|

- 积分
- 0
- 威望
- 0
- 包包
- 0
|
Department of Medicine and Cardiovascular Research Center, University of Virginia, Charlottesville, Virginia" d& }. J9 N# t _# u4 R. R
+ G- X- L# ]6 _
ABSTRACT
; r) y) ?: ~0 n2 V2 G
c! N1 A9 n& N6 l8 x3 X! y0 bThe role of monocytes/macrophages in the pathogenesis of ischemia-reperfusion injury (IRI) is unknown. We sought to determine whether activation of macrophage adenosine 2A (A2A) receptors (A2ARs) mediates tissue protection. We subjected C57Bl/6 mice infused with clodronate [dichloromethylene bisphosphonate (Cl2MBP)] to IRI (32 min of ischemia followed by 24 h of reperfusion) to deplete them of macrophages. IRI induced an elevation of plasma creatinine that was reduced with Cl2MBP (26% of control). Adoptive transfer of murine RAW 264.7 cells reconstituted injury, an effect blocked significantly by A2A agonists (27% of plasma creatinine from mice reconstituted with macrophages). Macrophages subjected to A2A knockout by small interfering RNA were adoptively transferred to macrophage-depleted mice and reconstituted injury (110% of control mice); however, the increase in plasma creatinine was blocked by A2A agonists (20% of vehicle treatment). Finally, the A2A agonist effect on IRI was blocked in macrophage-depleted A2A-knockout mice reconstituted with wild-type RAW 264.7 cells. RNase protection assays 24 h after IRI demonstrated that macrophages are required for IL-6 and TGF- mRNA induction. However, A2A agonist-mediated tissue protection is independent of IL-6 and TGF- mRNA. We conclude that the full extent of IRI requires macrophages and that A2A agonist-mediated tissue protection is independent of activation of macrophage A2ARs.! S# g1 x; L' K- k
) k( m( Z+ k; i& ?. j8 u' q H: J
small interfering RNA; clodronate; adoptive transfer; inflammation; acute renal failure
. h: I2 g7 V3 k
6 w% O2 O$ X/ ]2 DTHE CASCADE OF EVENTS that ensues after ischemia-reperfusion (IR) involves endothelial cell dysfunction (35) and activation of bone marrow-derived cells that contribute to the downstream effects of an active inflammatory process, leading to tissue injury (3, 38). This process consists of the coordinated release of cytokines/chemokines by specific hematopoietic cells that contribute to medullary vascular congestion or cytotoxic injury to epithelial cells. Previous studies indicate that neutrophils play an important role in IR injury (IRI) (16, 28, 33); however, not all studies support their involvement (25, 39). More recently, a number of different studies directly or indirectly support the role of T cells in IRI (15, 18, 20) or demonstrate a causal relation between T cells and IRI (4)./ Q7 K) V. f8 W# \4 _/ f
6 ~7 B7 E6 h. v7 a( p# [2 o
The role of macrophages in IRI is unknown. The classical paradigm suggests that macrophages produce a destructive proinflammatory response, whereas more recent studies suggest that macrophages are responsible for restoration of normal function (for review see Ref. 17). In IRI, correlative evidence supports the pathogenic role of macrophages (10). Kidney IRI is associated with increased infiltration of monocytes/macrophages (5, 37) and an increase in monocyte chemotactic protein (MCP-1) (11, 34). Furthermore, in mice lacking CCR2, the receptor for MCP-1 expressed on macrophages, the magnitude of IRI is reduced (11). Although these results suggest that macrophages contribute to the proinflammatory response in mediating kidney IRI, further studies are warranted to determine a direct causal relation between macrophages and the destructive process of early IRI.1 ~: d8 K. {, O& n: x. Z4 S9 f
. V9 w7 w% E" |
Adenosine 2A (A2A) receptor (A2AR) agonists are potent inhibitors of inflammation and have been shown to decrease IRI by 70% when administered before or after ischemic insult (22–24), primarily through the activation of A2ARs expressed on bone marrow-derived cells (9). Because A2ARs are expressed on macrophages (12), their activation could be responsible for the protection observed after A2AR agonist administration to animals subjected to renal IRI.
2 ?" B" D# w3 C4 v3 y+ y4 i- D2 A# l; y$ f2 \5 b
The purpose of the present study was twofold: 1) to determine the contribution of macrophages to the early phase of renal IRI and 2) to determine the protective role of A2ARs expressed on macrophages in renal IRI. Toward this end, we depleted mice of macrophages and examined the effect of adoptive transfer of macrophages on renal IRI. Furthermore, we used small interfering RNA (siRNA) to silence the A2AR gene as well as A2AR-knockout (A2AKO) mice to isolate macrophage A2ARs and determine their role in IRI. Our results demonstrate that macrophages are necessary in mediating tissue injury from IR but do not contribute to the protective effect of A2ARs.
: {1 ?4 o# |* I* f9 I8 u7 M- O' S8 }8 @; i$ _8 w. K
METHODS9 `- E$ `3 G# G6 J1 E
4 t% L2 B0 P6 K7 r, q. t; b7 |6 k E
A2A agonists. Experiments were performed using A2A agonists, ATL-146e and ATL-303. ATL-146e has been previously characterized (30). To determine the relative potency of ATL-303, competitive binding assays were performed in HEK-293 cells transfected with A2ARs (31). Membranes were incubated with [125I]2-[2-(4-amino-3-iodophenyl)ethylamino]adenosine ([125I]APE, 0.3 nM), a selective A2A agonist radioligand, in the presence of competing concentrations (0.001 nM–100 μM) of ATL-303, ATL-146e, or CGS-21680 [2-(p-carboxyethyl)phenethylamino-5'-ethylcarboxamidoadenosine HCl;Research Biochemical, Natick, MA] for 2 h at 21°C. Four milliliters of ice-cold wash buffer (25 mM Tris﹞HCl, pH 7.2) were added to terminate the reaction, and the membranes were filtered through Whatman GF/C filters. Filters were washed twice with 4 ml of wash buffer. Bound radioactivity was determined by liquid gamma counting. Data were analyzed by nonlinear regression (GraphPAD Prism version 4.0, Graph PAD Programs, San Diego, CA). IC50 values were converted to Ki values by the following equation: Ki = IC50(Kd/L Kd), where L is the concentration of the radioligand and Kd is the equilibrium dissociation constant of the ligand.- ~% d# @8 p& r2 T. \6 a
& _5 X' ^/ P9 F7 s6 }Procedure for producing renal IRI. All animals were handled and procedures were performed in adherence to the National Institutes of Health Guide for the Care and Use of Laboratory Animals and with approval by the University of Virginia Animal Care and Use Committee. C57Bl/6 mice (7–8 wk of age, Charles River Laboratories, Wilmington, MA) and A2AKO mice (6–7 wks of age) (7, 9) were allowed free access to food and water until the day of surgery. Mice were anesthetized with ketamine (100 mg/kg ip), xylazine (10 mg/kg ip), and acepromazine (1 mg/kg im) and subjected to bilateral flank incisions as previously described (9). Both renal pedicles were cross-clamped for 32 min. Surgical wounds were closed with metal staples, and the mice were returned to cages for 24 h. After 24 h of reperfusion, animals were reanesthetized, blood was obtained by cardiac puncture, and kidneys were removed for various analyses.+ _5 I5 B: i2 ~# w0 S: L5 q
+ s b* M% r. i+ e. [Tissue culture. Mouse RAW 264.7 cells, a mouse monocyte/macrophage cell line established from ascites of a tumor induced in a male mouse by intraperitoneal injection of Abselon leukemia virus (A-MuLV; American Type Culture Collection, Manassas, VA), were cultured in high-glucose DMEM supplemented with sodium bicarbonate (0.075% wt/vol), L-glutamine, penicillin-streptomycin (1%), insulin (0.5 mg/ml), and 10% FBS in a humidified atmosphere of 5% CO2 at 37°C. Cells were grown on tissue culture plates, and medium was replaced every 3–4 days.
7 q( A, k }/ I1 x6 q9 s. e1 h/ z0 c0 u
Preparation of liposomes. Clodronate [dichloromethylene bisphosphonate (Cl2MBP)] liposomes (lipo-Cl2MBP) were prepared according to the method of van Rooijen et al. (40). Phosphatidylcholine [86 mg; egg lecithin (20 mg/ml) in chloroform] and cholesterol (8 mg; 8 mg/10 ml chloroform) were evaporated by rotation under reduced pressure (vacuum pump; Rotationsevaporator R-114, Buchi Labortechik, Flavil, Switzerland). A suspension of 2.5 g of Cl2MBP and 10 ml of PBS was stored under N2 for 2 h, sonicated, and stored overnight at 4°C. Liposomes were centrifuged for 30 min (10,000 g, 4°C) and resuspended in 4 ml of PBS before use.5 a# n0 E. [8 z# t d2 i0 R
* W$ E; d0 w" K3 o0 t I% N, I& pIn vivo depletion of monocyte/macrophages and adoptive transfer of RAW 264.7 cells. C57Bl/6 mice were anesthetized with ketamine (50 mg/kg ip), xylazine (5 mg/kg ip), and acepromazine (0.5 mg/kg im) before administration of lipo-Cl2MBP or RAW 264.7 cells. Cl2MBP (100 μl/10 g mouse) was injected via an internal jugular vein, and a second dose (100 μl/10 g mouse) was injected 48 h later; the control group was subjected to the same protocol, except liposomes containing PBS (lipo-PBS) were injected. At 96 h after the first dose, PBS, murine RAW 264.7 macrophages (108 cells), or siRNA-treated RAW 264.7 cells were injected intravenously, and the animals were subjected to IRI 5 h later. The experimental groups are summarized in Table 1.
- b" P& Z# u0 v' S$ U
; i$ n+ X3 O3 {* uView this table:/ K/ O( j3 g# D+ i
4 C" k; T' Q5 U C* Y7 U' w0 p! ~
Plasma creatinine and leukocyte counts. Plasma creatinine concentrations were determined using a colorimetric assay according to the manufacturer's protocol (Sigma Chemical, St. Louis, MO). Anticoagulated blood was analyzed for leukocyte counts (HEMAVET 850, CDC Technologies, Oxford, CT).
1 r5 c+ w9 U: I# M: ]. G }
+ c+ O E: b6 WsiRNA. Recombinant pSilencer (Ambion, Austin, TX) expressing A2AR-siRNA was constructed as follows. A 21-nt targeting sequence beginning with an AA dinucleotide, AAACTTCTTCGTGGTATCTCT, was designed from A2AR mRNA by Oligo 6 and BLAST in GCG. The hairpin siRNA template oligonucleotide was designed according to the manufacturer (Ambion): the sense strand sequence was 5'-gatc ccAC TTCT TCGT GGTA TCTC Tttc aaga gaAG AGAT ACCA CGAA GAAG Tttt tttg gaaa-3', and the antisense strand sequence was 5'-agct tttc caaa aaaA CTTC TTCG TGGT ATCT CTtc tctt gaaA GAGA TACC ACGA AGAA GTgg-3'. The sense and antisense strands were annealed to form a hairpin siRNA template insert and ligated into pSilencer 2.1-U6 neo using T4 DNA ligase. The pSilencer was amplified by transformation into competent Escherichia coli DH5 and confirmed by agarose gel electrophoresis after digestion with BamHI and HindIII. Three of the clones containing the 66-bp insert were sequenced to further confirm the recombinant pSilencer.
8 w3 [) R6 L4 [4 H% h; U3 u
" X6 p3 v+ T1 Y' YRAW 264.7 cells were plated into six-well plates (1 x 105 cells/well) 24 h before transfection. For each well, 20 μl of siPORT Amine (Ambion) were diluted to 394 μl with OPTI-MEM I and incubated at room temperature for 30 min. siRNA (0.2 nmol) was added to diluted siPORT Amine transfection solution and incubated at room temperature for 20 min. The volume of the transfection solution was diluted to 2 ml with RPMI-10% FBS and added to the cells. Cells were cultured for 24 h with an additional 1 ml of RPMI-10% FBS to optimize cell growth. At 48 h after transfection, the cells were washed with PBS and incubated with RPMI 1640 containing G418 at 500 mg/ml for the first 24 h, 250 mg/ml for another 24 h, and 200 mg/ml for the rest of the week. The cells were replated to flasks and ready for the functional and reconstitution studies.
" F' V. i4 Y8 Z" f* |; O0 A Z" k* ]1 N7 Q& M& K* |9 r1 t
A2AR functional assay. RAW 264.7 cells were cultured in 96-well plates (5 x 104/well), and the degree of A2AR modulation of TNF- release from activated cells was measured by ELISA. RAW 264.7 cells were incubated overnight with IFN- (1 nM), and on the following day, H2O2 (5 mM) was added for 30 min with or without ATL-303 (10 nM), a selective A2A agonist. To determine specificity, some cells were incubated with ATL-303 ZM-243185 (50 nM), a selective A2A antagonist (27). After 30 min of incubation, supernatants were subjected to ELISA for measurement of TNF- concentration according to the manufacturer's protocol (eBioscience, San Diego, CA). A similar protocol was followed for wild-type (WT) RAW 264.7 cells that were subjected to mock transfection and for WT RAW 264.7 cells that were transfected with recombinant pSilencer plasmid. Normalized data are presented to allow for comparisons of experiments on different days., ^% M! q8 ]6 ]9 u
( X- k7 m, p3 v- ?Histochemistry and immunohistochemistry. Kidneys and spleens were fixed in periodate-lysine-paraformaldehyde (4% paraformaldehyde) and embedded in paraffin, and 4-μm sections were cut. Sections were subjected to routine staining with hematoxylin and eosin and viewed by light microscopy (Zeiss AxioSkop).
' _* `! ]5 z# L* V9 x$ Q
J ~, b% k' y6 N, g2 ?9 J- kFor immunohistochemical studies, sections were subjected to antigen retrieval according to the manufacturer's protocol (Vector Laboratories, Burlingame, CA); then sections were incubated with a well-characterized rat anti-mouse monoclonal antibody to murine macrophages (F4/80, Serotec, Raleigh, NC; 1:1,000 dilution) and then with a biotinylated goat anti-rat secondary antibody. The peroxidase reaction was performed according to the manufacturer's protocol (Vectastain ABC Elite kit). Tissue sections were covered with an aqueous-based mounting solution consisting of p-phenylenediamine (1 mg/ml) and 70% glycerol, and coverslips were applied and affixed with nail polish. Sections were viewed under a Zeiss AxioSkop photofluorescence microscope. Photographs were taken with a SPOT RT camera (software version 3.3, Diagnostic Instruments, Sterling Heights, MI). Images were imported into Adobe Photoshop (version 3.0) for brightness/contrast adjustment. `% y9 U r/ p! Q3 ?6 \
- `. {5 h* J4 M1 ?/ p3 _$ X' }- _We quantified macrophages in the cortex and outer medulla 96 h after injection of liposomes containing Cl2MBP or PBS. Kidney regions were viewed at x200 magnification, and discrete immunoreactive cells were counted and averaged from 8–10 fields per mouse kidney.
* D" A% W; x+ Y6 x: f; r# D
8 a6 b( w5 E1 f9 z7 Y Q3 y BMultiprobe RNase protection assays. Total kidney RNA was extracted from homogenized tissue with RNAzol B (Leedo Medical Laboratories, Houston, TX) and analyzed by 1.5% agarose gel electrophoresis to assess the integrity of RNA before solution hybridization. Cytokine mRNA expression was assessed by the RiboQuant multiprobe RNase protection system (BD PharMingen) according to the manufacturer's protocol. Briefly, mRNA-specific RNA probes were labeled with [32P]UTP using multiprobe template sets (mCK3b, BD PharMingen) for cytokine genes. Kidney total RNA was subjected to solution hybridization with each probe set. Hybridization was performed at 56°C before RNase treatment. After RNase treatment, protected fragments were separated by gel electrophoresis on 5% polyacrylamide gels and exposed to Kodak X-Omat AR film at –70°C with a single intensifying screen.& F% C t1 @/ A! ]- C1 i
6 m% ?4 a: F" e; B" W! b5 r; O* P
Statistical analysis. Unpaired Student's t-test or one-way ANOVA followed by Tukey's post hoc analysis was used for all comparisons. P ) v$ ?2 B m% r2 B' w, d
! [# V6 q" Y: F9 BRESULTS
/ ^8 Q9 |7 w+ o! X) c! d- G: u; `+ I
Selective activation of A2ARs by ATL-303 in transfected HEK-293 cells. We examined the subtype selectivity and potency of a new A2A agonist, ATL-303, compared with our prototype A2A agonist, ATL-146e (30), and CGS-21680. Figure 1 shows the results of competitive binding experiments in membranes derived from HEK-293 cells transfected with human A2ARs. Ki values for ATL-303 and ATL-146e were similar (0.3 ± 0.07 and 0.6 ± 0.04 nM, respectively, n = 3) and significantly different from Ki values for CGS-21680 (4.9 ± 0.30 nM, n = 3, P * P* ]! p+ k5 C: [: r" B
, B7 l8 I% Y l) f0 g6 a! Q
Lipo-Cl2MBP reduces tissue macrophage infiltration. We administered liposomes containing PBS (lipo-PBS, group 1; Fig. 2, Aa and Ab) or Cl2MBP (lipo-Cl2MBP, group 2; Fig. 2, Ac and Ad) to mice and harvested the spleen and kidneys at 48 and 96 h to quantitatively examine the degree of macrophage depletion as determined by immunohistochemical localization of macrophages. At 96 h after lipo-PBS administration, macrophages are seen in the red pulp region of the spleen, a characteristic feature of the normal spleen (Fig. 2Aa), as well as in the kidney cortex (not shown) and outer medulla (Fig. 2Ab). In contrast, at 96 h after lipo-Cl2MBP administration, marked macrophage depletion is observed in the spleen (Fig. 2Ac) and cortex (not shown) and in the outer medulla (Fig. 2Ad). At 48 h, there was an intermediate degree of macrophage infiltration with less well-defined cell margins that represented degenerating macrophages (data not shown). In the renal cortex and outer medulla, lipo-Cl2MBP significantly reduced macrophage infiltration. Macrophage density (cell number/200 x field) was 16.9 ± 2.4 and 5.0 ± 1.4 in the cortex (n = 4, P # x6 q' H2 ?! D( p7 d) g
; E1 e$ ^6 F" b7 l/ wEffect of macrophages and A2AR activation on renal IRI. We next sought to determine the contribution of macrophages to IRI and the contribution of activated A2ARs expressed in macrophages to the protection observed with A2A agonists. Mice were injected with lipo-Cl2MBP to deplete macrophages, and the kidneys were subjected to 32 min of ischemia followed by 24 h of reperfusion. First, we characterized the effect of lipo-Cl2MBP on peripheral leukocyte counts, inasmuch as lymphocyte depletion and neutrophil depletion have been demonstrated to reduce renal tissue injury after IRI. Lipo-PBS and lipo-Cl2MBP had no significant effect on total peripheral white blood cell or leukocyte subset counts in mice subjected to IRI (Table 2).$ g9 _5 e0 f8 [. k5 V+ ^6 Y2 n
8 G; D9 f- T# p, `View this table:
( w9 T1 B3 H6 m" e+ O! {) h" E+ j* B. E" b T
Control mice treated with lipo-PBS (group 1) and subjected to renal IR showed a rise in plasma creatinine (1.34 ± 0.07 mg/dl, n = 10) that was reduced with ATL-146e (0.32 ± 0.25 mg/dl, n = 3, P
4 z1 `5 I. Y6 O5 j5 n% f, l4 i+ W/ J$ g4 W" |
To determine the effect of macrophages and A2A agonists on tissue histology in kidneys subjected to IRI, we stained kidney sections from groups 1–3. Renal IRI in control mice treated with vehicle (lipo-PBS, group 1) led to marked tubule necrosis in the outer medulla with obstructing tubule lumen and loss of epithelial cells in the S3 segment (Fig. 4A); ATL-146e led to preservation of the tubule epithelium (Fig. 4B). These results are similar to those previously reported (24). Kidneys from mice depleted of macrophages (lipo-Cl2MBP, group 2) and subjected to IRI demonstrated relatively well-preserved tubule epithelium of the S3 segment in the absence (Fig. 4C) or presence of ATL-146e (Fig. 4D). Adoptive transfer of WT RAW 264.7 cells into mice depleted of macrophages (WT RAW 264.7 M DEPL WT, group 3) reconstituted injury (Fig. 4E), and the effect was reversed with ATL-146e (Fig. 4F).
4 w* s' w) F0 z& H: |5 d: ?/ K* a- k2 f( a- ^( c) X
Protective effect of A2AR activation on renal IRI is independent of A2ARs expressed on macrophages. Next, we sought to establish the contribution of A2ARs expressed in macrophages to the protective effects of A2A agonists on IRI by silencing the A2AR gene in RAW 264.7 (A2AKO RAW 264.7) cells using siRNA and adoptively transferred the modified cells into mice previously depleted of macrophages (A2AKO RAW M DEPL WT, group 4). To verify that we successfully silenced the A2AR gene in macrophages, we used a functional assay for A2ARs and measured the effect of an A2A agonist on TNF- release from activated macrophages. Typically, A2A agonists block TNF- release from activated macrophages (13), an effect reduced in A2A siRNA-transfected RAW 264.7 cells. TNF- release (expressed as the fraction of control) after A2A agonist treatment of A2A siRNA-transfected, control siRNA-transfected, and untransfected RAW cells was 0.72 ± 0.010 (n = 4), 0.11 ± 0.06 (n = 3, P 7 D+ S W+ w0 |, w, E3 g
F* t0 z j& Q. V$ L o
WT C57Bl/6 mice were depleted of macrophages (lipo-Cl2MBP) and reconstituted with RAW 264.7 cells transfected with siRNAs to silence the A2AR gene (group 4). Plasma creatinine in WT mice reconstituted with A2A siRNA-transfected RAW 264.7 cells increased after IRI, an effect significantly reduced by ATL-146e (20% of control; Fig. 6A). Plasma creatinine for vehicle and ATL-146e was 1.46 ± 0.12 and 0.30 ± 0.014 mg/dl (n = 5, P % B) G; K0 H7 O
! Q& K. i7 B4 DTo confirm this finding, we depleted macrophages from A2AKO mice and adoptively transferred WT RAW 264.7 cells (WT RAW M DEPL A2AKO, group 5). In this manner, only the RAW 264.7 cells express A2ARs. In these mice, renal IR led to an increase in plasma creatinine after vehicle infusion, and ATL-146e had no protective effect (96% of control; Fig. 7A). Plasma creatinine was 1.40 ± 0.10 and 1.35 ± 0.07 mg/dl for vehicle and ATL-146e, respectively (P = not significant, n = 6). Corresponding histology demonstrated marked tissue injury of the outer medulla of vehicle-treated (Fig. 7B) and ATL-146e-treated (Fig. 7C) mice. These results further substantiate the previous findings and indicate that the protective effect of A2A agonists in IRI is due to action on bone marrow-derived cells other than macrophages.
7 Y2 }- {) i: N/ Y. g9 p, d# i% N- }0 R2 C
Effect of macrophages and macrophage A2AR on cytokine mRNA expression in IRI. We next examined the contribution of macrophages and macrophage A2AR activation to IRI-induced cytokine mRNA expression. As we showed previously (9), cytokine (including IL-6 and TGF-) mRNA expression increases after 32 min of ischemia followed by 24 h of reperfusion (Fig. 8). Macrophage depletion led to a marked reduction of IL-6 and TGF- mRNA expression. The increase in expression of these cytokine mRNAs requires macrophages, inasmuch as both transcripts are reduced after depletion and reconstituted after adoptive transfer of macrophages. Additionally, despite the tissue-protective effect of ATL-146e in A2AKO RAW 264.7 M DEPL WT mice, IL-6 and TGF- transcripts were not reduced. These results suggest that IL-6 and TGF- mRNA expression requires macrophages but does not mediate the tissue-protective effect of A2A agonists.
' W7 ` w* z, }( w
% U$ y( B" W, _ D" DDISCUSSION
n( I* F& ]9 y1 C% Z8 i) q1 Y% g: b( y" f! j
The present study was performed to determine the role of macrophages in IRI and the role of macrophage A2AR activation in mediating renal tissue protection after IRI. Our results provide direct evidence that macrophages play an important role in IRI in the kidney. Furthermore, despite the essential role that macrophages play in IRI, they do not mediate the tissue-protective effect of A2A agonists. Given our previous findings that A2ARs on bone marrow-derived cells are a critical target for A2A agonists in mediating tissue protection, our present studies suggest that A2A agonists target bone marrow-derived cells other than macrophages. Recent studies implicate T cells in the pathogenesis of IRI and lead us to conclude that T cells may likely be the target of A2A agonist-mediated tissue protection.
8 A }) l) E% C# j/ D* e1 d6 t
# a7 d: g5 F- H# w! a6 fRole of macrophages in IRI. Previous studies have implicated macrophages as participants in IRI; however, a causal relation between macrophages and IRI has yet to be reported (10). A number of studies have demonstrated that monocytes/macrophages (26, 37, 42), as well as macrophage-associated cytokines, such as IL-1, IL-6, and TGF- (37), and monocyte/macrophage chemoattractants, such as IFN -inducible protein-10, MCP-1, and macrophage inflammatory protein-2 (9, 19, 36), appear in the kidney within 2–5 days of IRI. The late appearance suggests the possibility that macrophages participate in the repair process after IRI (10). Other animal models provide some insight into the potential role of macrophages. In experimental uveitis, liposomal dichloromethylene-diphosphonate depleted macrophages and prevented leukocyte-endothelial cell interaction, thus providing evidence for the central role of macrophages in this form of inflammation (2). In arterial injury, macrophage depletion using liposomal clodronate reduced inflammation involved in neointimal hyperplasia (8). Taken together, these studies provide strong evidence for the role of macrophages in inflammation and renal IRI.
5 z( G, e) }8 e) a% t! [7 X' j( \1 p* x k
In a similar manner, we used macrophage depletion to determine the role of macrophages in renal IRI. We chose the non-nitrogen-containing bisphosphonate (Cl2MBP) to deplete macrophages from mice. This method has been used previously and has been found to effectively reduce macrophage lineage without affecting peripheral blood leukocytes (1, 32). In our studies, we found that lipo-Cl2MBP produced a significant reduction in IRI, a marked reduction of macrophages in spleen and kidney, and no change in peripheral blood leukocytes. In our studies, the peripheral monocyte count was slightly reduced with lipo-Cl2MBP (0.26 ± 0.05 vs. 0.20 ± 0.04 counts/μl), but this difference did not reach statistical significance. The absence of a difference in monocyte count may reflect a difference in phagocytosis of lipo-Cl2MBP by monocytes and tissue resident macrophages. To exclude other nonspecific effects of our experimental protocol, adoptive transfer of macrophages into macrophage-depleted mice markedly reversed the protective effect of macrophage depletion. Additional information can be obtained from RNase protection assays, which demonstrated a reduction of cytotoxic cytokines from kidneys of mice subjected to macrophage depletion. Thus these studies provide evidence for a strong causal relation between macrophages and early proinflammatory-mediated renal tissue injury. Although macrophages may participate in the repair process, our studies directly implicate them in the genesis of renal tissue injury after IR.+ o7 x0 O7 z9 m, @+ H
6 q' c; B8 R. G, ^Integrated action of macrophages and bone marrow-derived cells in mediating tissue injury. Several mechanisms may be involved in the protection from IRI produced by macrophage depletion. Our in vitro studies demonstrate that TNF- is secreted by macrophages robustly on activation. Marked attenuation of macrophage infiltration will reduce TNF- release locally and its direct cytotoxic effects on renal epithelial cells. In experimental uveitis, macrophage depletion with Cl2MBP reduced leukocyte rolling, arrest, and emigration, as well as plasma TNF- levels (2). Activation of macrophages requires exposure to IFN- (17). Because CD4 T cells are the primary hematopoietic cells that secrete IFN-, a reduction or attenuation of IFN- suggests that macrophages contribute to IRI through activation of CD4 cells with subsequent release of IFN-.
8 Z, t7 x6 ] x) j% h) _9 D
; P# J% P1 |7 a: ?1 bT cells are believed to contribute to IRI (4). In studies using adoptive transfer of T cells into T cell-deficient mice, CD4 cells were found to be key mediators of the neutrophil inflammatory response (4). In a warm IR model in which specific markers for inflammatory cells were used, ED1 cells (macrophages), CD4 T cells, and CD8 T cells have been identified in renal tissue (36). The T cell-derived cytokines, IFN-, IL-4, and IL-2, appear temporally with mononuclear cell infiltration (36). IR in CD4–/CD8– double-KO mice was associated with a reduction of neutrophil infiltration and injury (4). Additional evidence that suggests a role of T cells in renal IRI is derived from studies where blockade of the CD28-B7 costimulatory pathway reduces injury (36). Thus T cells may mediate tissue injury through coordinated actions with T cells, macrophages, and other bone marrow-derived cells. The coordinated action of T cells, neutrophils, and macrophages may be necessary to induce full expression of tissue injury after renal IRI.) U3 _# H E+ h$ V0 p% O, {, k
2 p! P# z* v `7 @: G6 C1 k* C/ y
Role of macrophage A2ARs in mediating A2A agonist-mediated tissue protection. A second goal of this study was to determine whether macrophages are the target of A2A agonist-mediated tissue protection. Our previous studies demonstrated that activation of A2ARs expressed on bone marrow-derived cells mediated renal tissue protection after IRI (9). In those studies, we lethally irradiated mice and repopulated the bone marrow of WT mice with marrow of A2AKO mice. In these chimeras, ATL-146e, an A2A agonist, lost its protective effect. In contrast, when marrow of WT mice was replaced with WT bone marrow, the protective effect was restored. These studies point to bone marrow-derived cells as the primary target of A2A action in mediating IRI. The present study extended these findings by examining whether A2A agonists mediate renal tissue protection via macrophage A2ARs. In macrophage-depleted mice, administration of A2A agonists did not provide an additional protective effect. In macrophage-depleted mice, A2A agonists provided tissue protection after reconstitution with WT macrophages or macrophages in which A2AR expression was attenuated. Finally, the absence of an A2A agonist-mediated protective effect in A2AKO mice was not restored by reconstitution with WT macrophages.
# |# h# T2 [& K9 h0 Q$ d5 M# K! w. S [: c0 U7 K8 M, w
IL-6 and TGF- are dependent on the presence of activated macrophages; however, their role in renal IRI is uncertain. Our data demonstrate that the protective effect of A2A agonists is not dependent on these cytokines. Proinflammatory, anti-inflammatory, and reparative processes have been described for IL-6 (14, 29, 41). TGF- has been implicated in inducing IRI (21) or reducing IRI in myocardial tissue (6). These results underscore the complex relation between these cytokines and injury.
7 T" ?: _8 g" b S2 D$ v' U
/ v% G+ \+ r! U$ KTogether, these studies provide direct insight into the pathogenic mechanisms of macrophages in IRI and the mechanism of tissue protection mediated by A2A agonists. Our studies demonstrate that macrophages play a critical role in mediating the full extent of IRI. Furthermore, these studies provide strong evidence that A2A agonist action in reducing IRI is independent of macrophages. Given previous studies that CD4 cells contribute importantly to IRI, it is likely that a coordinated action is necessary between bone marrow-derived cells to mediate IRI. Future studies will focus on the role of CD4 cells in mediating the tissue-protective effect of A2A agonists in IRI. We believe that, in addition to the therapeutic benefits that A2A agonists may have in future clinical trials, A2A agonists offer an incisive pharmacological tool to investigate the mechanism of IRI.6 k: x' b* J. B
9 C8 }3 F' L c- O. lGRANTS
! R# y5 @! d! F3 c+ {, `: A, F( J
This work was supported by National Institutes of Health Grants DK-56223, DK-58413, DK-62324, and HL-37942.. N' r: y# \" s& H, I: Y. o3 P$ e$ Y
- a9 m0 M! `( s+ ]ACKNOWLEDGMENTS
5 i5 ?4 S, S) K- I) _
# K3 f: q' T Y1 u( b. p0 PThe authors gratefully acknowledge Drs. Timothy Macdonald and Jayson Rieger (Dept. of Chemistry, University of Virginia) for the generous gift of ATL-146e and ATL-303, Melissa Marshall for assistance with siRNA experiments, and Jiang-Fan Chen (Dept. of Neurology, Boston University School of Medicine, Boston, MA) for A2AKO mice. The authors are grateful to Dr. Alaa Awad and Charles Sevigny III for helpful discussions and Dr. Diane Rosin for careful reading of the manuscript.
. q: _# u. F$ K+ Z# ~2 Z$ u! W
/ a; Q+ v; g w# Y$ h3 [- NPresent address of Y.-J. Day, Dept. of Anesthesiology, Chang Gung Memorial Hospital, Taipei, Taiwan.
) ?8 E2 F( f- ]/ N5 K( M& U! M$ Y
+ v, s8 y: c& cFOOTNOTES
! k9 R7 u/ o7 X+ U/ R3 f2 m: W/ |5 s5 n# ]; i: N
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.7 N& S; Q5 M5 I! c6 [
+ o O' }; m/ ?0 |! |7 R2 t
REFERENCES" E! Y% Y8 H* _0 k( t
/ |7 U1 J c1 u2 T( B1 `" N
Alves-Rosa F, Stanganelli C, Cabrera J, van Rooijen N, Palermo MS, and Isturiz MA. Treatment with liposome-encapsulated clodronate as a new strategic approach in the management of immune thrombocytopenic purpura in a mouse model. Blood 96: 2834–2840, 2000.
; V' d7 C) C F7 z& O/ d1 `* P* i h' h' [7 h4 [) F" u; Z( K$ E- v- d v
Baatz H, Puchta J, Reszka R, and Pleyer U. Macrophage depletion prevents leukocyte adhesion and disease induction in experimental melanin-protein induced uveitis. Exp Eye Res 73: 101–109, 2001.+ Z ^9 @, A1 r- K" D6 |( e) r$ L
0 i% A6 Z8 s$ \& [- L' A9 b
Bonventre JV and Weinberg JM. Recent advances in the pathophysiology of ischemic acute renal failure. J Am Soc Nephrol 14: 2199–2210, 2003.
& \& a8 l6 G2 ~5 B+ S3 |
8 B4 P2 A% {! {( o* K. yBurne MJ, Daniels F, El Ghandour A, Mauiyyedi S, Colvin RB, O'Donnell MP, and Rabb H. Identification of the CD4 T cell as a major pathogenic factor in ischemic acute renal failure. J Clin Invest 108: 1283–1290, 2001.
9 b/ T5 l5 b/ o9 U1 c u- f; v, ^; T1 p. j1 [1 l9 q6 D
Cao CC, Ding XQ, Ou ZL, Liu CF, Li P, Wang L, and Zhu CF. In vivo transfection of NF-B decoy oligodeoxynucleotides attenuates renal ischemia/reperfusion injury in rats. Kidney Int 65: 834–845, 2004." b% G: y$ h- o: s- i9 O
5 G% a0 P2 ^% B- n" ?Chen H, Li D, Saldeen T, and Mehta JL. TGF-1 attenuates myocardial ischemia-reperfusion injury via inhibition of upregulation of MMP-1. Am J Physiol Heart Circ Physiol 284: H1612–H1617, 2003.
+ d5 k* I: R! b+ i
# L" j0 o) m0 v/ X7 L2 f4 jChen JF, Huang Z, Ma J, Zhu J, Moratalla R, Standaert D, Moskowitz MA, Fink JS, and Schwarzschild MA. A2A adenosine receptor deficiency attenuates brain injury induced by transient focal ischemia in mice. J Neurosci 19: 9192–9200, 1999.3 V& d5 _- C1 a [2 b- _0 h
. w- O, }0 J* t$ \- yDanenberg HD, Fishbein I, Gao J, Monkkonen J, Reich R, Gati I, Moerman E, and Golomb G. Macrophage depletion by clodronate-containing liposomes reduces neointimal formation after balloon injury in rats and rabbits. Circulation 106: 599–605, 2002.
8 Z; P8 {' d: b& o8 E8 u% m+ h& N8 @1 w- r( T5 Q7 N( e* x
Day YJ, Huang L, McDuffie MJ, Rosin DL, Ye H, Chen JF, Schwarzschild MA, Fink JS, Linden J, and Okusa MD. Renal protection from ischemia mediated by A2A adenosine receptors on bone marrow-derived cells. J Clin Invest 112: 883–891, 2003.. X' S8 x, Y; T5 ^% L1 X* \
: C& k7 C9 p0 d" V7 K6 Z/ ~% KFriedewald JJ and Rabb H. Inflammatory cells in ischemic acute renal failure. Kidney Int 66: 486–491, 2004.
" W" }. M0 m% `5 M' K9 S& V5 |9 B+ V0 d1 \/ F
Furuichi K, Wada T, Iwata Y, Kitagawa K, Kobayashi K, Hashimoto H, Ishiwata Y, Asano M, Wang H, Matsushima K, Takeya M, Kuziel WA, Mukaida N, and Yokoyama H. CCR2 signaling contributes to ischemia-reperfusion injury in kidney. J Am Soc Nephrol 14: 2503–2515, 2003.
7 Y/ P) W, E% U, ?6 j# n- y$ n+ F' i: Z* Z Z0 n [
Gessi S, Varani KM, Ongini E, and Borea PA. A2A-adenosine receptors in human peripheral blood cells. Br J Pharmacol 129: 2–11, 2000.
3 \+ w7 v4 o3 E) L7 X0 B) g+ S, o2 m7 z! k: U" v! [9 _4 C
Hasko G, Kuhel DG, Chen JF, Schwarzschild MA, Deitch EA, Mabley JG, Marton A, and Szabo C. Adenosine inhibits IL-12 and TNF- production via adenosine A2a receptor-dependent and independent mechanisms. FASEB J 14: 2065–2074, 2000.& S" j8 H9 x5 P! j# N! ]4 n
+ z. ~) w# q7 n# \8 c# V
Heemann U, Szabo A, Hamar P, Muller V, Witzke O, Lutz J, and Philipp T. Lipopolysaccharide pretreatment protects from renal ischemia/reperfusion injury: possible connection to an interleukin-6-dependent pathway. Am J Pathol 156: 287–293, 2000.+ q2 S0 T) X" m' l6 P" y+ l4 |- x
9 Z4 C6 C3 M, @ A m7 {Horie Y, Chervenak RP, Wolf R, Gerritsen ME, Anderson DC, Komatsu S, and Granger DN. Lymphocytes mediate TNF--induced endothelial cell adhesion molecule expression: studies on SCID and RAG-1 mutant mice. J Immunol 159: 5053–5062, 1997.5 q5 n0 k7 m: i- ~
& h) A3 k4 r' G5 {0 ?, {' Y
Kelly KJ, Williams WW, Colvin RB, and Bonventre JV. Antibody to intercellular adhesion molecule 1 protects the kidney against ischemic injury. Proc Natl Acad Sci USA 91: 812–816, 1994.2 k3 r2 [/ e4 N
V# C) i; U5 p( t" l$ dKluth DC, Erwig LP, and Rees AJ. Multiple facets of macrophages in renal injury. Kidney Int 66: 542–557, 2004., B+ p+ \4 ? k
8 x$ A" x5 z. e% R! z xKokura S, Wolf RE, Yoshikawa T, Granger DN, and Aw TY. T-lymphocyte-derived tumor necrosis factor exacerbates anoxia-reoxygenation-induced neutrophil-endothelial cell adhesion. Circ Res 86: 205–213, 2000.
q+ b# F" O- i7 x
1 w: R0 E1 F3 f& h5 SLemay S, Rabb H, Postler G, and Singh AK. Prominent and sustained up-regulation of gp130-signaling cytokines and the chemokine MIP-2 in murine renal ischemia-reperfusion injury. Transplantation 69: 959–963, 2000.) M0 E- J5 g/ {' ?5 L
2 I) `0 k) w( R4 V/ ?Le Moine O, Louis H, Demols A, Desalle F, Demoor F, Quertinmont E, Goldman M, and Deviere J. Cold liver ischemia-reperfusion injury critically depends on liver T cells and is improved by donor pretreatment with interleukin 10 in mice. Hepatology 31: 1266–1274, 2000.+ U# @& w5 [9 j4 }4 ?
# X1 _; s1 P" B6 j3 x" ~
Ninova D, Covarrubias M, Rea DJ, Park WD, Grande JP, and Stegall MD. Acute nephrotoxicity of tacrolimus and sirolimus in renal isografts: differential intragraft expression of transforming growth factor-1 and -smooth muscle actin. Transplantation 78: 338–344, 2004.
- _! c) z" |* a3 k9 O$ ^% e+ {5 t, z! G+ h/ T
Okusa MD, Linden J, Huang L, Rieger JM, Macdonald TL, and Huynh LP. A2a-adenosine receptor-mediated inhibition of renal injury and neutrophil adhesion. Am J Physiol Renal Physiol 279: F809–F818, 2000.
8 U2 i( u: b6 w1 i$ ^6 a. Q) _/ Y$ I% L. K; m0 J- _5 Z
Okusa MD, Linden J, Huang L, Rosin DL, Smith DF, and Sullivan G. Enhanced protection from renal ischemia-reperfusion injury with A2A-adenosine receptor activation and PDE 4 inhibition. Kidney Int 59: 2114–2125, 2001.
' ?8 j& H7 g6 p+ j
& T' w; s) ?3 [3 H: o9 @" N" POkusa MD, Linden J, Macdonald T, and Huang L. Selective A2A-adenosine receptor activation during reperfusion reduces ischemia-reperfusion injury in rat kidney. Am J Physiol Renal Physiol 277: F404–F412, 1999.
) ?2 r2 s+ M' h- l
6 t$ \' R; ?/ l; s* {6 ~, `# L) LPaller MS. Effect of neutrophil depletion on ischemic renal injury in the rat. J Lab Clin Med 113: 379–386, 1989., s6 ~; |1 b; g4 f$ e4 u- z
) `* N R0 }$ h+ e. h+ `. V
Persy VP, Verhulst A, Ysebaert DK, De Greef KE, and De Broe ME. Reduced postischemic macrophage infiltration and interstitial fibrosis in osteopontin knockout mice. Kidney Int 63: 543–553, 2003.3 |* `" V# G7 O `: |
4 C8 ]' Q5 X0 L0 c9 n3 P+ {
Poucher SM, Keddie JR, Singh P, Stoggal SM, Caulkett PWR, Jones G, and Collis MG. The in vitro pharmacology of ZM 243185, a potent, non-xanthine, A2A-selective adenosine receptor antagonist. Br J Pharmacol 115: 1096–1102, 1995.+ H$ d# `& C6 M( B# f& `
5 w' g3 m4 F- V$ h) t4 h# M
Rabb H, O'Meara YM, Maderna P, Coleman P, and Brady HR. Leukocytes, cell adhesion molecules and ischemic acute renal failure. Kidney Int 51: 1463–1468, 1997.
, {& j* S4 u+ E2 `' I5 `! s4 ^& |7 j: L$ Y5 w) h" d1 Y
Riedemann NC, Neff TA, Guo RF, Bernacki KD, Laudes IJ, Sarma JV, Lambris JD, and Ward PA. Protective effects of IL-6 blockade in sepsis are linked to reduced C5a receptor expression. J Immunol 170: 503–507, 2003.
2 W( O3 ^' q9 O! b9 t. L
( G5 _2 J5 e/ c+ ]1 ?0 y3 mRieger JM, Brown ML, Sullivan GW, Linden J, and Macdonald TL. Design, synthesis, and evaluation of novel adenosine A2A receptor agonists. J Med Chem 44: 531–539, 2001.
5 K3 S4 D% j: B9 W0 U3 P7 s0 v; q7 _8 w
Robeva AS, Woodard R, Luthin DR, Taylor HE, and Linden J. Double tagging recombinant A1-A2A-adenosine receptors with hexahistidine and the FLAG epitope. Development of an efficient generic protein purification procedure. Biochem Pharmacol 51: 545–555, 1996.$ K3 ]+ m9 y4 m6 a1 D2 {4 N
- L; o! i3 Z7 I3 nShibazaki M, Nakamura M, Nitta Y, and Endo Y. Displacement of platelets from blood to spleen following intravenous injection of liposomes encapsulating dichloromethylene bisphosphonate. Immunopharmacology 39: 1–7, 1998.
$ z2 B6 W# z7 U) C
+ t* n; b3 Q1 {; [' u/ I+ Q* ISingbartl K, Green SA, and Ley K. Blocking P-selectin protects from ischemia/reperfusion-induced acute renal failure. FASEB J 14: 48–54, 2000.
& U3 P: s. O9 s$ `" |5 _" m& a- s5 |9 B5 G1 m
Sung FL, Zhu TY, Au-Yeung KK, Siow YL, and OK. Enhanced MCP-1 expression during ischemia/reperfusion injury is mediated by oxidative stress and NF-B. Kidney Int 62: 1160–1170, 2002., t* R; {1 C$ i% K- b# _
3 z6 L6 ~* {9 vSutton TA, Fisher CJ, and Molitoris BA. Microvascular endothelial injury and dysfunction during ischemic acute renal failure. Kidney Int 62: 1539–1549, 2002., i% N2 Q8 P+ X9 ?
0 G$ P+ r# v% J5 q
Takada M, Chandraker A, Nadeau KC, Sayegh MH, and Tilney NL. The role of the B7 costimulatory pathway in experimental cold ischemia/reperfusion injury. J Clin Invest 100: 1199–1203, 1997.7 A% c7 r. @& R4 C2 Z2 n7 e/ Y. a
* H" S- Y, Q4 W J w3 y7 ~
Takada M, Nadeau KC, Shaw GD, Maruette KA, and Tilney NL. The cytokine-adhesion molecule cascade in ischemia/reperfusion injury of the rat kidney. J Clin Invest 99: 2682–2690, 1997." ^2 w4 H5 d+ o$ v3 L1 N/ L
, W/ } T) b7 F/ F& _
Thadhani R, Pascual M, and Bonventre JV. Acute renal failure. N Engl J Med 334: 1448–1460, 1996.
1 r6 O" h; A9 s$ c2 v2 }+ d# ?3 E4 P! S, a4 O- j
Thornton MA, Winn R, Alpers E, and Zager RA. An evaluation of the neutrophil as a mediator of in vivo renal ischemic-reperfusion injury. Am J Pathol 135: 509–515, 1989.% N9 b, g& b0 u7 l
9 A4 @0 O6 u5 O# ^! G7 x# EVan Rooijen N and Sanders A. Liposome-mediated depletion of macrophages: mechanism of action, preparation of liposomes and applications. J Immunol Methods 174: 83–93, 1994.. s) F) \7 C8 }7 x8 W
5 t4 C. x3 V# _/ m/ b G E# [
Yokota N, O'Donnell M, Daniels F, Burne-Taney M, Keane W, Kasiske B, and Rabb H. Protective effect of HMG-CoA reductase inhibitor on experimental renal ischemia-reperfusion injury. Am J Nephrol 23: 13–17, 2003.
, ]; Y3 d; [) D( q/ h2 b+ t2 C! V
Ysebaert DK, De Greef KE, Vercauteren SR, Ghielli M, Verpooten GA, Eyskens EJ, and De Broe ME. Identification and kinetics of leukocytes after severe ischaemia/reperfusion renal injury. Nephrol Dial Transplant 15: 1562–1574, 2000.(Yuan-Ji Day, Liping Huang) |
|