|

- 积分
- 0
- 威望
- 0
- 包包
- 0
|

Service de Néphrologie, Fondation pour Recherches Médicales, Geneva, Switzerland/ `. c b5 k/ S- s/ ?
+ s4 s% }" z/ \% T) H
ABSTRACT
0 k- d) T0 a: z. }# \9 C# A( X+ j; n, ?4 h) Z
Arginine-vasopressin (AVP) stimulates Na transport and Na-K-ATPase activity via cAMP-dependent PKA activation in the renal cortical collecting duct (CCD). We investigated the role of the Na-K-ATPase in the AVP-induced stimulation of transepithelial Na transport using the mpkCCDc14 cell model of mammalian collecting duct principal cells. AVP (10–9 M) stimulated both the amiloride-sensitive transepithelial Na transport measured in intact cells and the maximal Na pump current measured by the ouabain-sensitive short-circuit current in apically permeabilized cells. These effects were associated with increased Na-K-ATPase cell surface expression, measured by Western blotting after streptavidin precipitation of biotinylated cell surface proteins. The effects of AVP on Na pump current and Na-K-ATPase cell surface expression were dependent on PKA activity but independent of increased apical Na entry. Time course experiments revealed that in response to AVP, the cell surface expression of both endogenous Na-K-ATPase and hybrid Na pumps containing a c-myc-tagged wild-type human 1-subunit increased transiently. Na-K-ATPase cell surface expression was maximal after 30 min and then declined toward baseline after 60 min. Immunoprecipitation experiments showed that PKA activation did not alter total phosphorylation levels of the endogenous Na-K-ATPase -subunit. In addition, mutation of the PKA phosphorylation site (S943A or S943D) did not alter the time course of increased cell surface expression of c-myc-tagged Na-K-ATPase in response to AVP or to dibutyryl-cAMP. Therefore, stimulation of Na-K-ATPase cell surface expression by AVP is dependent on PKA but does not rely on 1-subunit phosphorylation on serine 943 in the collecting duct principal cells.+ o) Z5 i, j' c( k! [; P0 [
; n8 R3 H6 G. h" N
cell surface expression; sodium reabsorption; epithelial sodium channel& Z' k) L: q. I) Y9 P
+ Q4 I( I/ X+ ^! c) G, r+ I
TO FACE LARGE QUANTITATIVE variations of dietary Na intake, renal Na reabsorption is tightly controlled by hormonal and nonhormonal factors. The fine-tuning of Na reabsorption allowing the final adjustment of urinary Na excretion with respect to Na intake and extrarenal losses takes place along the collecting duct (CD). In this segment, Na reabsorption is performed by principal cells in which Na enters via the luminal epithelial Na channel (ENaC) and is extruded by the basolateral Na-K-ATPase. The Na-K-ATPase, which provides the driving force for active Na and K transport, and secondary active transport of other solutes, is tightly regulated both on the long term via alteration of the expression of its subunits and on the short term via changes in enzymatic turnover and/or redistribution between cell surface and intracellular compartments (18).$ J) K2 n Y0 e8 G8 M3 z8 y
. C6 Q* j z+ rArginine-vasopressin (AVP) is one of the major hormones that stimulate Na reabsorption in the CD. AVP exerts its effect by binding to V2 receptors located in the basolateral membrane of principal cells, resulting in activation of the Gs/adenylyl cyclase system, increased intracellular cAMP concentration, and PKA activation (18). The effect of AVP on Na transport is mediated by stimulation of both apical Na entry through ENaC (23, 30) and basolateral Na exit through Na-K-ATPase (16, 17). We previously showed that cAMP, the major second messenger of AVP, stimulates Na-K-ATPase activity via increased cell surface expression in CD principal cells (21). The Na-K-ATPase cell surface recruitment in response to cAMP may either directly rely on PKA activation or depend on increased intracellular concentration of Na following ENaC activation. Indeed, increasing intracellular Na concentration triggers the recruitment of functional Na-K-ATPase units to the basolateral membrane of CD principal cells (2, 9, 33).+ s! c! z5 S8 m3 Q3 i
- X7 E6 a/ e& dPhosphorylation of the Na-K-ATPase -subunit by protein kinases is one of the major mechanisms of short-term control of Na pump activity (18). PKA phosphorylation of the Na-K-ATPase 1-subunit on serine 943 (S943) has been demonstrated both in vitro using purified Na-K-ATPase preparations in the presence of detergent (19) and in vivo in transiently transfected COS-7 cells overexpressing the Na-K-ATPase 1-subunit (3, 20). Experiments performed in rat proximal convoluted tubules (11) and thick ascending limbs of Henle (26) revealed that stimulation of Na-K-ATPase activity was correlated with increased phosphorylation level of the Na-K-ATPase -subunit, although not necessarily at S943, in response to cell-permeant cAMP analogs. Indeed, in these studies performed in isolated rat tubules phospho-peptide mapping of the Na-K-ATPase -subunit phosphorylation site has not been done. Together, these observations raised the question of the role of phosphorylation of the Na-K-ATPase 1-subunit on S943 in the stimulatory effect of PKA on Na-K-ATPase activity." L- }3 ]+ n! J& G: N
/ q$ o/ f C! q. Y3 ^! j6 x4 MThe aims of the present study were to determine whether stimulation of Na-K-ATPase activity participates in the AVP-induced stimulation of transepithelial Na transport by CD principal cells and to study the role of increased intracellular Na concentration and/or phosphorylation of the Na-K-ATPase in this process. To answer these questions, experiments were performed using an immortalized mouse cortical CD principal cell line (mpkCCDcl4 cells). The mpkCCDc14 cell line retains expression of CD principal cell-specific Na and water transporters such as ENaC and aquaporin-2, as well as transepithelial Na transport controlled by aldosterone and vasopressin (4, 22, 33). The results of this study demonstrate that AVP stimulates Na-K-ATPase independently of increased intracellular Na concentration and phosphorylation of the Na-K-ATPase 1-subunit on S943.
/ Y5 u; O( t) M# r* A% |% F8 l+ B6 Q
MATERIALS AND METHODS
G* D' W* `* p' I) w9 p6 v
& }5 J# R+ x: v, j2 cCell culture. mpkCCDc14 cells (passages 22-30) were grown in DH medium (DH: DMEM:Ham*s F12 1:1 vol/vol, 60 nM sodium selenate, 5 μg/ml transferrin, 2 mM glutamine, 50 nM dexamethasone, 1 nM triiodothyronine, 10 ng/ml epidermal growth factor, 5 μg/ml insulin, 20 mM D-glucose, 2% vol/vol fetal calf serum, and 20 mM HEPES, pH 7.4) at 37°C in a 5% CO2-95% air atmosphere. Experiments were performed using confluent cells seeded on polycarbonate filters (Transwell, 0.4-μm pore size, 1-cm2 growth area, Corning Costar, Cambridge, MA). Cells were kept for 6–8 days in DM and then placed in serum-free, hormone-deprived DM 24 h before experiments.6 Z% A8 G. P3 V8 E6 G" O) P I
" x& z$ H3 e# _
Measurement of ouabain-sensitive 86Rb uptake. The transport activity of Na-K-ATPase was measured by the ouabain-sensitive 86Rb uptake under conditions of initial rate, as previously described (21). Confluent mpkCCDc14 cells were preincubated for 60 min at 37°C in serum-free, hormone-deprived DM with or without addition of 2 mM ouabain to the basal compartment. Cells were then incubated in the absence or presence of 10–9 M basolateral vasopressin for 15 min. Then, the transport activity of Na-K-ATPase was determined in quadruplicate samples after the addition of 50 μl of medium containing tracer amounts of 86RbCl (100 nCi/sample; Amersham) for 3 min. Incubation was stopped by cooling on ice, rapid aspiration of the incubation medium in the two compartments, and three washes with an ice-cold solution containing 150 mM choline-chloride, 1.2 mM MgSO4, 1.2 mM CaCl2, 2 mM BaCl2, and 5 mM HEPES, pH 7.4. Cells were lysed in 750 μl of Triton X-100 1% (wt/vol), and the radioactivity was measured by liquid scintillation on 400-μl samples. Protein content was determined in parallel by using the bisinchoninic acid assay (BCA; Pierce). The ouabain-sensitive 86Rb uptake was calculated as the difference between the mean values measured in quadruplicate samples incubated with or without 2 mM ouabain and was expressed as picomoles of Rb per microgram of protein per minute.
5 g" @% y3 X n, w3 S1 d+ g
- S- A- B$ f9 e% @- }Electrophysiological measurements. Confluent mpkCCDcl4 cells grown on Snapwell filters (0.4-μm pore size, 12-mm diameter, Corning Costar) were transferred to a Ussing chamber and short-circuit current (Isc) was measured under voltage clamp (0 mV) using dual silver-silver chloride electrodes connected to a VCC MC6 voltage-clamp apparatus (Physiological Instruments, San Diego, CA). The transepithelial Na transport was measured as the amiloride-sensitive Isc as previously described (34). Cells were equilibrated for 30 min at 37°C in serum- and hormone-free culture medium bubbled with 95% O2-5% CO2 before addition or not of 10–9 M AVP for another 30-min period of time. Incubation was terminated after addition of 10–6 M amiloride to the apical side of the chamber to measure the amiloride-resistant Isc. The amiloride-sensitive Isc reflecting transepithelial Na transport was calculated as the total Isc minus the amiloride-resistant Isc. The Na pump current was measured as described previously (31). Cells were equilibrated in low-Na medium (10 mM Na gluconate, 106 mM K gluconate, 1.8 mM CaCl2, 1.6 mM MgCl2, 0.8 mM KH2PO4, 2 mM D-glucose, 12 mM essential amino-acids, 2 mM nonessential amino acids, 0.4 mM glutamine, 25 mM HEPES, 3 mM BaCl2, pH 7.4) bubbled with 95% O2-5% CO2. The incubation medium contained Ba2 which blocks K channels and thereby reduces background K current. After 15-min equilibration at 37°C, 10–9 M AVP was added or not 5 min before apical membrane permeabilizion with 50 μg/ml amphotericin B for 10 min in the continuous absence or presence of AVP. The Na-K-ATPase was activated by apical and basolateral addition of high-Na medium (116 mM Na gluconate, 10 mM K gluconate, 1.8 mM CaCl2, 1.6 mM MgCl2, 0.8 mM KH2PO4, 2 mM D-glucose, 12 mM essential amino acids, 2 mM nonessential amino acids, 0.4 mM glutamine, 25 mM HEPES, 3 mM BaCl2, pH 7.4) to raise apical and basolateral Na concentrations to 80 mM which maximally activate Na pump current (data not shown). In some experiments, we determined the apparent Na affinity of Na-K-ATPase. For this purpose, the extracellular Na concentration was increased step by step from 20 to 80 mM, as previously described (31). After a 5-min stabilization period, 10–5 M amiloride was added to the apical medium to assess complete permeabilization of the apical membrane and after an additional 30 s, 2 mM ouabain was added to the basolateral medium to completely inhibit Na pump current. The ouabain-sensitive Isc reflecting Na pump-mediated current was calculated as the total Isc minus the ouabain-resistant Isc. By convention, positive Isc corresponded to a flow of positive charges from the basal to the apical solution. Results were expressed as microamperes per square centimeter.: ]% P( X- M( t! _) }. o
0 n7 e& D s: F; |9 j
Measurement of cell surface Na-K-ATPase. Cell surface proteins were labeled using EZ-Link sulfo-NHS-SS-biotin (Pierce, Rockford, IL) and precipitated by streptavidin-agarose beads (Immunopure immobilized streptavidin, Pierce) as previously described (21). After resuspension in sample buffer, samples were processed for 7% SDS-PAGE, and proteins were electrotransferred to polyvinylidene difluoride membranes (Immobilion-P; Millipore, Waters, MA). The endogenous Na-K-ATPase -subunit was revealed by Western blotting with a polyclonal antibody raised against the rat holoenzyme (10) and the exogenous c-myc-tagged human Na-K-ATPase 1-subunit was detected by a monoclonal anti-c-myc antibody (clone 9E10, Sigma). Antigen-antibody complexes were detected by enhanced chemiluminescence (ECL; Amersham Pharmacia Biotech). The protein bands were quantified using a video densitometer and the ImageQuant software (Molecular Dynamics, Sunnyvale, CA).4 D/ J$ ], b% T! E* A, k/ @
* K; c4 A. q! n
Measurement of Na-K-ATPase -subunit phosphorylation. Cells were labeled during 2 h at 37°C in serum- and hormone-free culture medium containing 100 μCi/ml [32P]orthophosphoric acid (Amersham Pharmacia Biotech) before incubation for 30 min at 37°C in the presence or absence of 10–3 M dibutyryl-cAMP. Cell lysis and immunoprecipitation were performed as described previously (10). Briefly, aliquots of 200 μg protein were incubated overnight at 4°C with saturating amounts of rabbit polyclonal anti-Na-K-ATPase antibody and protein A-sepharose beads (Amersham Pharmacia Biotech). Proteins were separated by 7% SDS-PAGE, electrotransferred to polyvinylidene difluoride membranes (Immobilion-P; Millipore), and subjected to autoradiography. The autoradiograms were quantified using a video densitometer and the ImageQuant software (Molecular Dynamics).! e- o: W( g+ V9 b
: l5 [0 l+ v8 a4 ~4 D
DNA constructs and transfection. The cDNA encoding the human Na-K-ATPase 1-subunit (accession number D00099) subcloned in pSD5 vector (a kind gift of Dr. G. Crambert, Institute of Pharmacology and Toxicology, University of Lausanne, Switzerland) was tagged by addition of a c-myc epitope (AAAEQKLISEEDL) directly after the start codon. The linearized pSD5 vector containing the human 1-subunit (h1-PSD5) was used as a template for PCR using the forward oligonucletide primer GGAAGTGACCATGGCAGCAGCAGAACAAAAGTTGATATCAGAAGAAGACTTATTAATCGGGAAGGGGGTTGGACGTGATAAG and the reverse oligonucletide primer GTTCTGCTGCTGCCATGGTCACTTCCGGGCGAGCTCGAATTCCGTG. AccI and SacI restriction sites were used to introduce c-myc-tagged DNA fragment into h1-PDS5 vector. The cDNA coding for the c-myc-tagged human Na-K-ATPase 1-subunit was then introduced into the peGFP-N1 vector (Clontech, Palo Alto, CA) using SacI and NotI restriction sites and thereby deleting the sequence coding for the enhanced green fluorescent protein (h1-pEGFP-N1). The linearized h1-pEGFP-N1 vector was used as a template for mutants generated by PCR. Serine 943 was substituted either by alanine (S943A) using the forward primer CCAGGAGGAATGCAGTCTTCCAGCAGG and the reverse primer CCTGCTGGAAGACTGCATTCCTCCTGG or by aspartic acid (S943D) using the forward primer CCAGGAGGAATGACGTCTTCCAGCAGG and the reverse primer CCTGCTGGAAGACGTCATTCCTCCTGG. The full-length wild-type and mutant c-myc-tagged human 1-subunits were sequenced to verify the absence and presence of phosphorylation site mutation, respectively. Cells suspended in serum- and hormone-deprived defined medium (2 x 106 cells) were electroporated (300 mV and 960 μF) using a Bio-Rad Gene Pulser and transfected with plasmids encoding c-myc-tagged wild-type or mutant (S943A and S943D) human Na-K-ATPase 1-subunit. Experiments were performed using confluent cells grown on Transwell filters (Costar) for 5 days after electroporation. Control experiments with eGFP reporter gene have shown that more than 70% of cells were transfected (data not shown).
( A" W; ~$ X+ [7 }9 p9 a4 u" |
; U! }9 o0 V6 D/ iStatistics. Statistical analysis of Na pump currents was done by unpaired Student*s t-test or by ANOVA for comparison of two or more than two groups, respectively. Statistical analysis of Na-K-ATPase 1-subunit immunoreactivity was done using the Mann-Whitney U-test or the Kruskal-Wallis test for comparison of two or more than two groups, respectively. The results are expressed as means ± SE from n independent experiments. Each experiment was performed with cells from one passage. A P value
; C1 F% U) N7 u, n+ H
( x# e% a3 L# I A4 h/ y, FRESULTS* ~( }* v. T; r, ?/ [
/ W1 W5 l j- k! Y! t' l9 B9 [AVP stimulates Na-K-ATPase activity in mpkCCDcl4 cells. We first measured the effect of AVP on transepithelial sodium transport taken as the amiloride-sensitive Isc. Results show that that addition of 10–9 M AVP to the basal medium rapidly stimulated the amiloride-sensitive Isc (Fig. 1A) with an approximately twofold increase after 30-min incubation (Fig. 1B). In addition, we measured the effect of AVP on the ouabain-sensitive 86Rb uptake, which is directly proportional to the Na-K-ATPase-mediated Na efflux and represents an indirect measurement of transcellular Na transport. Confluent mpkCCDcl4 cells were incubated for 15 min at 37°C in the absence or presence of 10–9 M AVP before measurement of the ouabain-sensitive 86Rb uptake. As previously shown in response to cell-permeant cAMP analogs, AVP stimulated the ouabain-sensitive 86Rb uptake by about twofold with respect to untreated cells (as pmol Rb ﹞μg protein–1﹞min–1 ± SE; control: 22.98 ± 4.33; AVP: 44.48 ± 8.41; n = 4). This effect was specific as the ouabain-insensitive 86Rb uptake was not altered by AVP (as pmol Rb ﹞μg protein–1﹞min–1 ± SE; control: 5.95 ± 0.88; AVP: 5.94 ± 1.06; n = 4). Therefore, AVP stimulates transepithelial Na transport through a transcellular route in cultured mpkCCDcl4 cells.8 c' W: F! |; i
/ u7 @, t; J5 d: eThe ouabain-sensitive 86Rb uptake assay does not discriminate between functional activation of the Na pump by intracellular Na concentration vs. regulatory changes in Na-K-ATPase activity or number of active units. To discriminate between these two possibilities, we measured the effect of AVP on the Na pump current in cells apically permeabilized to monovalent cations by amphotericin B to control intracellular Na concentration. After equilibration at 37°C in low-Na medium, confluent mpkCCDcl4 cells were incubated for 15 min with or without 10–9 M AVP before apical permeabilization with amphotericin B. As shown by Fig. 1C, the addition of high-Na medium to apically permeabilized cells, increasing Na concentration from 10 to 80 mM, induced a large stimulation of Isc, which was insensitive to 10 μM amiloride. This result confirms that Na entry through ENaC was not rate limiting for transepithelial Na transport in apically permeabilized cells. The Na -induced Isc was due to Na pump activation as it was inhibited by 2 mM ouabain, a specific inhibitor of the Na pump, and the basolateral K conductance had been blocked by Ba2 . Treatment of mpkCCDcl4 cells with AVP significantly stimulated the maximal Na pump current by 49% with respect to untreated cells (Fig. 1D), while AVP did not alter the apparent Na affinity of Na-K-ATPase (as mmol Na ± SE; control: 25.38 ± 3.05; AVP: 21.06 ± 2.5; n = 6). Therefore, as previously demonstrated in isolated rat cortical CDs, AVP stimulates the maximal Na-K-ATPase activity in cultured mpkCCDcl4 cells.8 f& Y- U$ m, B2 Z: ?: Q. @8 A
) W. C5 |) y3 I* b: z1 h/ iAVP increases Na-K-ATPase cell surface expression. Because stimulation of maximal Na-K-ATPase activity by AVP may rely either on increased cell surface expression of active Na pumps or on altered intrinsic properties of the enzyme, we measure the effect of AVP on Na-K-ATPase cell surface expression in mpkCCDcl4 cells. Confluent cells were incubated for 10 to 60 min at 37°C in the absence or presence of 10–9 M AVP before biotinylation, streptavidin-agarose precipitation of cell surface proteins, and Western blot analysis. Figure 2 shows that AVP induced a time-dependent increase in Na-K-ATPase cell surface expression which was statistically significant after 10 min and maximal after 30-min incubation at 37°C. However, the effect of AVP was transient as Na-K-ATPase cell surface expression returned to basal levels after 60-min incubation at 37°C in the continuous presence of 10–9 AVP. These results indicate that increased Na-K-ATPase cell surface expression may account, at least in part, for stimulation of maximal Na-K-ATPase activity by AVP in mpkCCDcl4 cells.
3 |* _# S, {" l% }& i& g: b
8 Y% X$ S3 c1 \6 ]* C/ N) q lStimulation of Na-K-ATPase activity and cell surface expression by AVP are PKA dependent. Because in renal cells most effects of AVP are mediated via V2 receptors which activate the cAMP/PKA signaling pathway (18), we assessed the PKA dependency of the AVP-induced stimulation of Na-K-ATPase activity and cell surface expression in mpkCCDcl4 cells. Confluent cells grown on filters were mounted in Ussing chambers and preincubated in low-Na medium for 30 min at 37°C with or without 10–6 M H89 before addition or not of 10–9 M AVP for 15 min and subsequently the apical membrane was permeabilized by amphotericin B. Figure 3A shows that H89 alone did not significantly alter the maximal Na pump current measured after addition of high-Na medium while it prevented the AVP-induced stimulation of Na pump current. Similarly, preincubation of confluent mpkCCDcl4 cells with 10–6 M H89 for 30 min at 37°C prevented the increase in Na-K-ATPase cell surface expression induced by 15-min incubation with 10–9 AVP (Fig. 3B). These results suggest that AVP stimulates Na-K-ATPase activity and cell surface expression through PKA activation in mpkCCDcl4 cells.
2 ]- ]5 t O) C+ O
: y3 r6 W3 @8 X# O9 e6 BAVP-induced Na-K-ATPase cell surface recruitment is independent of ENaC. AVP increases the number of functional ENaC in the apical membrane of CD principal cells and therefore enhances cellular Na influx (30). Increasing intracellular Na concentration induces Na-K-ATPase cell surface recruitment in isolated rat CD and in cultured mpkCCDcl4 cells (35). Therefore, the increase in Na-K-ATPase cell surface expression observed in response to AVP could have been secondary to enhanced apical Na influx. Figure 4 shows that preincubation of mpkCCDcl4 cells for 30 min with 10–5 M amiloride, which fully inhibits ENaC activity (data not shown), did not prevent the Na-K-ATPase cell surface recruitment induced by incubation of cells for 15 min in the presence of 10–9 M AVP. Therefore, the increase in Na-K-ATPase cell surface expression in response to AVP is independent of apical Na entry in mpkCCDcl4 cells.
* b8 f3 j9 {5 {6 r: h1 |# X( W5 D3 m4 g% b$ x0 `; R
AVP-induced Na-K-ATPase cell surface recruitment is independent of phosphorylation of the 1-subunit on serine 943. Phosphopeptide mapping (19) and site-directed mutagenesis (3, 20) identified S943 as the single potential PKA phosphorylation site on Na-K-ATPase 1-subunit. Experiments performed in rat renal proximal tubules revealed that PKA activations leads to both increased Na-K-ATPase -subunit phosphorylation level and cell surface expression (11, 12). However, phosphorylation of S943 in response to PKA activation remains to be demonstrated in nontransfected cells. Because the AVP-induced cell surface recruitment was dependent on PKA activity, we first studied the effect of stimulation of PKA activity on the total phosphorylation level of the Na-K-ATPase -subunit in mpkCCDcl4 cells. After metabolic labeling of the cellular ATP poll by [32P]orthophosphate, cells were incubated for 30 min at 37°C in the presence of 10–3 M dibutyryl-cAMP, a direct activator of PKA. Results showed that PKA activation did not significantly increase the total phosphorylation level of immunoprecipitated -subunit (Fig. 5A). This result may indicate that 1) the Na-K-ATPase -subunit is not phosphorylated by PKA; 2) PKA phosphorylation is masked by the high level of background phosphorylation by other protein kinases; or 3) PKA phosphorylates the Na-K-ATPase -subunit on S943 but concomitantly induces dephosphorylation of other(s) sites via activation of protein phosphatase 2A (PP2A) (8). Therefore, we specifically investigated the role of phosphorylation of the 1-subunit on S943 in the AVP-induced Na-K-ATPase cell surface recruitment. For this purpose, mpkCCDcl4 cells were transiently transfected with wild-type c-myc-tagged human Na-K-ATPase 1-subunit, or with its serine-to-alanine (S943A) or to-aspartic acid (S943D) mutant which abolishes or mimics phosphorylation, respectively. After biotinylation and streptavidin-agarose precipitation of cell surface proteins, c-myc-tagged 1-subunits were specifically detected by Western blotting using a monoclonal c-myc antibody (9E10). Figure 5B shows that the time course of AVP-dependent cell surface expression of hybrid Na pumps containing the wild-type c-myc-tagged 1-subunit was similar to that of endogenous Na pumps (see Fig. 2). AVP significantly increased the cell surface expression of wild-type c-myc-tagged 1-subunits after 10-min incubation, and the maximal effect was reached after 30 min. Cell surface expression of Na-K-ATPase declined but remained higher than control levels in cells further incubated for 60 min. The time course of AVP-dependent cell surface expression of c-myc-tagged 1-subunits harboring either the S943A or S943D mutation was similar to that of wild-type 1-subunits (Fig. 5B). Therefore, the control of Na-K-ATPase cell surface expression by AVP is independent of phosphorylation of the 1-subunit on S943.$ S2 b6 N; h9 r I: @+ V% f; d
, X" L8 ^+ C W$ O
To further assess that cAMP acting downstream of AVP controls cell surface Na-K-ATPase recruitment, we measured the effect of dibutyryl-cAMP, a cell-permeant cAMP analog, on the cell surface expression of Na-K-ATPase in mpkCCDcl4 cells transiently expressing either c-myc-tagged wild-type or phosphorylation site mutant (S943A or S943D) human 1-subunits. Results showed that cell surface expression of c-myc-tagged 1-subunits containing either wild-type or phosphorylation site mutant (S943A or S943D) 1-subunits exhibited a similar pattern in response to 10–3 M dibutyryl-cAMP (Fig. 6). Moreover, the time courses of AVP- and cAMP-dependent Na-K-ATPase cell surface expression were very similar. Together, our results indicate that AVP and cAMP lie along the same signaling pathway leading to cell surface recruitment of Na-K-ATPase and this effect is independent of phosphorylation of the 1-subunit on S943, i.e., the single identified PKA site.
& }5 C7 J& {- g+ ~ L1 ?7 ~! k5 I) O7 n# D8 I5 |7 s& t) M' z
DISCUSSION
0 {3 b0 E) @. |, l$ l
: n0 i* P4 L PThe present study provides evidence that AVP stimulates Na-K-ATPase activity through recruitment of silent Na pump units to the plasma membrane of CD principal cells. The effect of AVP on Na-K-ATPase is independent of increased apical cellular Na entry. While AVP-induced recruitment of cell surface Na-K-ATPase is dependent on PKA activity, this effect is independent of PKA phosphorylation of the Na-K-ATPase 1-subunit.. {( J7 k s" A
' T4 P. U2 h3 m8 p2 h1 cIt is generally believed that apical Na entry through ENaC is the rate-limiting step for Na reabsorption by CD principal cells. According to this point of view, it has been suggested that stimulation of Na-K-ATPase activity by hormones relies on a functional control via increased intracellular Na concentration which is also the major rate-limiting factor of Na-K-ATPase activity in intact cells (13). Results of the present study indicate that stimulation of Na-K-ATPase activity by AVP does not rely on increased intracellular Na concentration. Indeed, the effect of AVP was observed after apical membrane permeabilization by amphotericin B that allows the equilibration of intra- and extracellular Na concentrations and prevents variations of intracellular Na concentration (see Fig. 1, C and D). Such coordinated control of apical Na entry and basolateral exit limits variations of intracellular Na concentration that may alter the driving force for Na entry. This is especially important in CD, where luminal Na concentration is low and therefore any increase in intracellular Na concentration would strongly reduce the electrochemical gradient that drives apical Na entry. In addition, increasing intracellular Na concentration induces a feedback inhibition of ENaC that would further reduce Na reabsorption (25).2 A& U& Y5 \9 n0 m
2 `1 O% q; E' ~) C$ e# [1 l
Our results show that the extent by which AVP stimulates the maximal Na pump current (50%) was about one-half of the stimulation of the ouabain-sensitive 86Rb uptake (100%). Because ouabain-sensitive 86Rb uptake measures the actual pumping rate of Na-K-ATPase and because the apparent affinity of the Na-K-ATPase is not altered by AVP, our results imply that approximately one-half of ouabain-sensitive 86Rb uptake stimulation relies on a functional activation of the Na-K-ATPase, most likely secondary to increased intracellular Na concentration mediated by increased Na influx through ENaC. Therefore, the increase in transcellular Na transport in response to AVP (1) is mediated, in part, by an increased number of active Na pumps and in addition relies on the functional activation of Na pumps by intracellular Na .
$ {; H3 U' y0 ?, B0 U: V; t& y2 p( c; g( s: P: h
Increasing intracellular Na concentration by incubation in the absence of extracellular K or in the presence of a Na ionophore (nystatin or amphotericin B) induces a fast increase in maximal activity and cell surface expression of Na-K-ATPase in isolated rat CCDs (2, 9, 35) and in cultured mouse mpkCCDcl4 cells (34, 35). Results of the present study show that blocking apical Na entry via ENaC by amiloride did not prevent the increase in Na-K-ATPase cell surface expression in response to AVP in mpkCCDcl4 cells. Our results are in agreement with a previous study performed in lung alveolar cells showing that PKA activation by isoproterenol, a -adrenergic agonist, increases plasma membrane expression of Na-K-ATPase independently of Na entry via ENaC (7). Hence, the cell surface recruitment of silent Na-K-ATPase units in response to AVP is most likely independent of increased intracellular Na concentration. It is interesting to mention that high intracellular Na concentration leads to increased Na-K-ATPase cell surface expression through cAMP-independent PKA activation (35). Taken together with the PKA dependence of the AVP-induced recruitment of Na pumps, our results indicate that PKA is a major regulator of cell surface expression of active Na-K-ATPase units in CD principal cells. The precise mechanism of this PKA-dependent increase in Na-K-ATPase cell surface expression remains to be elucidated. This recruitment of Na-K-ATPase may be explained by fusion of intracytoplasmic vesicles with the basolateral membrane, as previously shown in response to dopamine in lung alveolar epithelial cells (6). Alternatively, the possibility of opening of sequestered membrane compartments should be considered and has been recently described for the adhesion molecule PECAM in endothelial cells (28). M/ o' z# I N2 ~
& q3 a# f1 b* k m' F
Our results show that the AVP-induced increase in Na-K-ATPase activity and cell surface expression are dependent on PKA activity, raising the question of the role of the previously described PKA phosphorylation of the Na pump (3, 5, 19, 20). However, the physiological relevance of PKA phosphorylation of the Na-K-ATPase remains highly debated. Several studies using purified Na-K-ATPase preparations (19) and transfected cells (3, 20) indicated that the Na-K-ATPase -subunit can be phosphorylated by PKA on S943, which constitutes the single conserved consensus PKA site. However, except for one study (15), in vitro phosphorylation of purified Na-K-ATPase by PKA requires the presence of detergent, which may improve the accessibility of the -subunit S943 (5, 14, 19). While phosphorylation of transfected rat Na-K-ATPase 1-subunit in response to PKA activation was prevented by substitution of S943 by alanine in COS-7 cells, phosphorylation of S943 has not been demonstrated in nontransfected cells. In addition, structural analysis revealed that the S943 consensus PKA site is very close to the membrane and, being partially buried by adjacent loops under native conformation of Na-K-ATPase, this site might be inaccessible to PKA (32). Moreover, PKA phosphorylation of the Na-K-ATPase -subunit was reported to either inhibit (5, 20), stimulate (15), or not alter (15, 19) Na-K-ATPase activity. Our results show that the total level of phosphorylation of the Na-K-ATPase -subunit is unchanged in response to PKA activation. Furthermore, the time course and the extent of the effects of AVP or cAMP on cell surface recruitment of hybrid pumps containing either wild-type or S943 mutants (S943A and S943D) are similar when expressed in a cell line that exhibits the major functional properties of CD principal cells. This result strongly suggests that S943 does not control the cell surface expression of Na-K-ATPase. One limitation of the interpretation of our transfection studies may be the presence of functional hetero-multimeric Na-K-ATPase units. Indeed, we cannot formally exclude that phosphorylated endogenous Na-K-ATPase -subunits carry associated c-myc-tagged mutant 1-subunits to the plasma membrane. While early studies concluded that the minimal functional unit is an - protomer (24), the monomeric or oligomeric nature of the functional Na-K-ATPase unit is not yet fully established. Recent evidence either suggests that plasma membrane - protomers of Na-K-ATPase are mostly monomeric (29) or oligomeric (27). It should be mentioned that in transfected cells, c-myc-tagged 1-subunits are overexpressed and compete with endogenous -subunits for limiting - subunits. Hence, under these conditions of overexpression, the heteromultimeric Na-K-ATPase complexes should contain primarily exogenous c-myc-tagged 1-subunits. Therefore, PKA phosphorylation of the Na-K-ATPase 1-subunit, if present to some extent, is very unlikely involved in the control of the cell surface expression of Na-K-ATPase in renal epithelial cells. The increase in Na-K-ATPase -subunit phosphorylation observed in response to PKA activation in renal cells (11, 26) might be accounted for by PP2A inhibition (8) rather than direct PKA phosphorylation. Hence, PKA may rather phosphorylate and modulate the function of accessory regulatory factors involved in the control of cell surface expression of Na-K-ATPase.5 N; [) A5 O7 e( w0 b' O2 v
1 x; `+ Q0 w* s3 }) X( F' G; R9 [
In conclusion, our results show that the stimulation of Na reabsorption by AVP relies, in part, on a PKA phosphorylation-independent stimulation of Na-K-ATPase activity in CD principal cells. This mechanism might be important in protecting cells against the adverse effects of Na overload.8 o2 e' w+ P B7 a
1 ]4 l! V- V5 z) w6 QGRANTS+ H8 {, C( y; o. p, S
8 o$ a* x! C1 M2 b" Q' W
This work was supported by Swiss National Foundation for Science Grant 3100–067878.02 and by a grant from the Carlos et Elsie De Reuter Foundation to E. Féraille.
0 E9 V9 m. s1 I1 N; Q j5 Y6 a% K0 D
1 m# N. X( `5 O/ e$ I- VFOOTNOTES
% J3 N6 p$ |) e4 R# C* ]& d5 {* b2 F- m- `
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.2 |$ U9 L$ `3 o$ n0 v
2 d( ?7 s: b5 } ?1 V
REFERENCES! D5 P( x! y- a/ }4 {. u" l) j
) |' S* s* |' j- G0 B0 J- hAuberson M, Hoffmann-Pochon N, Vandewalle A, Kellenberger S, and Schild L. Epithelial Na channel mutants causing Liddle*s syndrome retain ability to respond to aldosterone and vasopressin. Am J Physiol Renal Physiol 285: F459–F471, 2003.
7 [- _6 f: d/ K( f0 t
% |# k& x- @; E2 D$ xBarlet-Bas C, Khadouri C, Marsy S, and Doucet A. Enhanced intracellular sodium concentration in kidney cells recruits a latent pool of Na-K-ATPase whose size is modulated by corticosteroids. J Biol Chem 265: 7799–7803, 1990.
5 b% o) G" A7 e: f
8 Z! M8 M5 W3 D2 k jBéguin P, Beggah AT, Chibalin AV, Burgener-Kairuz P, Jaisser F, Mathews PM, Rossier BC, Cotecchia S, and Geering K. Phosphorylation of the Na-K-ATPase -subunit by protein kinase A and C in vitro and in intact cells. Identification of a novel motif for PKC-mediated phosphorylation. J Biol Chem 269: 24437–24445, 1994.: o( ]+ `0 B: m3 p
k+ H/ n9 X4 b& k4 hBens M, Vallet V, Cluzeaud F, Pascual-Letallec L, Kahn A, Rafestin-Oblin ME, Rossier BC, and Vandewalle A. Corticosteroid-dependent sodium transport in a novel immortalized mouse collecting duct principal cell line. J Am Soc Nephrol 10: 923–934, 1999.
& n& ~( z% Q$ p% N' D q0 q$ L, ]9 k. w+ y7 O5 H$ ^
Bertorello AM, Aperia A, Walaas SI, Nairn AC, and Greengard P. Phosphorylation of the catalytic subunit of Na -K -ATPase inhibits the activity of the enzyme. Proc Natl Acad Sci USA 88: 11359–11362, 1991.6 f8 b/ `! d% a8 O, T6 h
6 i3 O9 ^7 w: _2 M0 a) hBertorello AM, Komarova Y, Smith K, Leibiger IB, Efendiev R, Pedemonte CH, Borisy G, and Sznajder JI. Analysis of Na ,K -ATPase motion and incorporation into the plasma membrane in response to G protein-coupled receptor signals in living cells. Mol Biol Cell 14: 1149–1157, 2003.
6 S$ Q& B4 M, k" G
, ]% ^, r; S- P6 b; ]Bertorello AM, Ridge KM, Chibalin AV, Katz AI, and Sznajder JI. Isoproterenol increases Na -K -ATPase activity by membrane insertion of -subunits in lung alveolar cells. Am J Physiol Lung Cell Mol Physiol 276: L20–L27, 1999.
+ d, @* L9 b; A: v) W% n% @: b
: V% X7 u; t/ pBlot-Chabaud M, Coutry N, Laplace M, Bonvalet JP, and Farman N. Role of protein phosphatase in the regulation of Na -K -ATPase by vasopressin in the cortical collecting duct. J Membr Biol 153: 233–239, 1996.* ?3 \+ D7 f$ E' i
5 P7 u% p/ a/ Z# c8 ?# b# h1 t4 tBlot-Chabaud M, Wanstok F, Bonvalet JP, and Farman N. Cell sodium-induced recruitment of Na-K-AtPase pumps in rabbit cortical collecting tubules is aldosterone dependent. J Biol Chem 265: 11676–11681, 1990.
0 P- D$ W* O% z; [$ Q1 ~1 E7 [& U' P( A0 D4 W
Carranza ML, Féraille E, and Favre H. Protein kinase C-dependent phosphorylation of the Na ,K -ATPase -subunit in rat kidney cortical tubules. Am J Physiol Cell Physiol 271: C136–C143, 1996.
1 E+ l9 c4 ^. C& e% M. c
* D% Z% P: R6 a# `8 h% E5 DCarranza ML, Féraille E, Kiroytcheva M, Rousselot M, and Favre H. Stimulation of ouabain-sensitive 86Rb uptake and Na ,K -ATPase -subunit phosphorylation by a cAMP-dependent signalling pathway in intact cells from rat kidney cortex. FEBS Lett 396: 309–314, 1996.
+ N3 b/ S. ^/ j+ Q
& L" M8 y/ C/ _Carranza ML, Rousselot M, Chibalin AV, Bertorello AM, Favre H, and Féraille E. Protein kinase A induces recruitment of active Na ,K -ATPase units to the plasma membrane of rat proximal convoluted tubule. J Physiol 511: 235–243, 1998.
' X& W0 Q' [9 ?* x7 h7 P! @4 n D" q: r1 W) V) Y5 H x( k
Cheval L and Doucet A. Measurement of Na-K-ATPase-mediated rubidium influx in single segments of rat nephron. Am J Physiol Renal Fluid Electrolyte Physiol 259: F111–F121, 1990.
; j3 G" l+ P" @5 |* I9 K& W; ]) ^
Chibalin AV, Vasilets LA, Hennekes H, Pralong D, and Geering K. Phosphorylation of Na-K-ATPase -subunits in microsomes and in homogenates of Xenopus oocytes resulting from the stimulation of protein kinase A and protein kinase C. J Biol Chem 267: 22378–22384, 1992./ p1 i$ i6 X8 w( a4 w
9 {: q' a1 M& Y' kCornelius F and Logvinenko N. Functional regulation of reconstituted Na-K-ATPase by protein kinase A phosphorylation. FEBS Lett 380: 277–280, 1996.
# m# ?. s3 g6 m$ V% _* D4 j9 P! |. Y B9 v4 B+ Z6 S
Coutry N, Farman N, Bonvalet JP, and Blot-Chabaud M. Synergistic action of vasopressin and aldosterone on basolateral Na -K -ATPase in the cortical collecting duct. J Membr Biol 145: 99–106, 1995.6 V6 s* s. E$ O% w: Y5 _% u
?% k5 X( ^! G. }
Desch那nes G, Gonin S, Zolty E, Cheval L, Rousselot M, Martin PY, Verbavatz JM, Féraille E, and Doucet A. Increased synthesis and AVP unresponsiveness of Na-K-ATPase in collecting duct from nephrotic rats. J Am Soc Nephrol 12: 2241–2252, 2001.
9 }$ Y8 i2 N7 f& t
" D5 D' q* E. O* T$ [. R) yFéraille E and Doucet A. Sodium-potassium-adenosinetriphosphatase-dependent sodium transport in the kidney: hormonal control. Physiol Rev 81: 345–418, 2001.! H% o: q6 W# j
. r% J" A/ @/ t! z/ _0 D, \Feschenko MS and Sweadner KJ. Conformation-dependent phosphorylation of Na-K-ATPase by protein kinase A and protein kinase C. J Biol Chem 269: 30436–30444, 1994.
" W, Q. r* X8 z' o& D- r* _2 Y" w7 ^) f4 J
Fisone G, Cheng SXJ, Nairn AC, Czernik AJ, Hemmings, HC Jr, Hg JO, Bertorello AM, Kaiser R, Bergman T, Jrnvall H, Aperia A, and Greengard P. Identification of the phosphorylation site for cAMP-dependent protein kinase on Na ,K -ATPase and effects of site-directed mutagenesis. J Biol Chem 269: 9368–9373, 1994.
% }5 Z- y% e. x& S* W( z) _, \) {3 ~. ?$ @ K
Gonin S, Desch那nes G, Roger F, Bens M, Martin PY, Carpentier JL, Vandewalle A, Doucet A, and Féraille E. Cyclic AMP increases cell surface expression of functional Na-K-ATPase units in mammalian cortical collecting duct principal cells. Mol Biol Cell 12: 255–264, 2001./ S' g( M% Y$ P! m- n/ D
. ^, R2 R: B/ _: c- ~8 m$ Y% `Hasler U, Mordasini D, Bens M, Bianchi M, Cluzeaud F, Rousselot M, Vandewalle A, Féraille E, and Martin PY. Long term regulation of aquaporin-2 expression in vasopressin-responsive renal collecting duct principal cells. J Biol Chem 277: 10379–10386, 2002.
. y/ {+ J: K+ V6 D
; u4 \+ a" w2 X5 Y; l6 h& DHawk CT, Li L, and Schafer JA. AVP and aldosterone at physiological concentrations have synergistic effects on Na transport in rat CCD. Kidney Int 50: S-35–S-41, 1996.
7 U# t+ u" F e; `8 V
3 ` v. F. w+ Y* }! ?8 s$ R( @Jorgensen PL and Andersen JP. Structural basis for E1–E2 conformational transitions in Na-K-pump and Ca-pump proteins. J Membr Biol 103: 95–120, 1988.
6 K- Q- l( k9 p! v/ f3 C% V. ~, @6 s0 N- {4 a( k5 L9 u5 z6 W. b
Kellenberger S, Gautschi I, Rossier BC, and Schild L. Mutations causing Liddle syndrome reduce sodium-dependent downregulation of the epithelial sodium channel. J Clin Invest 101: 2741–2750, 1998.
. L3 d) ?* _' \2 E% }) u* G; g) W$ Q' Q [5 P+ s$ V$ F6 ~
Kiroytcheva M, Cheval L, Carranza ML, Martin PY, Favre H, Doucet A, and Féraille E. Effect of cAMP on the activity and the phosphorylation of Na ,K -ATPase in rat thick ascending limb of Henle. Kidney Int 55: 1819–1831, 1999.
8 }) q$ C8 d6 x* ?+ ?0 d" w8 H' Q9 g: Z ?
Laughery M, Todd M, and Kaplan JH. Oligomerization of the Na-K-ATPase in cell membranes. J Biol Chem 279: 36339–36348, 2004.: ~5 X7 [7 U6 ?6 p a8 Q
2 X. M1 S% n' A; x3 A8 kMamdouh Z, Chen X, Pierini LM, Maxfield FR, and Muller WA. Targeted recycling of PECAM from endothelial surface-connected compartments during diapedesis. Nature 421: 748–753, 2003.
2 e ^, z k! |1 A2 `
- z1 q& \8 @5 U2 @( o' x! [! aMartin DW, Marecek J, Scarlata S, and Sachs JR. - Protomers of Na ,K -ATPase from microsomes of duck salt gland are mostly monomeric: formation of higher oligomers does not modify molecular activity. Proc Natl Acad Sci USA 97: 3195–3200, 2000.
5 M$ D p6 D+ U) O/ W+ L5 A: {5 u1 J3 h J5 }
Schafer JA and Troutman SL. cAMP mediates the increase in apical membrane Na conductance produced in rat CCD by vasopressin. Am J Physiol Renal Fluid Electrolyte Physiol 259: F823–F831, 1990. }. H. l$ J" E) b: [
5 F# @# ^) G- H4 |; a9 JSumma V, Mordasini D, Roger F, Bens M, Martin PY, Vandewalle A, Verrey F, and Féraille E. Short-term effect of aldosterone on Na-K-ATPase cell surface expression in kidney collecting duct cells. J Biol Chem 276: 47087–47093, 2001.7 Q2 B, P3 Y J1 a
( N3 t$ ?' z O& a1 u7 gSweadner KJ and Feschenko MS. Predicted location and limited accessibility of protein kinase A phosphorylation site on Na-K-ATPase. Am J Physiol Cell Physiol 280: C1017–C1026, 2001.
9 o$ L4 u" b! f) U# j
6 l Q% G$ s P! M. Z+ h$ c1 `Vandewalle A, Bens M, and Van Huyen JPD. Immortalized kidney epithelial cells as tools for hormonally regulated ion transport studies. Curr Opin Nephrol Hypertens 8: 581–587, 1999.
* B1 F g; y% k1 l/ c9 L0 i* O) y4 ~9 V
Vinciguerra M, Arnaudeau S, Mordasini D, Rousselot M, Bens M, Vandewalle A, Martin PY, Hasler U, and Feraille E. Extracellular hypotonicity increases Na-K-ATPase cell surface expression via enhanced Na influx in cultured renal collecting duct cells. J Am Soc Nephrol 15: 2537–2547, 2004.
4 K/ i- |- C- _( X8 |; D2 @
6 L. d: I1 u: u7 _) ~Vinciguerra M, Desch那nes G, Hasler U, Mordasini D, Rousselot M, Doucet A, Vandewalle A, Martin PY, and Féraille E. Intracellular Na controls cell surface expression of Na-K-ATPase via a cAMP-independent PKA pathway in mammalian kidney collecting duct cells. Mol Biol Cell 14: 2677–2688, 2003.(David Mordasini, Mauro Bu) |
|