|
  
- 积分
- 0
- 威望
- 0
- 包包
- 483
|

作者:Jeong Tae Doa, Dong Wook Hana,b, Luca Gentilea, Ingeborg Sobek-Klockea, Martin Stehlinga, Hoon Taek Leeb, Hans R. Schlera作者单位:aDepartment of Cell and Developmental Biology, Max Planck Institute for Molecular Biomedicine, Mnster, Germany;bDepartment of Bioscience and Biotechnology, Bio-Organ Research Center, Konkuk University, Gwangjin-Gu, Seoul, South Korea
* ?4 m! P& u* Q% g
/ K, @8 t- T! p
3 B$ \* V$ M( q5 ~1 E* }) x4 M) n- C
9 X+ x" K, E$ W8 D" W I ' H$ l( C p' k: P. E, l- H' |
+ n$ z% b7 b5 i& {1 ^/ [; {% z
/ K+ M/ K9 u4 W8 Q4 N
6 B; x' I8 T$ O+ C1 m
8 w6 F" ?) E: Q/ B; J
, o& g) B9 b [1 k% y: |! p
# D. W0 o- i }5 H2 U
& \& Q5 m! q0 }7 N& g" K% _+ V
: t) I/ w3 d6 D' ]: X: L' {+ \ 【摘要】8 q2 y: g6 A" v8 }; x. E7 e
Pluripotent cells have been suggested as a prime source to reprogram somatic cells. We used F9 EC cells as a pluripotent partner to reprogram neurosphere cells (NSCs) because they exhibit a nonneural differentiation potential in the presence of retinoic acid. F9-NSC hybrid cells displayed various features of reprogramming, such as reactivation of pluripotency genes, inactivation of tissue-specific genes, and reactivation of the inactive X chromosome. As the hybrid cells undergo differentiation, the pluripotency markers Oct4 and Nanog were downregulated. Whereas neural marker genes were not upregulated, endodermal and mesodermal markers were, suggesting that NSCs lose memory of their neural origin and preferentially differentiate to the lineages corresponding to the F9 program. After fusion, the methylation status in the Xist region was similar to that of F9 EC cells. However, upon differentiation, the Xist region failed to resume the methylation patterns of differentiated cells, suggesting that the Xist in F9-NSC hybrids does not easily acquire a differentiated state.
) U& Y4 K- _8 x1 j p
( Y5 A% b' ~ M( oDisclosure of potential conflicts of interest is found at the end of this article.
. e8 B# H, X3 Y( @) @ 【关键词】 Differentiation F EC cells Fusion Oct Xist Reprogramming
# F( {& ~! U( Z* s INTRODUCTION6 x9 O' ?( H4 F( g! x- Q
8 i7 z( ~% v$ F5 a' c d3 z5 WEmbryonic stem (ES), embryonic germ, and embryonic carcinoma (EC) cells are pluripotent cell types that can contribute to most cell types of an organism. Pluripotent cells display, by definition, a range of typical features, such as prolonged self-renewal ability, expression of pluripotency markers, potential to contribute to all three germ layers, and a specific epigenetic status .# g" n: d; A$ W0 ]2 G1 S! p! Y
* u* v8 `( y3 J3 _
Pluripotent cells are able to differentiate into all three germ layers and germ cells upon differentiation. ES-somatic hybrid cells also differentiate into derivatives of the three germ layers . Therefore, we considered F9-NSC hybrid cells a suitable model to investigate whether neural cells keep some memory after fusion with F9 EC cells or whether the pluripotent F9 EC cells solely dictate the NSCs' differentiation potential. We found that F9 EC cells not only can reprogram NSCs but that the epigenetic memory of the NSCs indeed has been lost, as determined by the differentiation potential and the change in gene expression and methylation status of the F9-NSC hybrid cells during redifferentiation.- n; n6 [: A2 U y3 I S
% y9 p& g/ v c- l1 Q* ?6 h c& {MATERIALS AND METHODS- y7 R x" ~ K2 R: m$ g
# n2 X+ X4 O; M* J' B: R; NEC Cell Culture. u8 p+ l; H$ X7 x& q
3 z( m2 h$ q( h7 l l7 J7 ]$ MF9 and P19 EC cell lines (passages 45 to 50) were grown on gelatin-coated (0.1% in phosphate-buffered saline ) dishes in standard EC cell media, high-glucose Dulbecco's modified Eagle's medium (DMEM) (Gibco-BRL, Gaithersburg, MD, http://www.gibcobrl.com) containing 15% fetal calf serum (FCS; Gibco BRL), 1x penicillin/streptomycin/glutamine, and 1x nonessential amino acids (Gibco BRL).4 W7 X+ m, q( y; l! j/ X& U5 f9 G
6 v9 j' W7 x, h, zNSC Culture$ x/ m! |8 L/ D; X
$ K K" z. N5 l# d6 d9 ]To derive NSCs, brain tissue was collected from 12.5- to 16.5-days postcoitum (dpc) fetuses, which were ROSA26/OG2 heterozygous double transgenic. The ovaries (female) and testes (male) can be distinguished by their morphology from 12.5 dpc. Female NSCs were obtained from the female fetuses that have ovaries. Neurospheres cultured from brain tissue were prepared as described in detail in our previous article . In brief, the cortex was dissected, enzymatically dissociated, and passed through a 70-µm nylon mesh (Falcon; Becton, Dickinson and Company, Franklin Lakes, NJ, http://www.bd.com). The NSCs were further purified by centrifugation in 0.9 M sucrose in 0.5x Earle's balanced salt solution (EBSS) at 750g for 10 minutes and in 4% bovine serum albumin (BSA) in EBSS solution at 200g for 7 minutes. The standard NSC culture medium was supplemented with 20 ng/ml epidermal growth factor (Gibco BRL), 20 ng/ml basic fibroblast growth factor, B27 supplement (Gibco BRL), 8 mM HEPES, 2 mM glutamine, 100 U/ml penicillin, and 100 mg/ml streptomycin in DMEM-F12 medium (Gibco BRL). Primary neurospheres were cultured for 6¨C7 days at 37¡ãC under 5% CO2 in air and then used for fusion experiments. Animal experiments were approved and performed according to the Animal Protection Guidelines of the Government of Max Planck Society, M¨¹nster, Germany.+ ^3 {( y& S; E5 A- |6 [
9 \; g2 s, u, M, B3 x1 wCell Fusion and Subsequent Culture7 p& e, J8 n0 s& }( y" b
: x" t; l8 _& F8 mF9 EC cells were mixed with NSCs in a ratio of 1:1 and washed in PBS. The mixture was centrifuged in 50-ml conical tubes at 130g for 5 minutes. After removal of the supernatant, 1 ml of a prewarmed 50% polyethylene glycol (PEG1500; Roche Diagnostics, Basel, Switzerland, http://www.roche-applied-science.com) was added to the cell pellet drop by drop. DMEM was added up to 25 ml over the 5 minutes, with constant stirring. The cells were centrifuged at 130g for 10 minutes, washed gently with DMEM, and seeded onto gelatin-coated dish in ES culture medium containing leukemia inhibitory factor (LIF).
( s5 r% U3 q. {' z' L$ D% M' G, S! G9 d' p( m
Karyotype Analysis7 \, A4 C( t6 j3 A
$ [% q4 r P. G7 h8 F4 z" B
Cells cultured in a 10-cm culture dish were treated with 3 µg/ml Nocodazole for 4 hours, followed by trypsinization using 0.25% trypsin/EDTA. The cells were recovered and treated with hypotonic (0.56% ) KCl solution for 15 minutes. The cells were collected by centrifugation and fixed with fresh fixative (methanol/acetic acid, 3:1). The cells were washed three times in fixative and dropped onto clean glass slides. The slides were air-dried, stained with 4,6-diamidino-2-phenylindole (Sigma-Aldrich, St. Louis, http://www.sigmaaldrich.com), and observed under a fluorescence microscope.
: o" E5 a; h, E% {9 |
- }" j' u6 A7 [& AX-Gal Staining& W8 t/ n0 W |, b
0 p( c' g4 o# y( oWhole fetal embryos were washed with PBS and fixed for 1 hour at 4¡ãC in 4% formaldehyde. They were then washed three times with PBS and LacZ rinse buffer supplemented with 5 mM EGTA, 0.01% deoxycholate, 0.02% Nonidet P40, and 2 mM MgCl2. The fetuses were incubated overnight at 37¡ãC in 5-bromo-4-chloro-3-indolyl-galactosidase (X-gal) staining buffer supplemented with 1 mg/ml X-gal (Sigma-Aldrich), 5 mM K2Fe(CN)6, 5 mM K4Fe(CN)6, and 1 mM MgCl2. Blue staining is visible under a light microscopy.
8 I& O5 ?6 Y) D1 Q, v( c3 [
( J/ R; W1 d$ C1 m& S7 t( ]( j# GFlow Cytometry0 O* \8 p* H( y9 r; q. c1 {1 W1 D
7 o2 j; e0 R2 A0 }- c
Dissociated hybrid cells were washed with PBS, filtered through a 40-µm nylon mesh, and resuspended in standard EC cell medium. Highly intense green fluorescent protein (GFP)-positive cells were sorted directly into lysis buffer RLT (Qiagen GmbH, Hilden, Germany, http://www.qiagen.com) using a FACSAria cell sorter (Becton, Dickinson and Company) with FACSDiva software (Becton, Dickinson and Company)." S! b+ n; e5 o, a4 d
/ f& g# `1 B1 S
In Vitro Differentiation of F9-NSC Hybrid Cells5 l& I. o/ T; f% \8 a
( U+ J6 M) t: p" N# R
Differentiation of F9-NSC hybrid cells was induced by treatment with RA. The GFP-positive hybrid cells recovered by trypsinization were replated onto bacteriological dishes in DMEM (15% FCS) in the absence of LIF for 4 days. After the formation of EBs, they were treated with 5 µM RA for 4 days in bacteriological dishes and seeded onto gelatin-coated culture dishes for 5 days. GFP-negative cells were sorted by fluorescence-activated cell sorting (FACS) directly into buffer RLT (Qiagen GmbH) and analyzed for real-time reverse transcription-polymerase chain reaction (RT-PCR) and bisulfite DNA sequencing.
5 U: Z% b+ @% D; z" d/ L5 C4 z6 @
1 I) H) \1 ^; n. o+ P8 EBlastocyst Injection0 P" X; u5 _+ e& M* L" h! a
' K( E3 q) {9 V/ S; A
Blastocysts were obtained from B6C3F1 x B6C3F1 nontransgenic mice (Harlan Winkelmann GmbH, Borchen, Germany, http://www.harlan.com/). F9-NSC hybrid cells were recovered by trypsinization, washing with PBS, and placed in a drop of PBS (0.4% BSA) under mineral oil. The B6C3F1 blastocysts were placed in an adjacent drop of PBS (0.4% BSA). GFP-positive cells (10 to 15 cells) were picked up with the injection pipette and injected into a blastocyst. Ten to 15 injected blastocysts were transferred into the uterus of each pseudopregnant ICR mouse.
0 l- ]4 q1 I- J1 E$ Q+ h
3 H) u, K* r2 o( ? E6 dRNA Extraction, cDNA Synthesis, and Real-Time RT-PCR
; `' b' M2 }/ n- X! Z! A
/ @' P% P' ^9 ^; [0 ZFor real-time quantification of the gene expression, GFP-positive cells were sorted by FACS directly into buffer RLT (Qiagen GmbH), and the RNA was extracted on RNeasy microcolumns (Qiagen GmbH), according to the manufacturer's instructions. The quality and concentration of the total RNA were determined with the Bioanalyzer RNA 6000 (Agilent Technologies, Palo Alto, CA, http://www.agilent.com), using a nano or pico chip according to the number of sorted cells. Complementary DNA synthesis was performed with the High Capacity cDNA Archive Kit (Applied Biosystems GmbH, Darmstadt, Germany, http://www.appliedbiosystems.com/) following the manufacturer's instructions, scaling down the reaction volume to 20 µl. Transcript levels were determined using the ABI PRISM Sequence Detection System 7900HT (Applied Biosystems) and the ready-to-use 5' Nuclease Assays-on-Demand.
& t* w5 X! O/ @
' {! v1 n7 z; }4 |The raw quantification data of the transcripts were normalized on the endogenous Bact gene within the log-linear phase of the amplification curve (Ct method, ABI PRISM 7700 Sequence Detection System User Bulletin 2; Applied Biosystems). The theoretical background of real-time polymerase chain reaction (PCR) is extensively described in our previous article .
! Q6 ] h( V. ~+ t$ w# L ]% V
3 d% s" C& T0 A* O; k7 A- D1 COligos for the following genes were designed by the Taqman Assay-on-Demand service: Oct4 (Mm00658129_gH), Sox2 (Mm00488369_s1), Sox1 (Mm00486299_s1), Nestin (Mm00450205_m1), Glur6 (Mm00599860_m1), Olig2 (Mm01210556_m1), Xist (Mm01232884_m1), Hprt (Mm00446968_m1), Gata1 (Mm00484678_m1), Esx1 (Mm00468385_m1), Ard1 (Mm00502342_m1), Hdac6 (Mm00515945_m1), Figf (Mm00438965_m1), Gspt2 (Mm00492464_s1), Fshprh (Mm00521454_m1), Afp (Mm000431715_m1), Hnf4a (Mm00433964_m1), Tbx1 (00448948_m1), Otx2 (00446859_m1), Meox1 (00440285_m1), and Bact (Mm00607939_s1). Oligos for Nanog amplification were custom designed (primer forward: 5'AACCAGTGGTTGAATACTAGCAATG, primer reverse: 5'-CTGCAATGGATGCTGGGATACT, probe: 5'-6FAM-TTCAGAAGGGCTCAGCAC-MGB).- F+ o9 U4 H, b- ]+ R7 ^$ v2 Q
1 X' i, n- c A" dThree replicates were used for each real-time PCR; an RT¨C blank and a no-template blank served as negative controls, together with H2O eluted from the micro RNeasy column. The analysis using the Taqman software automatically sets a confidence level of 95%, indicating that differences among the values are always significant with a p
, M( ? o! b7 Y3 ~" K0 F x6 D: m w
$ S% |& \" }, y2 R$ R A4 YBisulfite Sequencing Analysis- u+ [* d- w) l& x
' t( C+ f6 J) D* Z+ \, w
To investigate the methylation status of target genes, bisulfite sequencing PCR (BS-PCR) was adopted. Genomic DNA isolated by phenol-chloroform method was treated with sodium bisulfite to convert all unmethylated cytosines to uracil using the One Day MSP kit (In2Gen, Seoul, Korea, http://www.in2gen.com/English/) according to manufacturer's protocol. In brief, 1 µg of purified genomic DNA was denatured with 3 N sodium hydroxide at 37¡ãC for 10 minutes, and modification was induced with sodium bisulfite (5 M) at 50¡ãC for 16 hours in the dark. Modified DNA was then diluted with 20 µl of distilled water after desulfonation, neutralization, and desalting. Subsequently, BS-PCR amplification was carried out using 1-µl aliquots of modified DNA for each PCR. In the present study, the regulatory regions of the Oct4 (proximal enhancer , 45¡ãC); Oct4 Pro second sense 5'-TGAGGAGTGGTTTTAGAAATAATTG-3', Oct4 Pro second antisense 5'-AATCCTCTCACCCCTACCTTAAAT-3' (190 bp, 55¡ãC); Oct4 PE first sense 5'-GGTTTTTTGAGGTTGTGTGATTTAT-3', Oct4 PE first antisense 5'-CTCCCCTAAAAACAACTTCCTACTC-3' (423 bp, 45¡ãC); Oct4 PE second sense 5'-GGGATTTTTAGATTGGGTTTAGAAAA-3', Oct4 PE second antisense 5'-CTCCTCAAAAACAAAACCTCAAATA-3' (200 bp, 55¡ãC); Xist first sense 5'-GTTAATTAATGTAGAAGAATTTTTAGTGTTTA-3', Xist first antisense 5'-AAATATTCCCCCAAAACTCCTTAAATAA-3' (458 bp, 50¡ãC); and Xist second sense 5'-TGTAATTTTTGTGGTTATTTTTTTT-3', Xist second antisense 5'-ATATTCCCCCAAAACTCCTTAAATA-3' (159 bp, 55¡ãC). Each 3 µl of the first PCR products were used as the template for the second PCR. The second PCR products were subcloned using PCR 2.1-TOPO vector (Invitrogen, Carlsbad, CA, http://www.invitrogen.com) according to the manufacturer's protocol. The reconstructed plasmids were purified with QIAprep Spin Miniprep kit (Qiagen GmbH), and then individual clones were sequenced (GATC Biotech, Konstanz, Germany, http://www.gatc-biotech.com/en/). Clones were only accepted with A90% cytosine conversion, and all possible clonalities were excluded based on criteria from the BiQ Analyzer software (Max Planck Society). At least 10 replicates were performed for each of the selected regions in fusion hybrids, and more than three separate bisulfite treatments were carried out for the samples shown to verify the results.: E" I' U. t( x4 j0 P
5 J, c; s- P7 E% f: [RESULTS
7 w p% ]* I, r. } N6 U( V+ O+ I. h. t `! z! {
Activation and Reinactivation of Oct4-GFP of NSCs After Fusion and Redifferentiation
2 E o8 z7 O1 |, I: F& c! V
& c; U3 \1 ]0 O( n. ^5 v. RNSCs were prepared from OG2 /¨C/ROSA26 /¨C double transgenic female embryos carrying a GFP transgene under the control of the Oct4 promoter and a ubiquitously expressing neo/lacZ transgene. NSCs were fused with F9 EC cells using polyethylene glycol. First, GFP-positive cells were detected at day 2 postfusion. The G-418-resistant cells (Fig. 1A) were GFP-positive (Fig. 1B), X-gal-positive (Fig. 1C), and tetraploid (Fig. 1D), indicating that the cells are hybrids of F9 EC cells and NSCs. More than 95% of the hybrid cells contained 72 to 79 chromosomes, and less than 5% of the hybrid cells contained 80 chromosomes. The hybrid cells could form embryoid bodies (Fig. 1E). GFP-positive hybrid cells lost GFP signal during RA-induced differentiation (Fig. 1F). These GFP-negative cells were FACS-sorted to obtain a pure population of redifferentiated hybrid cells for real-time RT-PCR and bisulfite sequencing (Fig. 2). y! } B) p4 Q1 N" C% \0 D* K
/ M" f: O( o# k2 q+ T3 Q' k- R& `$ qFigure 1. Reprogramming of neurosphere cells after fusion with F9 EC cells and their redifferentiation. The successful reprogramming by fusion was confirmed by phase-contrast (A), green fluorescence (B), and 5-bromo-4-chloro-3-indolyl-galactosidase staining (C) images. (D): Representative tetraploid karyotype of the hybrid cells. The fusion hybrid cells can form embryoid bodies (E) and lose Oct4-green fluorescent protein signal when they are cultured on a gelatinized dish (F). Scale bars = 50 µm.
# |( q1 c2 A0 p; z0 j2 R
* i7 |+ o/ R/ [( `: ^8 {Figure 2. Schematic illustration about how the hybrid samples are obtained. The GFP-positive hybrid cells were sorted by FACS on day 21 and the GFP-negative hybrid cells on day 13 after initiation of differentiation. The sorted cells are used for real-time RT-PCR and bisulfite sequencing. Abbreviations: FACS, fluorescence-activated cell sorting; FL1, fluorescence at 530 nm; FL2, fluorescence at 575 nm; GFP, green fluorescent protein; NSC, neurosphere cell; RA, retinoic acid; RT-PCR, reverse transcription-polymerase chain reaction.. C* V2 I6 J, X
1 D: c: \8 C- m2 QChanges in Gene Expression During Reprogramming and Redifferentiation Following Fusion9 E7 b/ v( O* V- k8 h4 h/ h
; \8 f2 m9 {2 D$ T6 m
To examine the changes in gene expression, we compared by real-time RT-PCR Oct4-GFP-expressing fusion hybrid cells with differentiated hybrid cells (Oct4-GFP-negative) obtained at day 13 after RA-induced differentiation. The pluripotency markers Oct4 and Nanog, which were not expressed in NSCs (marked by red arrow in Fig. 3A), were increased after fusion to levels as in F9 EC cells. The expression levels of Oct4 and Nanog were decreased more than 10-fold after redifferentiation. Sox2 and Sox1, which were also highly expressed in NSCs and in hybrid cells, were downregulated in differentiated hybrid cells (Fig. 3A). Collectively, in hybrid cells, the expression levels of pluripotency markers were reset to similar levels as in F9 EC cells and were downregulated upon differentiation.: T$ U+ J( s/ |& U- S+ n% e
( C; ~' O' i: }/ R# B& b' g) o, j* GFigure 3. Changes in gene expression patterns during reprogramming and redifferentiation following fusion. Real-time reverse transcription-polymerase chain reaction analysis for male NSCs, female NSCs, F9-female NSC fusion hybrids, and differentiated hybrids (A¨CD, F), and chimera formation with fusion hybrids (E). The relative change of RNA levels of pluripotency (A), neural-specific (B, C), and three germ layer-specific markers (D). (E): Representative 12.5-days postcoitus fetus after blastocyst injection with undifferentiated fusion hybrids. (F): The change of RNA levels of the Xist and the eight analyzed X-linked genes. The Xist gene was downregulated after fusion with F9 EC cells and upregulated about 10-fold upon differentiation of the hybrid cells. X-linked genes show a dynamic change of gene expression during reprogramming and redifferentiation. All data are normalized to Bact expression and calibrated on the F9 EC cells, whose expression is considered one for all genes except for the Olig2 gene, for which neural stem cells are used as a calibrator and considered 1. The red arrow indicates that no signal was detected after 45 cycles, but the software considers 45 as the effective Ct. y-axis value is on logarithmic scale, and minor gridlines are 1/10th the value of each major gridline. Abbreviation: NSC, neurosphere cell.
j+ T) C" X2 `. S8 D- C- V
+ H1 e9 C. z2 s/ ?- d' cOn the other hand, the tissue-specific genes Nestin and glutamate receptor 6 (Glur6) were expressed in NSCs as expected (40 and 400 times higher than in F9, respectively; Fig. 3B). The expression level of Nestin was decreased to the same low level as in F9 EC cells after fusion and did not change in differentiated hybrid cells. Expression of Glur6 was abolished after fusion and was not upregulated upon differentiation. After fusion, expression of Olig2 was also reduced to a low level (700 times less than in NSCs), and again, this neural marker was not upregulated during differentiation (Fig. 3C). F9 EC cells differentiate in the presence of RA along the mesodermal and endodermal lineages. For this reason, we compared endodermal (Afp and Hnf4) and mesodermal (Tbx1 and Meox1) gene expression with that of the neural marker Otx2. The visceral endoderm marker Afp, which was not expressed in NSCs, F9 EC cells, and hybrid cells, was drastically upregulated after redifferentiation (Fig. 3D). Hnf4, which was not expressed in NSCs, was upregulated to the same level as in F9 EC cells after fusion and was further upregulated upon differentiation. The mesoderm markers Tbx1 and Meox1 were not expressed in NSCs but upregulated to a lower (Tbx1) or a higher (Meox1) level than F9 level after fusion. When the hybrid cells were differentiated, these mesoderm-related genes were further upregulated. These data indicate that the F9-NSC hybrid cells lose the memory of their somatic genome and preferentially differentiate into endodermal and mesodermal lineages. This was confirmed by determining the in vivo differentiation potential after blastocyst injection; X-gal-positive cells contribute to inner parts of the body but not to brain tissue (Fig. 3E). In contrast, P19-NSC hybrid cells did differentiate along the neural lineage, and the neural markers were upregulated when the hybrid cells were differentiated (supplemental online Fig. S1). These results indicate that the differentiation potential of the hybrid cells depend on the differentiation potential of the pluripotent fusion partner and that the differentiation potential is not a specific feature of the NSCs.
R; E2 Z3 \9 Q2 m \8 g( ^9 p! G4 G2 [* k' |
Change of the Xist Gene During Reprogramming and Redifferentiation After Fusion* S- m: H: Z5 S8 M$ U
& x( D3 d$ e/ q/ xTo study the reactivation of the inactive X chromosome, we measured the Xist RNA level. The Xist RNA is responsible for the inactivation of one of the X chromosome by coating this X chromosome. Xist RNA is transcribed only from the inactive X chromosome (Xi), not from the active X chromosome (Xa) . Therefore, the reactivation of the Xi can be measured by quantitative real-time RT-PCR, allowing quantification of the Xist transcripts. The Xist RNA that is responsible for the X chromosome inactivation was highly expressed only in female NSCs containing Xi and not in male NSCs, since they lack Xi (Fig. 3F). F9 EC cells (derived from a male mouse carcinoma), however, expressed 500 times less Xist RNA than female NSCs. In fusion hybrid cells, the Xist RNA level decreased and reached a level almost identical to that of F9 EC cells, and that was upregulated about 10-fold when the hybrid cells had lost their Oct4-GFP signal upon differentiation.. w# u3 r" N- C
; i" F4 z8 Z( ^; O' i: I
To test whether the change of Xist RNA levels affects the re-establishment of X-linked genes expression, we examined the RNA levels of eight X-linked genes, Hprt, Gata1, Esx1, Ard1, Hdac6, Figf, Gspt2, and Fshprh (Fig. 3F). For these X-linked genes, expression levels were equal or slightly lower than in F9 EC cells or completely absent (Gata1 and Esx1). Six genes, Hprt, Gata1, Ard1, Hdac6, Figf, and Gspt2, were found to be upregulated to the level of (or slightly lower than) F9 EC cells and then downregulated upon differentiation. Esx1, which was not expressed in NSCs, was upregulated after fusion with F9 EC cells, but the level was still 50-fold lower than that of F9 EC cells. Interestingly, this gene was further upregulated after the hybrid cells were differentiated (Oct4-GFP-negative). On the other hand, the level of Fshprh was not changed after fusion and redifferentiation, indicating that the expression of some genes is not affected by fusion-induced reprogramming.9 P, G1 o* m- q! L2 V0 X6 R
9 }2 p* l0 T' Y4 H
Dynamics of DNA Methylation Status on the Oct4 PE and the Promoter Region After Fusion and Redifferentiation
/ P- S* e& D: W& m% o# a
- g) s. ]/ x. ?# A* zThe CpG sites of the Oct4 PE and the promoter region in NSCs were partially methylated (55.0 and 46.0%, respectively). In contrast, all CpG sites of the PE and the promoter region in F9 EC cells (which highly express Oct4) were completely unmethylated (0%) (Fig. 4A). Interestingly, the partial methylation patterns of the PE and the promoter region of female NSCs dramatically declined to 0% (Fig. 4A), indicating the complete demethylation of the Oct4 regulatory region in the somatic fusion partner. This result supports that pluripotency markers are expressed in both NSCs and F9 EC genomes, because methylation of the Oct4 regions is fully erased and any partial methylation clones could not be identified in the hybrid cells. After differentiation, however, the GFP-negative hybrid cells resume a hypermethylation status in the PE and the promoter regions (60.0 and 48.9%, respectively).
) Z8 P& P3 j/ e
& J+ _9 |( x) b) U0 mFigure 4. Methylation status of the Oct4 PE and the promoter, and the Xist regions analyzed by bisulfite sequencing. (A): The hypermethylated status of the Oct4 PE and the promoter regions of NSCs completely demethylated (0%) after fusion with F9 EC cells but resume a hypermethylated status when hybrid cells are differentiated. (B): Differential methylation patterns the Xist region one (Xist R1) of female NSCs changed to partially methylated status after forming hybrid with F9 EC cells. This partial demethylation status remains unchanged even after 13-day of differentiation. Open and filled circles indicate unmethylated and methylated CpGs, respectively. Abbreviations: bp, base pair(s); CR, conserved region; DE, distal enhancer; diff, differentiated; kb, kilobase(s); NSC, neurosphere cell; PE, proximal enhancer.
: x& c: J; _" @# i2 M% A5 j5 C
* ^! \* d6 f# t7 ]9 b: MDemethylation of the Xist Region of Hybrid Cells Does Not Occur in the Differentiation Process: U" C+ e) ~/ K; a* |7 Y3 x
6 f$ k9 N n9 e
The Xist expression was suggested to be controlled by methylation of the 5' region of Xist gene . Female NSCs containing Xa and Xi were differentially methylated: one completely methylated and one completely unmethylated allele (Fig. 4B). However, the Xist R1 of male NSCs lacking Xi showed a complete methylation status (almost 100%) in all clones (data not shown). The Xist R1 of F9 EC cells was partially methylated (70.0%), which supports the real-time RT-PCR data (Fig. 3F), showing that F9 EC cells express 500-fold less levels of the Xist RNA than female NSCs. Therefore, we considered the X chromosome of F9 EC cells as a partially active X chromosome (Xã). The hybrid cells showed a partial methylation pattern on Xist R1 (64.4%; Fig. 4B), similar to the F9 EC cell methylation status (Xã). Moreover, completely unmethylated alleles (which are related to Xi) were not found. Taken together, these data indicate that Xi of NSCs become reactivated into the Xã state by fusion with F9 EC cells. On the other hand, the differentiated hybrid cells, in which the Oct4 PE and promoter regions were already methylated, showed the same partial methylation pattern as undifferentiated hybrid cells (Fig. 4A) without any completely unmethylated clones. This result indicates that F9 EC-female NSC hybrids did not process the X chromosome inactivation at least until day 13 of differentiation, when the Oct4-GFP was completely inactive. We consider this to be due to the slow process of X chromosome inactivation during the differentiation of the F9 EC hybrid cells.
2 X. Q2 D j' X$ f/ O3 n
, ?) ?- P1 w# {- }; d" ODISCUSSION B6 u) _3 c) U" ?% J) u
1 K- U# t$ W6 C2 s; zIn the present study, we have shown that F9 EC cells can reprogram NSCs by forming tetraploid hybrids. When the hybrid cells were differentiated, pluripotency markers (Oct4 and Nanog) were downregulated. The dynamic change of gene expression of pluripotency genes was confirmed by checking the methylation status of the Oct4 PE and the promoter regions. In both areas, CpG sites of NSCs were demethylated after fusion with F9 EC cells (methylation = 0%, as in F9 EC cells) but were remethylated upon differentiation (methylation = 60%, as in NSCs). Although the methylation rate was similar to that of NSCs, the differentiated hybrid cells, which were Oct4-GFP-negative, still had fully unmethylated alleles (two out of 10). This might be caused by a discrepancy in reprogramming endogenous and exogenous Oct4 (Oct4-GFP transgene). In agreement with this notion, the methylation pattern was found not to be identical between the endogenous and the Oct4-GFP transgene (unpublished observation). Therefore, it is possible that although the Oct4-GFP signal disappears, the endogenous Oct4 can be still expressed in some hybrid cells.
6 y2 o4 ^* G$ R- j+ j5 {# y, {( X2 N7 z; J3 o$ h
We have shown that the reprogramming of somatic nuclei by fusion with F9 EC cells is accompanied by the downregulation of tissue-specific markers and the activation of pluripotency genes, and redifferentiation of the hybrid cells is associated with the downregulation of pluripotency genes and activation of endoderm and mesoderm markers, whereas NSC-specific markers (Nestin, Glur6, and Olig2) and Sox1 were not upregulated after differentiation. The fusion hybrid cells preferentially differentiate to endodermal and mesodermal lineages, indicating that the NSCs lose the memory of their origin. It has been suggested that F9 EC cells have a lower rate of spontaneous differentiation and a more restricted differentiation potential in comparison with other EC cell lines after exposure to RA .9 r( c% L; R+ [2 |- A
3 s$ N- J. B) O9 w6 KTaken together with previous data, our results suggest that F9-NSC fusion hybrid cells display a differentiation potential identical to that of their pluripotent fusion partners (F9 EC cells). To validate whether this observation is also true when NSCs are fused with other pluripotent cells, we generated other hybrid cells with P19 EC cells. Contrary to F9 EC cells, P19 EC cells can differentiate into neurons, glia, and fibroblast-like cells after RA treatment . If the NSCs adopt the differentiation potential of P19 EC cells, their fusion hybrid cells should be able to differentiate along the neural lineage. Therefore, we compared the differentiation potential of F9-NSC and P19-NSC hybrid cells. Differentiation of P19-NSC hybrid cells was induced with the same protocol as that used for F9-NSC hybrid cells. The P19-NSC hybrids displayed an upregulation of the NSC markers after RA-induced differentiation (supplemental online Fig. S1). This result confirms the conclusion that hybrid cells lose the memory of the somatic origin and adopt an identical differentiation potential to that of their respective pluripotent fusion partner.
- ^& S2 r. o1 w4 k" a S4 ]$ e l! |' b: p0 P3 m1 r
In mammals, one of the two X chromosomes of female somatic cells is transcriptionally inactive to achieve dosage compensation, since male cells only contain one X chromosome. The Xist RNA is responsible for the inactivation of the X chromosome by covering the X chromosome. Although the mechanism involved in Xist-mediated silencing is unknown, a series of epigenetic changes on the Xi by recruitment of silencing factors are likely to be involved, such as hypoacetylation of histones and DNA methylation . By quantifying the Xist transcripts using real-time RT-PCR and bisulfite DNA sequencing, we demonstrated that hybrid cells displayed an identical state of X chromosome (Xã) to that of F9 EC cells¡ªa lower level of Xist RNA and the partial methylation patterns (about 70%) of the Xist R1.% }2 o( r" [; M. _
9 U L+ j1 o& K2 ]. l
It has been suggested that Xist expression is upregulated from the inactivated X chromosome upon differentiation . Thus, pluripotency might have already been lost when the Oct4 RNA level was downregulated about 10-fold (but was still at a higher level when compared with NSC levels). It is also possible that, at least in F9-NSC hybrid cells, demethylation of the Xist region (reinactivation of X chromosome) could hardly occur or need more time than that of Oct4.
8 q, k* t4 d4 g0 F8 g& a/ H9 f# S6 I) u0 M, T B
It has been suggested that fusion-induced reprogramming entails the erasure of the somatic epigenome and leads to the loss of the differentiation-related gene expression. However, reprogramming itself does not necessarily mean that the somatic cells completely lose their memory, because the hybrid cells might be preferentially committed to the lineage of the somatic cells that had been fused with the pluripotent cells under differentiation-inducing conditions. In the present study, by showing the inability to restore the neural memory, even when the hybrid cells have differentiated, we demonstrated that the NSCs completely lose their memory and acquire a differentiation potential identical to that of their pluripotent fusion partner.1 D" q: _* i+ I. O9 P9 h) J
" G; |% v; o- a4 f S6 S( ?3 _, \DISCLOSURE OF POTENTIAL CONFLICTS OF INTEREST
# f' s3 Q6 ]; E- s9 R7 S$ ?! s* b
The authors indicate no potential conflicts of interest.
! l- c; t8 v0 m6 {% `6 B9 m9 I2 n" [' j! @1 C: h$ g
ACKNOWLEDGMENTS) M$ o9 {7 K( g; x: B
$ W$ k/ z2 \* \$ o2 ~$ K+ b- U* {( [
We are indebted to members of the Schöler laboratory for helpful discussions of the results and valuable comments on the manuscript. We are especially grateful to Claudia Ortmeier for help with the real-time RT-PCR. This work was supported by the Federal Ministry of Education and Research (BMBF) initiative "Cell-Based Regenerative Medicine" (Grant 01GN0539). J.T.D. and D.W.H. contributed equally to this work.6 i0 p9 ^" S+ ]: L: }
【参考文献】. a' S, j9 Q" `- w% y) A( \# u
* Q' P3 ?1 B! j* X9 ~' b7 C1 m
Do JT, Schöler HR. Cell-cell fusion as a means to establish pluripotency. Ernst Schering Res Found Workshop 2006;35¨C45.
$ r) u) C: ~( P+ C( e) T1 l5 r4 m; c0 V
Do JT, Schöler HR. Nuclei of embryonic stem cells reprogram somatic cells. STEM CELLS 2004;22:941¨C949. a* s: C/ j5 h
9 P* L4 k; B% m1 n
Do JT, Schöler HR. Comparison of neurosphere cells with cumulus cells after fusion with embryonic stem cells: reprogramming potential. Reprod Fertil Dev 2005;17:143¨C149.
4 E. m. K, P1 t4 L Y/ d2 a6 A$ o x
Flasza M, Shering AF, Smith K et al. Reprogramming in inter-species embryonal carcinoma-somatic cell hybrids induces expression of pluripotency and differentiation markers. Cloning Stem Cells 2003;5:339¨C354.* Z( V, j r$ o& g4 E: y8 f
3 T! `5 l c1 S3 q! ] [# JHatano SY, Tada M, Kimura H et al. Pluripotential competence of cells associated with Nanog activity. Mech Dev 2005;122:67¨C79.: _8 M" c A8 b# ` {
+ D8 p! m, i" O. Y! x
Tada M, Tada T, Lefebvre L et al. Embryonic germ cells induce epigenetic reprogramming of somatic nucleus in hybrid cells. EMBO J 1997;16:6510¨C6520.1 S% d4 u" ]# L
/ u$ e' H5 D) R) _* D9 bTada M, Takahama Y, Abe K et al. Nuclear reprogramming of somatic cells by in vitro hybridization with ES cells. Curr Biol 2001;11:1553¨C1558.
5 W5 u. f! J6 W+ n
8 P& e# _% d3 X7 m4 D0 n1 a4 w3 Z8 XMatveeva NM, Shilov AG, Kaftanovskaya EM et al. In vitro and in vivo study of pluripotency in intraspecific hybrid cells obtained by fusion of murine embryonic stem cells with splenocytes. Mol Reprod Dev 1998;50:128¨C138.: ]* ~8 t# i6 q& C3 L1 k; v
- D" |% N4 `6 vKoopman P, Cotton RG. Pluripotent differentiation of single F9 embryonal carcinoma cells. Exp Cell Res 1987;168:567¨C571.( Y& ~# g$ i( k; s; P! W
& l* b$ N; {. i$ yLehtonen E, Laasonen A, Tienari J. Teratocarcinoma stem cells as a model for differentiation in the mouse embryo. Int J Dev Biol 1989;33:105¨C115.
9 h q$ b1 s2 x f5 u
0 i+ x% S: K4 b6 N2 j, ~Nayernia K, Li M, Jaroszynski L et al. Stem cell based therapeutical approach of male infertility by teratocarcinoma derived germ cells. Hum Mol Genet 2004;13:1451¨C1460.
9 Q9 j1 o* g+ q6 {0 f5 R( s$ p1 p3 r: Y1 E. ?
Rochette-Egly C, Chambon P. F9 embryocarcinoma cells: A cell autonomous model to study the functional selectivity of RARs and RXRs in retinoid signaling. Histol Histopathol 2001;16:909¨C922.9 E* r4 `0 ]. N9 A4 x) z
/ q, U6 b4 f6 E( |. `/ o" l; SBerstine EG, Hooper ML, Grandchamp S et al. Alkaline phosphatase activity in mouse teratoma. Proc Natl Acad Sci U S A 1973;70:3899¨C3903.
9 ~7 l; ?7 C9 J* O6 r, a
, A) u! j9 N( BHarris TM, Childs G. Global gene expression patterns during differentiation of F9 embryonal carcinoma cells into parietal endoderm. Funct Integr Genomics 2002;2:105¨C119.+ ]. X) L2 {7 n/ y( k; ]
) w8 ?6 {1 d9 d9 n* E% ^
Boiani M, Gentile L, Gambles VV et al. Variable reprogramming of the pluripotent stem cell marker Oct4 in mouse clones: Distinct developmental potentials in different culture environments. STEM CELLS 2005;23:1089¨C1104.0 J8 C2 ]# D8 e
% G- ]! R* p* W) T" N0 W2 DSuzuki T, Higgins PJ, Crawford DR. Control selection for RNA quantitation. Biotechniques 2000;29:332¨C337.
# U" J9 v9 `) b5 x2 L/ g i z6 b% |9 w/ z1 v) O4 u m
Lee JT, Lu N. Targeted mutagenesis of Tsix leads to nonrandom X inactivation. Cell 1999;99:47¨C57.
, {9 `5 q$ M. i3 S( f
& X9 k1 r; B5 F" v* e3 K) W1 `' lPanning B, Dausman J, Jaenisch R. X chromosome inactivation is mediated by Xist RNA stabilization. Cell 1997;90:907¨C916.3 I; A ~! B P. [; y1 s3 `; C( r
& ^9 f# ~/ v& j' N8 P
Beard C, Li E, Jaenisch R. Loss of methylation activates Xist in somatic but not in embryonic cells. Genes Dev 1995;9:2325¨C2334.
7 k# l' {" }2 D+ k, k9 F A; [- o& D
. t5 q% e6 D6 h- P& w' dNorris DP, Patel D, Kay GF et al. Evidence that random and imprinted Xist expression is controlled by preemptive methylation. Cell 1994;77:41¨C51.
4 n; Z' l6 ~+ E
- e7 l# J7 ~5 ]8 u! v" j) ?McDonald LE, Paterson CA, Kay GF. Bisulfite genomic sequencing-derived methylation profile of the xist gene throughout early mouse development. Genomics 1998;54:379¨C386.4 R+ q1 E+ y+ `2 y% i
4 v. V* e2 c3 t; @1 _ U* M# E, s( {5 x
Zuccotti M, Monk M. Methylation of the mouse Xist gene in sperm and eggs correlates with imprinted Xist expression and paternal X-inactivation. Nat Genet 1995;9:316¨C320.7 S2 h& B. O0 m" Y) b3 m
. Y' I" N. T& R* {
Reddi AH. Bone morphogenetic proteins: an unconventional approach to isolation of first mammalian morphogens. Cytokine Growth Factor Rev 1997;8:11¨C20.8 A! W" Z c1 f& `2 H. Q
+ J6 m9 [! l0 z) Q- F ]/ ^( iGitelman I. Twist protein in mouse embryogenesis. Dev Biol 1997;189:205¨C214.! G. N% ]; |2 ^$ ~: l& u$ d
! k( e; t# ]5 w1 F0 S, ~Yang J, Mani SA, Weinberg RA. Exploring a new twist on tumor metastasis. Cancer Res 2006;66:4549¨C4552.3 O* G4 L: p0 C7 { S6 u1 o
) I7 @" q! h; y4 Z
Plageman TF Jr, Yutzey KE. T-box genes and heart development: Putting the "T" in heart. Dev Dyn 2005;232:11¨C20.. K2 E3 B8 D0 f% \& K, U
# z4 S, c" h, c; n0 `
Liesi P, Rechardt L, Wartiovaara J. Nerve growth factor induces adrenergic neuronal differentiation in F9 teratocarcinoma cells. Nature 1983;306:265¨C267.
$ W- l! k Y* _) P% [
% k0 L4 e7 Q, ~, oTienari J, Virtanen I, Soinila S et al. Neuron-like derivatives of cultured F9 embryonal carcinoma cells express characteristics of parietal endoderm cells. Dev Biol 1987;123:566¨C573.. H6 @& V, ], I$ e
0 [9 }3 D) K$ ~# e8 sJones-Villeneuve EM, McBurney MW, Rogers KA et al. Retinoic acid induces embryonal carcinoma cells to differentiate into neurons and glial cells. J Cell Biol 1982;94:253¨C262.6 j* K- m! o, I# j: {. A* h: }1 T2 M
r/ n, P4 d8 b, u- L, a
Rougeulle C, Chaumeil J, Sarma K et al. Differential histone H3 Lys-9 and Lys-27 methylation profiles on the X chromosome. Mol Cell Biol 2004;24:5475¨C5484.
- ]+ a; Z1 ]9 {7 W( ] H2 l" |8 t h9 E
Kimura H, Tada M, Hatano S et al. Chromatin reprogramming of male somatic cell-derived XIST and TSIX in ES hybrid cells. Cytogenet Genome Res 2002;99:106¨C114.) X2 C$ ^" K ~8 K
* V6 E/ i+ q3 n, S2 Z3 _
Sheardown SA, Duthie SM, Johnston CM et al. Stabilization of Xist RNA mediates initiation of X chromosome inactivation. Cell 1997;91:99¨C107.0 Q+ a0 q) T( z
& z1 J. C4 V3 q
Niwa H, Miyazaki J, Smith AG. Quantitative expression of Oct-3/4 defines differentiation, dedifferentiation or self-renewal of ES cells. Nat Genet 2000;24:372¨C376. |
|