 t2 ]2 r& @, n
Jaffe EA, Nachman RL, Becker CG et al. Culture of human endothelial cells derived from umbilical veins: identification by morphologic and immunologic criteria. J Clin Invest 1973;52:2745¨C2756.
4 a! q3 L4 Y; T; q2 k
8 ]' ^$ }/ _3 \3 S# J8 G; |Rosnoblet C, Vischer UM, Gerard RD et al. Storage of tissue-type plasminogen activator in Weibel-Palade bodies of human endothelial cells. Arterioscler Thromb Vasc Biol 1999;19:1796¨C1803.1 s: P2 X+ Z# w4 W! E5 g
0 c% M) u" p1 ]1 Z! [" z8 W/ LSalmon P, Kindler V, Ducrey O et al. High-level transgene expression in human hematopoietic progenitors and differentiated blood lineages after transduction with improved lentiviral vectors. Blood 2000;96: 3392¨C3398.
6 [* Z/ G* ] v/ R# z ?9 [, g% [
6 ^ D3 W3 }- A7 hNaldini L, Blomer U, Gallay P et al. In vivo gene delivery and stable transduction of nondividing cells by a lentiviral vector. Science 1996; 272:263¨C267.
% I% V# G$ O2 C) h4 ]7 Y& G, l$ W6 h; o* V1 V5 S- c# d
Pernod G, Fish R, Liu JW et al. Increasing lentiviral vector titer using inhibitors of protein kinase R. Biotechniques 2004;36:576¨C580.
# Y ~0 E3 U$ ^/ b8 S0 W5 I
* u8 `/ D. M1 Q$ }. ~Eggermann J, Kliche S, Jarmy G et al. Endothelial progenitor cell culture and differentiation in vitro: a methodological comparison using human umbilical cord blood. Cardiovasc Res 2003;58:478¨C486.# n) b( ?( D" }$ P0 W% M
' g$ S, A3 i! @: f: BTrono D. Lentiviral vectors: turning a deadly foe into a therapeutic agent. Gene Ther 2000;7:20¨C23., q& V, F3 Q' I y6 a2 j* K( F
6 k+ Y- f0 w& Q/ S, n
Kootstra NA, Verma IM. Gene therapy with viral vectors. Annu Rev Pharmacol Toxicol 2003;43:413¨C439.0 H1 v1 ]2 e' ?1 F4 }- {- f
2 a: U% P2 ~" R: L
De Palma M, Venneri MA, Naldini L. In vivo targeting of tumor endothelial cells by systemic delivery of lentiviral vectors. Hum Gene Ther 2003;14:1193¨C1206.: R$ W# a7 y% c7 S e |3 M- Z
- V( A* @1 f1 g3 b+ b3 F! R2 o# FGulati R, Jevremovic D, Peterson TE et al. Diverse origin and function of cells with endothelial phenotype obtained from adult human blood. Circ Res 2003;93:1023¨C1025.5 b3 p' n7 j& Z6 x
6 [# l' [* z7 tUrbich C, Heeschen C, Aicher A et al. Relevance of monocytic features for neovascularization capacity of circulating endothelial progenitor cells. Circulation 2003;108:2511¨C2516.$ A) o) v E- Y
0 z: C! K9 z- ]+ X% {4 m2 |Badorff C, Brandes RP, Popp R et al. Transdifferentiation of blood-derived human adult endothelial progenitor cells into functionally active cardiomyocytes. Circulation 2003;107:1024¨C1032. |
|