Higher Expression of Transcription Targets and Components of the Nuclear Factor- - 《stemcells》干细胞学杂志干细胞之家



免疫细胞治疗专区	欢迎关注干细胞微信公众号

12 3 4 5 6 7 8 9 10 ... 26 下一页

返回列表

查看: 470541\|回复: 259	go Higher Expression of Transcription Targets and Components of the Nuclear Factor- [复制链接]

江边孤钓

版主

Rank: 7 Rank: 7 Rank: 7

积分: 0
威望: 0
包包: 483

楼主

发表于 2009-3-5 01:00 |只看该作者 |倒序浏览 |打印

作者：Rodrigo Alexandre Panepuccia, Rodrigo Tocantins Caladoa, Vanderson Rochab, Rodrigo Proto-Siqueiraa, Wilson Araujo Silva, Jr.a, Marco Antonio Zagoa作者单位：aCenter for Cell Therapy and Regional Blood Center, Department of Clinical Medicine, Faculty of Medicine, University of So Paulo, Ribeiro Preto, Brazil;bBone Marrow Transplantation Unit, Hpital Saint-Louis, Paris, France 4 i* E( F( m0 Q' E+ o9 K, k
   4 Z/ L4 v0 o, v1 l

      ) I6 `0 P0 B6 z5 Q7 |; r
                     : {" z. X! f: L& e. r' D

         : f" U/ m# s2 A( t# h9 w7 [9 E

         9 }- i1 P8 R5 g  ]6 f; S/ p) k

      ; [6 B+ j& E' V

      % T! h+ d$ \8 @" o% J$ A, l1 G5 X+ V- S
      【摘要】
   Delayed engraftment, better reconstitution of progenitors, higher thymic function, and a lower incidence of the graft-versus-host disease are characteristics associated with umbilical cord blood (UCB) transplants, compared with bone marrow (BM). To understand the molecular mechanisms causing these intrinsic differences, we analyzed the differentially expressed genes between BM and UCB hematopoietic stem and progenitor cells (HSPCs). The expressions of approximately 10,000 genes were compared by serial analysis of gene expression of magnetically sorted CD34  cells from BM and UCB. Differential expression of selected genes was evaluated by real-time polymerase chain reaction on additional CD34  samples from BM (n = 22), UCB (n = 9), and granulocyte colony stimulating factor-mobilized peripheral blood (n = 6). The overrepresentation of nuclear factor-B (NF-B) pathway components and targets was found to be a major characteristic of UCB HSPCs. Additional promoter analysis of 41 UCB-overrepresented genes revealed a significantly higher number of NF-B cis-regulatory elements (present in 22 genes) than would be expected by chance. Our results point to an important role of the NF-B pathway on the molecular and functional differences observed between BM and UCB HSPCs. Our study forms the basis for future studies and potentially for new strategies to stem cell graft manipulation, by specific NF-B pathway modulation on stem cells, prior to transplant. 2 V/ e% F4 |# F5 d1 ]$ K
      【关键词】 Hematopoiesis Stem cells Nuclear factor-B Umbilical cord blood Bone marrow
   INTRODUCTION

The appearance of hematopoietic stem and progenitor cells (HSPCs) in the early embryo occurs at a site called aorta-gonad-mesonephros. Later, HSPCs from this site home to secondary sites in the fetus such as the liver, and finally into the bone marrow (BM), where definitive hematopoiesis takes place in adults .
- k4 g% N: _5 {7 ]; W) o* \
We demonstrate that transcripts enriched in UCB HSPCs included activators, mediators, regulators, and transcription targets of nuclear factor-B (NF-B) signaling. The promoter analysis of these transcript genes further corroborated the importance of NF-B transcription factors (TFs) by showing that NF-B binding sites (BSs) were significantly overrepresented in these promoters.  z* M2 z7 x2 i) L# z
. T6 N+ b" C; G8 s; w7 j
MATERIALS AND METHODS

CD34  Cells6 r! X' C6 Y! ]; g. R

UCB from full-term deliveries, BM iliac crest aspirates from healthy adult donors, and granulocyte colony stimulating factor MPB were collected after informed consent was obtained, approved by the local Institutional Review Board. Magnetic cell sorting was carried out using the MACS Direct CD34 Progenitor Cell Isolation Kit (Miltenyi Biotec, Bergisch Gladbach, Germany, http://www.miltenyibiotec.com), following the manufacturer's instructions, except that after gradient centrifugation separation, mononuclear cells were incubated for 1 hour in culture flask at 37¡ãC (RPMI; 5% bovine serum albumin) to remove adherent cells before magnetic labeling. Expression of selected genes was evaluated in additional CD34  cell samples from BM (n = 22), UCB (n = 9), and MPB (n = 6). Percentage of CD34 cells (purity) was determined by flow cytometry using anti-CD34-PE and anti-CD45-PerCP (BD Pharmingen, San Diego, http://www.bdbiosciences.com/pharmingen)., H8 U4 a6 q4 R- O0 a  C

SAGE Transcriptomes
7 v+ Q/ n3 o) s, B
Total RNA of CD34  cells from nine BM samples (mean purity of 94%) and seven UCB samples (mean purity of 89%) were pooled to yield two pools of 15 µg of RNA, which were used to generate the SAGE libraries. RNA extraction, library construction, and data analysis were done as previously described .

Promoter Analysis

Promoter analysis of differentially expressed genes, comparing BM and UCB HSPCs, was carried out by the Toucan software . Promoter regions up to 600 bp upstream of the first exon were retrieved and subjected to a transcription factor binding site (TFBS) search, followed by a statistical analysis to identify significantly overrepresented TFBS, compared with the overall TFBS expected frequencies on the human promoter set of the Eukaryotic Promoter Database. The stringency level (prior value) of the TFBS search was set to 0.02.

Quantitative Polymerase Chain Reaction

Total RNA from CD34  HSPCs, isolated from 22 BM, nine UCB, and six MPB samples, was reverse transcribed to cDNA using the High Capacity cDNA Archive Kit (Applied BioSystems, Foster City, CA, http://www.appliedbiosystems.com), following the manufacturer's instructions. Real-time polymerase chain reaction (PCR) (in duplicate) for CCL4, NFKB2, interleukin 8 , RELB, and TGFB1 were carried out with TaqMan probes and MasterMix, whereas IL1B, ICAM1, RELA, and TNFA were assayed with SYBr Green Mix (Applied BioSystems). The 5' to 3' sequences of the forward (f) and reverse (r) primers used in conjunction with the SYBr Green Mix were as follows: IL1B-f, TCAGCCAATCTTCATTGCA; IL1B-r, TGGCGAGCTCAGGTACTTCT; ICAM1-f, GCCAACCAATGTGCTATTCA; ICAM1-r, GCCAGTTCCACCCGTTCT; RELA-f, CCACGAGCTTGTAGGAAAGG; RELA-r, CTGGATGCGCTGACTGATAG; TNFA-f, CTCTTCTGCCTGCTGCACTT; and TNFA-r, GCCAGAGGGCTGATTAGAGA. To normalize sample loading, the differences of threshold cycles (Ct) were derived by subtracting the Ct value for the internal reference (glyceraldehyde-3-phosphate dehydrogenase) from the Ct values of the evaluated genes. The relative fold value was obtained by the formula 2¨C Ct using the median Ct value of BM samples as a reference; Ct was calculated by subtracting the reference Ct from the Ct values of the samples. Expression of all samples was measured in a single plate for each gene evaluated. The Kruskal-Wallis test with Dunn's post hoc test was performed using Prism 4 (GraphPad Software, Inc., San Diego, http://www.graphpad.com)., V8 N- f% x( f% K
' X1 f7 L% E& N
RESULTS$ G3 R" w9 p! p3 N$ l
" V, a9 C; }9 L, H' f
A total of 61,302 and 60,745 tags from BM and UCB CD34 HSPC SAGE libraries were sequenced and corresponded to, respectively, 15,398 and 14,518 unique tags that could be mapped to 10,439 and 9,973 distinct UniGene clusters (full data available at http://gdm.fmrp.usp.br).7 }$ k% \! W) J# _

A direct comparison of the SAGE transcriptomes from BM and UCB revealed a large overall similarity. Only 61 differentially expressed tags (p
( }# P5 x+ O8 g% G" @+ m
Table 1. Differentially expressed transcripts between UCB and BM HSPCs

Figure 1. NF-B signaling and transcriptional targets in umbilical cord blood (UCB) hematopoietic stem and progenitor cells (HSPCs). (A): Schematic illustration of NF-B signaling components overrepresented on UCB HSPCs. (B): Heatmap illustrating the number of NF-B binding sites on known or potentially new transcription targets. A promoter analysis carried out on UCB-overexpressed genes highlighted five NF-B binding sites (BSs) overrepresented along 22 of 43 gene promoters. Numbers of NF-B BS are shown as follows: 0, white; 1, light gray; 2, dark gray; 3, black. BSs are shown in decreasing order of significance from left to right. Transfac accession numbers are shown in parentheses. M00208 was not among the overrepresented BSs found. Abbreviations: CEBPB, CCAAT/enhancer-binding protein B; FGF, fibroblast growth factor; ICAM, intercellular adhesion molecule; IL, interleukin; LTB, lymphotoxin-ß; NF-B, nuclear factor-B; TGF, transforming growth factor; TNF, tumor necrosis factor.; l; u  q( g& r( j$ i, ^7 T

Table 2. Additional genes related to the nuclear factor  B (NF- B) pathway overrepresented on UCB hematopoietic stem and progenitor cells (HSPCs)

A promoter analysis on 41 of these 43 genes revealed that five NF-B binding sites were among the top significantly overrepresented TFBSs, distributed along the promoters of 22 genes (Fig. 1B). Many known NF-B transcription targets were among these genes, including CXCL2 , and others.$ {3 M1 l" ~" _9 d  i& T
: Q% `! d: A& Y1 K/ u
To evaluate the significance of this findings on additional CD34  cell samples, we selected a set of genes to evaluate by real-time PCR, including activators (IL1B, TNF, and TGFB1), effectors (NFKB2, RELA, and RELB) and transcriptional targets (ICAM1, IL8, and CCL4L) of NF-B signaling.
6 h$ ~4 P; K+ S
The RELA (p65) subunit of the NF-B TF was not detected by our SAGE analysis, but we demonstrated a significant higher expression of this transcript on UCB HSPCs by real-time PCR (Fig. 2). SAGE tags for TNF were present in higher numbers in UCB HSPCs (nine tags) than in BM HSPCs (three tags), and although this difference was not statistically significant (p = .08), the difference obtained by real-time PCR was highly significant (Fig. 2)./ g  [' i" d; k" q
  c  `: C( ]& X( M
Figure 2. Validation of nuclear factor-B (NF-B)-related genes by real-time polymerase chain reaction (PCR). Quantitative PCR was carried out on CD34  hematopoietic stem and progenitor cells isolated from 22 BM, nine UCB, and six MPB samples. Gene expression is shown as the fold relative to the median gene expression of the BM samples. Differences between BM and UCB were all significant (p
$ v) n  v; m- V- j, W
Differences observed between UCB and BM HSPCs, for all nine selected genes, were validated by real-time PCR (Fig. 2), supporting our assumption that a higher constitutive NF-B signaling is a distinctive feature of UCB CD34  HSPCs. In addition, results for MPB were similar to those obtained for BM samples, except for TGFB1, which was similar to UCB (Fig. 2).+ P0 W' O: D% z) ?- F

DISCUSSION9 I3 `* d1 u4 U# ^  {

The overrepresentation of the central components of the NF-B pathway is a major characteristic of UCB HSPCs (Figs. 1, 2), and inhibition of constitutive NF-B activity in BM CD34  HSPCs causes loss of clonogenic function and induces apoptosis , among other mechanisms." K4 I1 I3 y. E- P5 Z

The large number of known and new potential NF-B transcription targets among the UCB-overrepresented genes (as detected by our promoter analysis) is a strong evidence of NF-B signaling. The role of this pathway becomes clearer when our set of UCB-overrepresented genes are compared with NF-B genomic targets identified by two independent large scale studies, using TNF  as activators. The large number of common genes further corroborates our conclusion.# w6 P! q+ s2 b3 O, T

NF-B TF complexes are composed of regulatory (NFKB1 or NFKB2) and transcriptionally active (RELA, RELB, or REL) subunits. NF-B signaling (Fig. 1A) acts through two pathways: the classic or canonical pathway (mediated by RELA and NFKB1), and the noncanonical or constitutive pathway (mediated by RELB and NFKB2). Although the latter is responsible for the sustained activation of NF-B signaling, the former may influence its duration and amplitude .
) N, w% Y9 @  R2 Y$ k1 K( C2 {) k
Although gene expression studies of HSPCs from different sources have been carried by others , 15 were found on our analysis with statistically significant (p
3 O( A; J* }' Q1 D
Table 3. Agreement between our data (based on SAGE) and that of Ng et al.  (using microarray) in relation to differentially expressed genes between BM and UCB hematopoietic stem and progenitor cell (HSPCs)* x) s% S/ v( o$ t1 _: Y

Many of the genes identified in common in both studies, such as elastase, myeloperoxidase, and cathepsin G, which are overrepresented on BM CD34  HSPCs, are discussed elsewhere .

Despite the agreement of the two studies in relation to this limited set of genes, our work differs from that of Ng et al. , although the finding was not emphasized.

Although IL8 has long been known to be a transcription target of NF-B signaling .: l4 g" i. g6 |: [! u& X1 W/ p
/ k' p2 n- K( ^) L" p
In addition, the proapoptotic function of NR4A1 on T cells at the CD4¨C CD8¨C stage may be inhibited by the interaction with NOTCH1 , compared with BM recipients and HSPCs, respectively.

For instance, BM HSPCs differentiation into T lymphocytes in FTOC depends on the prestimulation with TNF .; N1 O; W: ~5 S6 B3 r8 e

Moreover, other characteristics of UCB HSPCs, such as a higher in vitro migration .1 B* \! T: d! r, r- ]$ r' H( E
6 T& r8 i8 r4 [/ M
Although the expression profiles of NF-B components and targets of MPB and BM HSPCs are similar, they differ in relation to TGFB1, because its expression is significantly higher both in MPB and in UCB HSPCs, compared with BM (Fig. 2). This high expression may be related to specific needs of these in-transit cells, as for instance by its ability to modulate the responsiveness of CD34  cells .
( c" b. }/ j2 G+ h- v6 t5 Y
Many additional genes overrepresented in UCB HSPCs (Table 1) may be involved in the mechanism of higher constitutive NF-B signaling in these cells. For instance, LTB, which has a crucial role in the formation of peripheral lymphoid organs, promotes the nuclear translocation of p52/RELB dimmers, activating the noncanonical constitutive NF-B pathway .5 Q$ e7 A4 Z$ I# P. t6 ]) j3 c

As mentioned, additional components of the NF-B signaling machinery (and other potential players) can be found in Table 2, as, for instance, TNIP1 (NAF1/ABIN-1), TRAF3/LAP1, and SUMO-1 act on NF-B signaling regulation . Finally, fibroblast growth factor receptor 4 and the other member of the NUR77 family NR4A3 are also overrepresented on UCB HSPCs.4 C' S* s' s8 G" K

It is also tempting to speculate about the role of NF-B signaling and the reduced risk of GVHD on UCB transplants in comparison to BM transplants. For instance, whereas TNF plays an important role in the immune regulatory activity of CD34  HSPCs ., s1 o* L  n# W) x( G
4 ^+ F5 p/ a: h- f' f
The chemokine known as MIP-1ß is derived from two paralogous genes, CCL4 (ACT2) and CCL4L (LAG1) .0 a$ ^* F$ z* Z- `

Increased constitutive phosphorylation of the NF-B inhibitor IkB and an increased percentage of UCB-derived CD34  cells (90%) showing nuclear RELA in relation to BM (50%) and MPB-derived cells (not detected) strongly corroborate our observations .3 I- J" P. N& J

In conclusion, increased NF-B constitutive signaling, indicated by our gene expression and promoter study, is a major hallmark of UCB HSPCs. This would not be associated with late transient events, but rather with specific needs of HSPCs for the development of immune system, which are ultimately reflected on their in vitro and in vivo behavior.
/ [# h) i4 i' D$ b: d9 m  N
Understanding the molecular mechanisms involved in these differences may contribute to improve the outcomes of transplantation (reducing the risk of GVHD or the time to engraftment) or the in vitro behavior of the graft (e.g., favoring self renewal and inhibiting differentiation of expanded cells). The functional roles of NF-B pathway components and targets in UCB CD34  precursors, proposed by us, are based on the information from the literature. Thus, the specific participation of the NF-B pathway on some of the distinct in vivo and in vitro characteristics observed on BM and UCB CD34  cells should be experimentally addressed.3 K( ^5 h, s$ F- ]
9 [$ N8 I/ y0 H: Y8 e) J, [
DISCLOSURES
+ L1 ~8 ]! }5 i
The authors indicate no potential conflicts of interest.1 {2 p( R8 @$ z; W8 j/ @) b- f
& b& H- J0 t- K( C" {" `
ACKNOWLEDGMENTS8 p) o. @3 o- j+ m2 L/ s' Z- d

We thank Aglair B. Garcia, Anemari D. Santos, Am¨¦lia G. Araujo, Marli H. Tavella, and Maristela Orellana for expert help with the laboratory techniques and Carlos A. Scrideli and Rita C.V. Carrara for providing primers and samples. We also thank Mair P. Souza and Vergilio Colturato from the Hospital Amaral de Carvalho de Ja¨², Carmino A. Souza from the Universidade Estadual de Campinas, and Milton Ruiz from Faculdade de Medicina de S. Jos¨¦ do Rio Preto for obtaining bone marrow samples for this study. This work was supported by Fundação de Amparo ¨¤ Pesquisa do Estado de São Paulo, Conselho Nacional de Desenvolvimento Cient¨ªfico e Tecnol¨®gico, and Financiadora de Estudos e Projetos.0 L/ R/ y8 `! f; h" s
      【参考文献】
% P# @! k. x: y  r! L5 A8 v
" C' B' s! c4 e; Q0 i8 u  ~
Dzierzak E. Embryonic beginnings of definitive hematopoietic stem cells. Ann N Y Acad Sci 1999;872:256¨C262.

Spits H. Development of alphabeta T cells in the human thymus. Nat Rev Immunol 2002;2:760¨C772.

Rocha V, Sanz G, Gluckman E. Umbilical cord blood transplantation. Curr Opin Hematol 2004;11:375¨C385.; W/ U2 U: y2 x2 f. T
' p/ |+ Y( k3 M3 l
Frassoni F, Podesta M, Maccario R et al. Cord blood transplantation provides better reconstitution of hematopoietic reservoir compared with bone marrow transplantation. Blood 2003;102:1138¨C1141.3 m; q5 t& ]- v9 Z# P& G
4 S: ~0 ~2 v: \0 b8 {% g
Noort WA, Wilpshaar J, Hertogh CD et al. Similar myeloid recovery despite superior overall engraftment in NOD/SCID mice after transplantation of human CD34( ) cells from umbilical cord blood as compared to adult sources. Bone Marrow Transplant 2001;28:163¨C171.; e: |6 r- _7 g3 b& j: ^4 P; }

Theunissen K, Verfaillie CM. A multifactorial analysis of umbilical cord blood, adult bone marrow and mobilized peripheral blood progenitors using the improved ML-IC assay. Exp Hematol 2005;33:165¨C172.

Talvensaari K, Clave E, Douay C et al. A broad T-cell repertoire diversity and an efficient thymic function indicate a favorable long-term immune reconstitution after cord blood stem cell transplantation. Blood 2002;99:1458¨C1464.- y( ]( o7 n* W

Voermans C, Gerritsen WR, von dem Borne AE et al. Increased migration of cord blood-derived CD34  cells, as compared to bone marrow and mobilized peripheral blood CD34  cells across uncoated or fibronectin-coated filters. Exp Hematol 1999;27:1806¨C1814.8 b% i( T5 K* C$ G
3 {9 W7 [3 ?: ?" ]4 Z
Weekx SF, Snoeck HW, Offner F et al. Generation of T cells from adult human hematopoietic stem cells and progenitors in a fetal thymic organ culture system: Stimulation by tumor necrosis factor-alpha. Blood 2000;95:2806¨C2812.: {. m8 r1 w  s$ R' Y$ M9 Y

Arakawa-Hoyt J, Dao MA, Thiemann F et al. The number and generative capacity of human B lymphocyte progenitors, measured in vitro and in vivo, is higher in umbilical cord blood than in adult or pediatric bone marrow. Bone Marrow Transplant 1999;24:1167¨C1176.4 h- l  }) _# c* h) a& v
/ r/ a5 a2 U$ f  B
Bradley MB, Cairo MS. Cord blood immunology and stem cell transplantation. Hum Immunol 2005;66:431¨C446.7 ~5 C# B) h+ k2 x6 ^! h6 x2 v
1 Q0 l# p: a& V6 F) g5 q7 x- n" u
Weekx SF, Van Bockstaele DR, Plum J et al. CD34 CD38- and CD34  CD38  human hematopoietic progenitors from fetal liver, cord blood, and adult bone marrow respond differently to hematopoietic cytokines depending on the ontogenic source. Exp Hematol 1998;26:1034¨C1042.6 v1 \% B9 t1 q

Shojaei F, Gallacher L, Bhatia M. Differential gene expression of human stem progenitor cells derived from early stages of in utero human hematopoiesis. Blood 2004;103:2530¨C2540.

Velculescu VE, Zhang L, Vogelstein B et al. Serial analysis of gene expression. Science 1995;270:484¨C487.

Panepucci RA, Siufi JL, Silva WA Jr et al. Comparison of gene expression of umbilical cord vein and bone marrow-derived mesenchymal stem cells. STEM CELLS 2004;22:1263¨C1278.* [1 M: l1 P2 {- s/ v& g
8 A6 D+ w; }. m$ y) c3 j" g) E
Aerts S, Van LP, Thijs G et al. TOUCAN 2: the all-inclusive open source workbench for regulatory sequence analysis. Nucleic Acids Res 2005;33:W393¨CW396.
+ x9 l) [" u, [2 @
Mayer H, Bilban M, Kurtev V et al. Deciphering regulatory patterns of inflammatory gene expression from interleukin-1-stimulated human endothelial cells. Arterioscler Thromb Vasc Biol 2004;24:1192¨C1198.# U/ ]" ~0 z( L( S, f$ @% u6 l

Beinke S, Ley SC. Functions of NF-kappaB1 and NF-kappaB2 in immune cell biology. Biochem J 2004;382:393¨C409.! H: P' z, Q9 R# G/ w7 ~

Jaramillo M, Godbout M, Olivier M. Hemozoin induces macrophage chemokine expression through oxidative stress-dependent and -independent mechanisms. J Immunol 2005;174:475¨C484.$ m. {" m- Z+ i: ?
! [. t7 e/ J: z( a6 {  Q: [8 i2 G* r
Anisowicz A, Messineo M, Lee SW et al. An NF-kappa B-like transcription factor mediates IL-1/TNF-alpha induction of gro in human fibroblasts. J Immunol 1991;147:520¨C527.

Collins T, Read MA, Neish AS et al. Transcriptional regulation of endothelial cell adhesion molecules: NF-kappa B and cytokine-inducible enhancers. FASEB J 1995;9:899¨C909.
+ X* z: r4 t- A+ R8 Q5 T3 z7 f& {6 D
Stein B, Baldwin AS Jr. Distinct mechanisms for regulation of the interleukin-8 gene involve synergism and cooperativity between C/EBP and NF-kappa B. Mol Cell Biol 1993;13:7191¨C7198.
; y+ R% g: D% D  v! R# i
Stylianou E, Saklatvala J. Interleukin-1. Int J Biochem Cell Biol 1998;30:1075¨C1079.: a; k  `& y  Q$ Z# D

Liptay S, Schmid RM, Nabel EG et al. Transcriptional regulation of NF-kappa B2: Evidence for kappa B-mediated positive and negative autoregulation. Mol Cell Biol 1994;14:7695¨C7703.

Bren GD, Solan NJ, Miyoshi H et al. Transcription of the RelB gene is regulated by NF-kappaB. Oncogene 2001;20:7722¨C7733.
- V# u. Z  B3 ~
Pyatt DW, Stillman WS, Yang Y et al. An essential role for NF-kappaB in human CD34( ) bone marrow cell survival. Blood 1999;93:3302¨C3308.; o: Z' m8 M( z

Nakata S, Matsumura I, Tanaka H et al. NF-kappaB family proteins participate in multiple steps of hematopoiesis through elimination of reactive oxygen species. J Biol Chem 2004;279:55578¨C55586.

Tian B, Nowak DE, Jamaluddin M et al. Identification of direct genomic targets downstream of the NF-kappa B transcription factor mediating TNF signaling. J Biol Chem 2005;280:17435¨C17448.

Cheng P, Zlobin A, Volgina V et al. Notch-1 regulates NF-kappaB activity in hemopoietic progenitor cells. J Immunol 2001;167:4458¨C4467.
! G* ?5 @  |% ?: A3 n6 W4 @' ]" J
de Leseleuc L, Denis F. Inhibition of apoptosis by Nur77 through NF-kappaB activity modulation. Cell Death Differ 2006;13:293¨C300.2 F- [3 D$ K* `. d( _
% U6 A8 O2 a1 K* B4 _& L$ C
Hauer J, Puschner S, Ramakrishnan P et al. TNF receptor (TNFR)-associated factor (TRAF) 3 serves as an inhibitor of TRAF2/5-mediated activation of the noncanonical NF-kappaB pathway by TRAF-binding TNFRs. Proc Natl Acad Sci U S A 2005;102:2874¨C2879.. K  O' c- K' Q+ A

Sanz L, az-Meco MT, Nakano H et al. The atypical PKC-interacting protein p62 channels NF-kappaB activation by the IL-1-TRAF6 pathway. EMBO J 2000;19:1576¨C1586.
8 p$ ^% S' Z" [% v; N' k
Shin HM, Minter LM, Cho OH et al. Notch1 augments NF-kappaB activity by facilitating its nuclear retention. EMBO J 2006;25:129¨C138.  E1 _% s4 i3 c4 [3 r1 e* z) R: j
1 v4 B% G' l; ?7 g
Vandermoere F, El Yazidi-Belkoura I, Adriaenssens E et al. The antiapoptotic effect of fibroblast growth factor-2 is mediated through nuclear factor-kappaB activation induced via interaction between Akt and IkappaB kinase-beta in breast cancer cells. Oncogene 2005;24:5482¨C5491.
* o/ @: E+ l8 y: ]3 L
Zhu Y, Culmsee C, Klumpp S et al. Neuroprotection by transforming growth factor-beta1 involves activation of nuclear factor-kappaB through phosphatidylinositol-3-OH kinase/Akt and mitogen-activated protein kinase-extracellular-signal regulated kinase1,2 signaling pathways. Neuroscience 2004;123:897¨C906.

Georgantas RW III, Tanadve V, Malehorn M et al. Microarray and serial analysis of gene expression analyses identify known and novel transcripts overexpressed in hematopoietic stem cells. Cancer Res 2004;64:4434¨C4441.
, z+ ^; N/ l4 ^2 D
Graf L, Heimfeld S, Torok-Storb B. Comparison of gene expression in CD34  cells from bone marrow and G-CSF-mobilized peripheral blood by high-density oligonucleotide array analysis. Biol Blood Marrow Transplant 2001;7:486¨C494.
; d/ `: k+ s- S) [5 ~
Ng YY, van Kessel B, Lokhorst HM et al. Gene-expression profiling of CD34  cells from various hematopoietic stem-cell sources reveals functional differences in stem-cell activity. J Leukoc Biol 2004;75:314¨C323.

Steidl U, Kronenwett R, Rohr UP et al. Gene expression profiling identifies significant differences between the molecular phenotypes of bone marrow-derived and circulating human CD34  hematopoietic stem cells. Blood 2002;99:2037¨C2044.
6 _7 K* _! O  k( U% ?
Steidl U, Kronenwett R, Haas R. Differential gene expression underlying the functional distinctions of primary human CD34  hematopoietic stem and progenitor cells from peripheral blood and bone marrow. Ann N Y Acad Sci 2003;996:89¨C100.
/ ?- S1 d, \9 k8 ^$ z& y* b* o
Cooper CL, Brady G, Bilia F et al. Expression of the Id family helix-loop-helix regulators during growth and development in the hematopoietic system. Blood 1997;89:3155¨C3165.6 u: H* k$ @4 J

Pei L, Castrillo A, Chen M et al. Induction of NR4A orphan nuclear receptor expression in macrophages in response to inflammatory stimuli. J Biol Chem 2005;280:29256¨C29262.
- W2 j# l+ @2 r$ |% |8 l. n
Suzuki S, Suzuki N, Mirtsos C et al. Nur77 as a survival factor in tumor necrosis factor signaling. Proc Natl Acad Sci U S A 2003;100:8276¨C8280.: a- `, H( D! Y9 p& O) ?

Liu ZG, Smith SW, McLaughlin KA et al. Apoptotic signals delivered through the T-cell receptor of a T-cell hybrid require the immediate-early gene nur77. Nature 1994;367:281¨C284.
! O; R4 Z& W$ Z
Cohen LY, Bourbonniere M, Sabbagh L et al. Notch1 antiapoptotic activity is abrogated by caspase cleavage in dying T lymphocytes. Cell Death Differ 2005;12:243¨C254.5 J  C9 w7 K% N1 q2 V

Jehn BM, Bielke W, Pear WS et al. Cutting edge: Protective effects of notch-1 on TCR-induced apoptosis. J Immunol 1999;162:635¨C638.
3 A, ~) E' x8 m3 l
De Smedt M, Reynvoet K, Kerre T et al. Active form of Notch imposes T cell fate in human progenitor cells. J Immunol 2002;169:3021¨C3029.
6 i% Z. C# e; r. U9 |  B+ G& n
Samira S, Ferrand C, Peled A et al. Tumor necrosis factor promotes human T-cell development in nonobese diabetic/severe combined immunodeficient mice. STEM CELLS 2004;22:1085¨C1100.  o3 p" y6 ]9 E. E$ d# y7 @6 I

Zuniga-Pflucker JC, Di J, Lenardo MJ. Requirement for TNF-alpha and IL-1 alpha in fetal thymocyte commitment and differentiation. Science 1995;268:1906¨C1909.$ T6 n  _* q" w" w! p
2 ^1 `6 Z4 Q, I5 o* A8 r! K% Q
Janowska-Wieczorek A, Marquez LA, Dobrowsky A et al. Differential MMP and TIMP production by human marrow and peripheral blood CD34( ) cells in response to chemokines. Exp Hematol 2000;28:1274¨C1285.5 z* s! h7 [2 _# M- g0 R3 v
; K5 Q# Y' Q/ b) r+ p* w
Zheng Y, Watanabe N, Nagamura-Inoue T et al. Ex vivo manipulation of umbilical cord blood-derived hematopoietic stem/progenitor cells with recombinant human stem cell factor can upregulate levels of homing-essential molecules to increase their transmigratory potential. Exp Hematol 2003;31:1237¨C1246.0 s% x  K/ y& u2 Z' e( T1 K5 a

Pelus LM, Bian H, King AG et al. Neutrophil-derived MMP-9 mediates synergistic mobilization of hematopoietic stem and progenitor cells by the combination of G-CSF and the chemokines GRObeta/CXCL2 and GRObetaT/CXCL2delta4. Blood 2004;103:110¨C119.5 P9 Y8 H. c; m  T9 G
: Y, h/ o' ?9 r8 t* Q5 a% [
Mishra L, Derynck R, Mishra B. Transforming growth factor-beta signaling in stem cells and cancer. Science 2005;310:68¨C71.7 @& t8 y3 c- V$ p5 M5 G; a

Duncan AW, Rattis FM, DiMascio LN et al. Integration of Notch and Wnt signaling in hematopoietic stem cell maintenance. Nat Immunol 2005;6:314¨C322.
2 J6 I, C+ p2 F, G! y' ~' p0 e1 L
Basu S, Broxmeyer HE. Transforming growth factor-beta1 modulates responses of CD34  cord blood cells to stromal cell derived factor-1/CXCL12. Blood 2005;106:485¨C493.) H% r- o9 D$ M/ U. Y
( q/ q& a" h- V: R5 v$ [  D6 t
Hoffmann A, Levchenko A, Scott ML et al. The IkappaB-NF-kappaB signaling module: Temporal control and selective gene activation. Science 2002;298:1241¨C1245.  q* K! P4 r, O' b; T

Sanz L, Sanchez P, Lallena MJ et al. The interaction of p62 with RIP links the atypical PKCs to NF-kappaB activation. EMBO J 1999;18:3044¨C3053.
. g- C4 x5 }* z1 g1 B0 C3 L1 n/ V
Yeoh JS, van Os R, Weersing E et al. Fibroblast growth factor-1 and 2 preserve long-term repopulating ability of hematopoietic stem cells in serum-free cultures. STEM CELLS 2006;24:1564¨C1572.% C; b" f; z( N9 d. ?; V+ J
1 Y& p# U5 I9 w, _9 K4 M
Goyama S, Yamaguchi Y, Imai Y et al. The transcriptionally active form of AML1 is required for hematopoietic rescue of the AML1-deficient embryonic para-aortic splanchnopleural (P-Sp) region. Blood 2004;104:3558¨C3564.

Hay RT, Vuillard L, Desterro JM et al. Control of NF-kappa B transcriptional activation by signal induced proteolysis of I kappa B alpha. Philos Trans R Soc Lond B Biol Sci 1999;354:1601¨C1609.* m3 Q2 [# c- X! ]& F; i

Mauro C, Pacifico F, Lavorgna A et al. ABIN-1 binds to NEMO/IKKgamma and co-operates with A20 in inhibiting NF-kappa B. J Biol Chem 2006;281:18482¨C18488.
: W/ ~+ p) e  P5 U' W) L( \
Gur H, Krauthgamer R, Bachar-Lustig E et al. Immune regulatory activity of CD34  progenitor cells: Evidence for a deletion-based mechanism mediated by TNF-alpha. Blood 2005;105:2585¨C2593.& Y, \- l" b9 Z  Q' r5 |: J; O

Schramm C, Huber S, Protschka M et al. TGFbeta regulates the CD4 CD25  T-cell pool and the expression of Foxp3 in vivo. Int Immunol 2004;16:1241¨C1249." m8 W/ Z1 s6 o

Modi WS, Bergeron J, Sanford M. The human MIP-1beta chemokine is encoded by two paralogous genes, ACT-2 and LAG-1. Immunogenetics 2001;53:543¨C549.
4 w4 J/ X9 g8 \. q
Lu J, Honczarenko M, Sloan SR. Independent expression of the two paralogous CCL4 genes in monocytes and B lymphocytes. Immunogenetics 2004;55:706¨C711.

Giron-Michel J, Caignard A, Fogli M et al. Differential STAT3, STAT5, and NF-kappaB activation in human hematopoietic progenitors by endogenous interleukin-15: implications in the expression of functional molecules. Blood 2003;102:109¨C117.
/ z- a& W6 j. o/ y
Gigant C, Latger-Cannard V, Bensoussan D et al. Quantitative expression of adhesion molecules on granulocyte colony-stimulating factor-mobilized peripheral blood, bone marrow, and cord blood CD34  cells. J Hematother Stem Cell Res 2001;10:807¨C814.

收藏0 分享0 顶0 踩0