|

- 积分
- 0
- 威望
- 0
- 包包
- 0
|

Department of Cellular and Integrative Physiology, University of Nebraska Medical Center, Omaha, Nebraska( ?! \; ` H* A9 E [5 ?. E4 K
2 l+ u! a# y6 E8 \/ M; VABSTRACT
) Y$ I* J; V; ~# m
) `8 i. I- r. O0 n% T( \Large, Ca2 -activated K channels (BK), comprised of - and -subunits, mediate K secretion during high flow rates in distal nephron segments. Because the BK-1 subunit enhances Ca2 sensitivity of BK in a variety of cells, we determined its role in flow-induced K secretion and its localization in the mammalian nephron. To determine the role of BK-1 in the kaliuretic response to volume expansion, the rate of K excretion (UKV) vs. varied urinary flow rates were determined in wild-type and BK-1 knockout mice (BK-1–/–). When flow rate was varied by volume expansion (2 ml﹞h–1﹞25 g body wt–1) for 30 to 60 min in wild-type mice, we found that the UKV increased significantly with increasing urine flow rates (r2 = 0.50, P 0 D! ~. I4 f9 F' s! \
- U0 A j# ^( \. w I& eMaxi K; distal nephron; flow-mediated K secretion( j# [/ T4 F# B0 Q" R
6 _6 n4 C+ i: p5 sRENAL K SECRETION IN MAMMALS and amphibians is stimulated by high flow rates through the distal nephron (53, 55, 58, 60). In mammals, the connecting tubule (CNT) (20, 55) and the early cortical collecting duct (CCD) (58, 59) are the major sites involved in flow-induced K secretion. In these segments, flow-induced K secretion permits the coupling of kaliuresis with diuresis so that the fractional excretion of K will be maintained or increased when glomerular filtration rate is elevated.
+ l- i4 T4 h0 Q9 ^- H1 X" `
7 ]) r& p' l2 k' h1 M; A2 w+ x1 R3 MIn the K secretory segments, which include the CNT (55) and the CCD (17, 18, 42), two different types of K channels, inward rectifying (Kir1.1 or ROMK) and large Ca2 -activated K channels (BK), have been observed in the apical membrane. Under basal conditions, renal K secretion is primarily mediated by ROMK. However, several recent studies suggest that K is secreted via BK in high flow conditions. Using isolated perfused tubules, investigators showed that BK contribute to flow-activated increases in K secretion in the CNT (55) and the CCD (59). Also, in support of this notion, it was found that K secretion is actually enhanced in ROMK–/– mice, which have defective loop transport and therefore high distal flow rates (30)., V; J _2 o+ P$ X
, T1 v+ @' j5 r
BK are comprised of pore-forming -subunits, which may also associate with accessory -subunits. Whereas the BK- subunit has a ubiquitous expression pattern, the -subunits are expressed in a tissue-specific manner with BK- subunits modulating BK activity as most appropriate for the tissue. For example, in neurons, where inhibiting BK activity enhances neurotransmitter release, the 4-subunit dampens the apparent voltage and Ca2 sensitivities of BK- (2, 7). In contrast, in vascular smooth muscle, the 1-subunit enhances the Ca2 sensitivity of BK, thereby enhancing the role of BK as a feedback regulator responding to elevated intracellular [Ca2 ] (7, 28, 33, 43). Thus the appropriate expression of a particular -subunit acts to fine tune the responsiveness of BK- to best fulfill its required function in each cell type.
7 \. Z3 P% C9 R) J# B* v3 {, r2 z) H& T( }' a' z- E
Studies have not yet identified accessory BK -subunits in nephron segments. However, we recently found that K excretion in response to volume expansion was attenuated in BK-1 null mice (BK-1–/–) (44). Because 1 serves to increase the apparent calcium sensitivity of BK- as well as the sensitivity to mediators such as cGMP (22), we hypothesized that 1 is localized in one of the distal nephron segments and plays a role in enhancing BK-mediated K secretion in response to increased flow rates.
8 j2 B9 h2 I- g* `" c, C
% [( P& j1 U9 v) \3 {) KMETHODS
4 a6 t5 y- b3 p+ d' c& W% W
; y! J6 @% M( m# E6 a& C: U NIn vivo K clearance studies. All experiments were performed under the guidelines of the animal care committee of the University of Nebraska Medical Center. Mice, null for BK-1 (BK-1–/–) with a homogeneous C57BL/6 background [generated by Brenner et al. (7)], and C57BL/6 control mice (BK-1 / ) of both sexes were used. The mice, which were 3 mo of age, received standard chow containing 0.4% NaCl and water ad libitum. General surgical and clearance procedures were performed as previously described by this laboratory (44) and others (57). After anesthetizing with Inactin (0.14 mg/g body wt), cannulas were inserted in the trachea, bladder, left jugular vein, and right carotid artery. Blood pressure was continually monitored. Physiological saline solution (PSS), containing (in mM) 135 NaCl, 5.0 KCl, 2.0 MgCl2, 1.0 CaCl2, 10 HEPES, and 10 mg/ml FITC-Inulin, was infused at a rate of 2.0 ml﹞h–1﹞25 g body wt–1. After a 1-h equilibration period, an 20-μl blood sample was taken and urine was then collected under mineral oil for a 30-min period. After this period, a second 20-μl blood sample was taken and then urine was collected for another 30-min period. For some mice, data could be obtained for only one 30-min period. After the last collection period, a larger blood sample was taken for the measurement of plasma [K ] and FITC-Inulin. Plasma and urine electrolytes were analyzed using a Instrumentation Laboratory 443 Flame Photometer. FITC-Inulin concentrations were analyzed using a Cary Eclipse Fluorescence Spectrophotometer (Varian) as previously described by us (44) and Lorenz and Gruenstein (29).
( I# A- f1 h$ N! ?
8 b% T1 b) v& e# [1 hImmunohistochemistry. Paraffin-embedded or frozen tissue sections from rabbits (killed for an unrelated project) or euvolemic mice were processed according to standard histochemical methods. Paraffin slides were washed in xylene before rehydration in a series of ethanol washes. Antigen retrieval and/or peroxidase quench steps were then performed when necessary, followed by permeabilization and blocking. The primary antibody/antibodies were incubated with the sections overnight, and the next day the sections were washed, incubated with the secondary antibody/antibodies, and washed again. Finally, chromagens were developed [alkaline phosphatase (AP) and/or horseradish peroxidase (HRP)] and the sections were counterstained. For frozen slides, the procedure was essentially the same except: 1) no xylene or ethanol washes were performed, 2) the section was fixed in acetone before the permeabilization step, and 3) fluorescent secondary antibodies were used, so no chromagen development or counterstaining was necessary.
* h) I6 E( v0 s( c" R- J, U; ]2 b+ Z3 l1 w4 N2 M- C9 z
Two different BK-1 primary antibodies were used in this study. It was found that antigen retrieval was required for a distinct signal with the Affinity Bioreagants (Golden, CO, rabbit, PA1–924) but not the Santa Cruz Biotechnology (Santa Cruz, CA, goat, sc-14749) antibody. The antibody from Affinity Bioreagants recognized mouse BK-1 but not rabbit BK-1, whereas the Santa Cruz Biotechnology antibody recognized both. The Affinity Bioreagants antibody was used to obtain the data represented in Figs. 3, 4, 5, B and C, and the Santa Cruz antibody for Figs. 5A, 7, 8, and 9. A chicken BK- antibody (59) was also used (Fig. 6). The BK- antibody used in Fig. 7 is from Santa Cruz Biotechnology (sc-14746).
& q {1 C4 \0 W5 l7 Q6 g6 y5 C- K9 }' [' K
To immunolocalize BK-1 to a particular region of the nephron, we took advantage of the specific distribution of transporters along the distal tubule. The scheme used for this localization in mouse is shown in Fig. 1A. The marker used for distal tubule was a Na-Cl cotransporter (NCC) antibody (rabbit) (6). To identify CNT, we used a Na/Ca exchanger (NCX) antibody (R3F1, mouse; Swant, Switzerland). In mouse, NCX is expressed in the latter half of the distal tubule as well as the CNT (8, 27). To identify CCD, we used an aquaporin-3 antibody (Santa Cruz Biotechnology, goat, sc-9885). By double staining histochemical sections for BK-1 and each of these three marker antigens, we were able to determine more precisely the location of BK-1 in the murine nephron. For double staining performed with rabbit sections, it is important to note that, in contrast to the mouse, NCX expression in the rabbit is restricted exclusively to the CNT (4, 8, 27) (Fig. 1B).' q* X' `+ m; n1 m8 S
8 b+ a/ G- m5 o/ M3 h( K9 L7 @Secondary antibodies used were: donkey anti-mouse-AP (sc-2316, Santa Cruz Biotechnology), donkey anti-goat-HRP (sc-2020, Santa Cruz Biotechnology), donkey anti-rabbit-AP (sc-2315, Santa Cruz Biotechnology), goat anti-rabbit F(ab')2-AP (sc-3838, Santa Cruz Biotechnology), goat anti-mouse F(ab')2-HRP (sc-3697, Santa Cruz Biotechnology), Alexa Fluor 594 donkey anti-rabbit (A21207 [GenBank] , Molecular Probes, Eugene, OR), and Alexa Fluor 488 donkey anti-goat (A11055 [GenBank] , Molecular Probes). Because BK-1 and NCC are both apical proteins, fluorescent secondary antibodies were used for the doublestaining of these two antigens.
$ x, f2 c8 K& @; K9 Q1 o, E2 v- L- G8 u! v( Y# o0 C* c
To determine whether (and to what extent) colocalization occurred between BK-1 and the marker antigen, we quantified the amount of colocalization by counting the number of stained tubules in multiple sweeps in a single direction across randomly selected areas of the section. Only tubules that stained for at least one of the antigens (BK-1 or marker antigen, such as AQP3) were counted. Data were recorded as number of tubules stained with only antigen A, only antigen B, or both antigens A and B. When quantifying fluorescent stains, a picture was taken with each filter and then merged to be certain whether colocalization occurred (x40 objective). This process was repeated, frame by frame, as the "sweep" across the section progressed. For colorimetric stains (HRP or AP), quantification was performed using the x100 oil objective. Bar graphs represent, as a percentage of total staining, the staining observed with "marker" antigen and BK-1 on the same tubule, and either one alone.# b' U+ b- y8 E# ?4 z4 H( }
0 a, v( o$ g/ D: K
BK-1 sequencing. Kidneys were obtained from rabbits that had been killed for an unrelated project. The kidney was rapidly removed from the animal and then placed in chilled saline solution for dissection. Several CNTs were isolated by stripping up from the medullary rays to heads at the top of the cortex as previously described (19, 56). Tubules were homogenized in Tri Reagent (Molecular Research Center, Cincinnati, OH) and RNA was isolated as described in the manufacturer's protocol. Following isolation, the RNA was reverse transcribed into first-strand cDNA using oligo(dT) primers and Superscript II (Invitrogen, Carlsbad, CA). PCR was then performed using Taq PCR Master Mix (Qiagen, Valencia, CA) and sequence-specific primers (forward: GGGGGTCAGGAAGAAAGAAA; reverse: CTGAGTGGAAACAGGCATCA). Primers were based on a previously published rabbit BK-1 sequence (accession no. AB009313) and bracketed the entire coding sequence of BK-1. The reaction conditions were as follows: 94°C 2:00; 40 cycles of 94°C 1:00, 59°C 1:00, 72°C 3:00; then 72°C 20:00; and hold at 4°C. After an aliquot of the PCR product was run on a gel to confirm the expected size (884 bp), the PCR product was cloned into the pCR2.1-TOPO vector (Invitrogen) using blue/white selection in the presence of ampicillin. Clones were analyzed by restriction enzyme digestion with EcoRI and two positive clones were sent to the Genomics Core Research Facility at the University of Nebraska at Lincoln to be sequenced using M13 Forward and Reverse Primers. The entire insert was sequenced at least two times, and the obtained sequence was submitted to GenBank as accession no. AY829265.
% T, C6 T- a j4 Q5 \$ m" n# v0 Y2 l/ W- e
Statistics. For the histochemistry summary data (Figs. 5 and 8), significance was determined by ANOVA with Student-Newman-Keuls (P $ s1 K4 I6 N, {
. u5 S8 c0 y# `. }$ f- {RESULTS
D' ]- Q4 V% l2 t- [5 M6 a% Q0 Z6 j
K handling under volume expanded conditions in wild-type and BK-1–/– mice. To determine the potential role of BK-1 in the flow-mediated increase in K secretion, we volume-expanded both wild-type and BK-1–/– mice and plotted their flow rates vs. urinary excretion of K (UKV) or FEK (%). As shown in Fig. 2, a significant correlation was found between urinary flow rate and K excretion for BK-1 / (P / Y- _* l3 K+ _# ?% R! I
2 |$ ?4 Z$ p" k% F8 |/ eImmunohistochemical localization of BK-1 in mouse distal nephron. If BK-1 has a role in K transport in the mammalian nephron, then apical expression in distal nephron segments would be expected. To address this, we used histochemistry to analyze kidney sections from wild-type mice for the presence and location of BK-1. As shown in Fig. 3A, BK-1 (red, AP) is expressed apically on tubular segments that have an appearance consistent with the distal nephron. No staining was observed in the absence of the primary antibody (not shown). In contrast to sections from wild-type mice, no staining was observed in renal sections taken from BK-1–/– (Fig. 3B); this absence of staining in BK-1–/– sections serves as a confirmation of the specificity of the antibody.
" F/ t \- r# y; ^6 i1 f! i- ]
/ F9 E( B/ Z$ G2 gDouble-staining experiments, using the antibodies identified in Fig. 1, were performed to determine the precise renal tubular location of BK-1. The various distal tubule segments of the mouse nephron were identified by antibodies against the NCC (distal tubule), the NCX (distal tubule and CNT), and aquaporin-3 (AQP3; CCD). Figure 4 shows that BK-1 exhibited strong apical staining in segments that also had intense NCX staining (brown, HRP) in the basolateral membrane. However, BK-1 colocalization was rare with NCC, and slightly more prevalent but still infrequent with AQP3. The histograms in Fig. 5, A–C, summarize the colocalization experiments by representing, as a percentage of the tubules that stained for either antigen, tubules that stained for only BK-1, only the marker of interest, or both. As summarized in Fig. 5B, BK-1 strongly colocalized with NCX. In fact, BK-1 staining was rarely observed in the absence of NCX. Because these graphs represent the total number of tubules stained by either antigen, it is important to note that the percentage of tubules stained cannot be compared between different graphs, since the total number of tubules stained is different for different antigens. However, the percentage of tubules stained can be compared within a graph.5 u7 M# s* ~) z9 \/ a
* U1 a6 b9 L7 m4 nDouble staining was also performed for BK- and NCX (Fig. 6). As shown in Fig. 6, A and B, the apical localization of BK- was similar in BK-1 / and BK-1–/–. Furthermore, cortical BK- colocalized with NCX in sections from BK-1 / and BK-1–/– (Fig. 6, C and D). BK- was also present on a number of non-NCX tubules in both the medulla and cortex, which is consistent with prior reports of BK expression in the medullary and cortical thick ascending limbs (16, 35, 54), CCD (18, 42), and medullary collecting ducts (36) as well as the DCT (3). The slight difference in the proportion of NCX BK- tubules between BK-1 / (28%) and BK-1–/– (32%) reached statistical significance; however, the proportions are extremely similar.1 u& s2 N. {+ u F" [% k/ q
6 Y9 k7 R7 k# ~( [
Experiments performed to double stain for BK- and BK-1 (Fig. 7) revealed that BK- and BK-1 colocalize to the same tubules, as expected from the finding that BK- and BK-1 both colocalize with NCX. However, this experiment demonstrates that not only are BK- and BK-1 in the same tubule, but they are indeed expressed in the same cells.9 s' Q' h/ z! d- C8 t% y/ W6 [
4 k* w' u: m" S% W) @
Immunohistochemical localization of BK-1 in rabbit distal nephron. Because many previous studies have utilized isolated rabbit tubules when demonstrating flow-mediated K secretion (55, 58, 59), we repeated the immunohistochemical experiments on rabbit renal sections. As shown in Fig. 8, BK-1 localized to the apical membrane of specific tubular segments from rabbit (brown, HRP). No staining was observed when IgG was substituted for the primary antibody (not shown). Double staining was then performed for NCX and BK-1 in rabbit kidney. In rabbit, unlike the mouse, NCX is expressed only in the CNT and not in the DCT (4) (see Fig. 1). In rabbit sections, it was found that NCX colocalized with BK-1 (Fig. 9, A and B), but with a different profile than in the mouse. In contrast to the mouse, where NCX staining occurred fairly frequently in the absence of BK-1, anti-NCX rarely stained any structures not expressing BK-1 in rabbit kidneys. However, in rabbit tissues, BK-1 staining without NCX was found much more frequently than in mouse.
0 d6 s0 b) |/ B: p$ I: I( q# x
' ]/ _; z' Q' H. j# y( W. _6 RIn addition to the cortical BK-1 staining, rabbit kidney sections consistently exhibited apical staining in a small percentage of medullary tubules. In contrast, medullary staining of BK-1 was never observed in any murine sections.
3 O [; B2 g, o
8 l6 b9 T$ @$ USequencing of rabbit CNT BK-1. The coding region of the BK-1 sequence obtained from microdissected rabbit CNT segments was identical to two of the three previously published sequences from rabbit muscle (accession numbers AB009313 and AB001934; 99% identical to AF107300). The 5'-untranslated region (UTR) was identical to all previously published rabbit sequences, however, there were several nucleotides in the 3'-UTR which varied from AB009313 but were identical to AF107300.
+ w/ g1 \ V v! U# H0 H1 F3 @4 M9 U1 P. J: h
DISCUSSION( q' s* h7 B, Z3 f0 f
. _( ~/ O) N p0 n$ D' _ _6 bThe results of this study showed that the BK-1 subunit is apically expressed in the distal nephron of both rabbit and mouse and has a role in influencing increases in K secretion in mice. Specifically, we showed that the normal kaliuretic response to volume expansion is significantly blunted in BK-1–/– mice and that BK-1 expression is predominantly restricted to the CNT in both rabbits and mice. Although it is tempting to speculate that the BK-1 subunit confers an increased sensitivity to flow rate, volume expansion evokes changes other than its influence on flow rate. Hormones such as atrial natriuretic peptide and aldosterone as well as renal sympathetic tone would be altered with volume expansion. Therefore, we conclude that the BK-1 subunit is necessary for a normal kaliuretic response to volume expansion. However, the specific mediator of this response is not known.5 ?% a, J4 \5 i" t
2 q4 f/ E0 R: d1 y) l
Role of BK in K secretion. Using the patch-clamp technique, Hunter et al. (18) and Frindt and Palmer (11) found that BK channels were contained in the apical membranes of rabbit and rat CCDs. Originally, however, it was believed that the BK channel functioned primarily as a volume regulatory channel. A transport role for BK was not evident until a study by Okusa et al. (39) showed that high flow rates caused the transepithelial potential (VT) to shift to a positive direction by amiloride application in the presence, but not the absence, of Ca2 . In a subsequent study, Taniguchi and Imai (55) showed with both isolated, perfused tubules and patch-clamp techniques that flow-dependent K secretion in the CNT (rabbit) is mediated by the BK channel. More recently, it was demonstrated that in the isolated, perfused rabbit CCD flow-dependent K secretion is mediated by the BK channel (58).5 e2 L6 s$ ?8 I/ a8 g
! T' j! ~* S5 z' l D5 ?: ~That ROMK–/– mice excreted K at a higher rate than wild-type mice provided a particularly convincing argument for a K secretory role for BK (30), the only K channel other than ROMK found to date in the apical membrane of the mammalian distal nephron with the patch-clamp technique (15, 48). Therefore, several groups demonstrated a role for the BK channel in K secretion. The possible role of accessory - subunits, however, had not been investigated.
+ C7 }. y5 p# G# L, w! J" R0 e( u9 `. `5 S }, n
Localization of BK-1 within the distal nephron. In this study, we investigated the distribution of BK-1 in renal tubules. As shown in Fig. 1, we used antibodies against NCX, NCC, and AQP3 to identify the murine DCT (NCC NCX), CNT (NCX), and CCD (AQP3). In the mouse, the strong colocalization of BK-1 with NCX (DCT CNT) but not NCC (DCT) implies that BK-1 expression is restricted to the CNT. This is consistent with the colocalization experiment that showed an unmistakable proportion of NCX expressed without BK-1. This likely represents the DCT expression of NCX. Because BK-1 can be considered a marker of the CNT (a more specific marker, in fact, than NCX, which also labels DCT), the colocalization of BK- and BK-1 to the same cells (Fig. 7) must represent CNT colocalization of these two subunits.
7 Q6 f% ~( k* X( D4 g0 S$ T2 D/ M: A0 h7 j9 m, D& ~+ P7 r7 P8 k% \$ W) x
BK-1 expression was found predominantly in the CNT of both the murine and rabbit sections. This was further confirmed by obtaining the sequence for BK-1 from microdissected rabbit CNTs using RT-PCR. However, only in the mouse was BK-1 expression restricted to the CNT. In the rabbit, we found that cortical BK-1 colocalized partially with NCX, but not with NCC, suggesting that BK-1 is expressed in the rabbit CNT. However, a significant proportion of rabbit BK-1 is expressed in a cortical segment that is morphologically consistent with distal nephron but is neither DCT nor CNT. This segment is most likely CCD or initial CCD (ICT). This conjecture is consistent with several studies showing flow-induced K secretion in rabbit CCD (58, 59). Unfortunately, we have been unable to confirm this speculation because we have not found an antibody that recognizes an appropriate CCD marker in rabbit tissue.
/ O8 z i6 u, `8 \, S- c* o- t
- M4 M9 J$ Y" T* L* y6 ?Another difference between the murine and rabbit localization of BK-1 is that rabbit renal sections consistently showed staining on the apical membranes of medullary structures. We have no evidence to establish the identity of these segments.* g4 N6 _ k. D3 c4 n, U
# p8 o' p: A' xIt has been previously reported that BK expression is higher in intercalated cells (IC) than in principal cells (PC) in the CCD (42, 59). However, in the rare colocalization which occurred in murine sections between AQP3 and BK-1, it appeared that these two antigens stained on the same cells (implying that BK-1 is expressed in PC). However, because of the small sample size due to the rarity of this colocalization, it is difficult to rule out the possibility that BK-1 may also be expressed on IC. Another possible site of BK-1 expression in IC in this study is the BK-1 medullary staining observed in rabbit. However, this staining often occurred on every cell visible in the tubule, and because IC is the minor cell type in the rabbit medulla, it appears that this staining must not be exclusive to IC.: ~) |/ p ~7 R# x
- Q* v. F: `4 V) ^: t! ?It has been shown that AQP2, and presumably AQP3, is expressed in approximately one-third of the rat CNT (9, 38). However, we saw extremely minor colocalization of AQP3 with BK-1. One possible explanation for this apparent discrepancy is that BK-1 is only expressed in some fraction of the CNT. In this scenario, the "NCX alone" staining may represent NCX in the DCT as well as CNT-absent BK-1. Species differences are another possible explanation for this discrepancy. For example, although AQP2 has been reported in portions of the rat CNT (9), it is not present in the rabbit CNT (26). There is one report of an unpublished observation of AQP2 expression in the mouse CNT (25); however, no studies have examined AQP3 distribution in mouse CNTs. A final possibility is that because the AQP2 staining is much weaker in the rat CNT than in the CCD (9, 25), we may not have had sufficient signal strength to recognize AQP3 in CNT.
) j- {( r' Z& b9 }- V. E { j$ H: Z' {" j( X/ s* |4 L
Previous reports of flow-induced K secretion in the rabbit CCD (as opposed to the CNT) may appear to be in conflict with our findings that the murine expression of BK-1 is restricted to the CNT and that the kaliuretic response in BK-1–/– mice is dramatically reduced. A species difference in BK-1 localization or the presence of another BK- subunit in the CCD may explain this apparent discrepancy. However, several studies indicate that the CNT is a primary site for renal K secretion in vivo.
" X* N9 N; K9 N: C' x. Y7 _5 n8 b3 Z8 S4 K
Role of the CNT in K secretion. Although the function of the mammalian CNT has not been investigated as prevalently as other distal segments, studies have shown that CNTs secrete K at higher rates than CCDs (20, 46). Indeed, micropuncture studies comparing the early (DCT) and late (CNT ICT) distal tubular fluid with the final urine have shown that the majority of K secretion occurs prior to the collecting duct (32, 46). Similarly, recent studies have shown that the Na reabsorptive capacity of the CNT is ten times that of the CCD (13) and that the density of SK (presumably ROMK) channels is higher in the CNT than in the CCD (12). Furthermore, a study using mice that have a CCD-specific "knockout" of -ENaC found that these mice maintained normal Na and K balance even when challenged with K loading, salt restriction, or water deprivation (47). These authors concluded that earlier distal nephron segments (late DCT and CNT) must play a prominent role in Na and K balance. With both Na and K channels in their apical membranes, an abundance of mitochondria, and a highly amplified basolateral membrane, CNTs are designed optimally to secrete K (34, 50). Furthermore, studies have shown that CNT express the highest levels of the enzyme 11--hydroxysteroid dehydrogenase (6), which is necessary for the action of aldosterone, the primary hormone for regulating K secretion.1 B- L7 P0 ?1 o& X% o
: h8 E1 G" p% m' }) Y: E" H+ i: VNot only does the CNT respond well to hormonal influences from the basolateral side, but also, with a position directly downstream of the thick ascending limb and distal convoluted tubule, it may be the most efficient and well placed segment to secrete K in response to local influences from the luminal compartment. Therefore, the majority of the experimental evidence indicates that the CNT is a major site of K secretion in the mammalian kidney.
2 ~: \7 ~, ]. z& Y& p& T- x4 x6 @) ], U1 \1 Z$ v
Potential mechanisms. These results raise the question of the mechanism by which the BK-1 subunit confers to the BK- an increased sensitivity to flow (or volume expansion). Although the increase in K excretion associated with flow is often explained by changes in electrochemical gradients (an increased rate of Na reabsorption, and a decrease in luminal K concentration driving K secretion), it seems likely that these mechanisms alone are not responsible. It has been shown that amiloride does not attenuate flow-mediated K secretion (31). For the BK channel, which has a low open probability under basal conditions, it is assumed that the channel must be activated in order for it to appreciably contribute to K secretion. One potential mechanism, which has been previously suggested by several groups (11, 55, 58), is that increased flow stretches the apical membrane causing an increase in intracellular [Ca2 ], thereby activating BK. This mechanism would be enhanced in the presence of BK-1, which increases the Ca2 sensitivity of the channel, and is analogous to the previously described role of BK-1 in vascular tissue to couple Ca2 sparks to BK channel activation (7).
) P. g+ [2 A' Q) n% x2 k8 r* F2 l2 _3 ?& M
Madin-Darby canine kidney (MDCK) cells, a model of mammalian distal nephron, apically express functional BK channels (5, 23). MDCK cells also display a cilium on their apical surface, as do both CNT cells and PC of the CCD. It has been demonstrated by Praetorius and Spring (45) that this cilium acts as a flow sensor. Bending of the cilium (either by increased flow rate or by micropipette suction) causes an increase in [Ca2 ]i (45). It seems plausible that the shear stress of increased flow causes the primary apical cilia of CNT cells to bend, thereby increasing [Ca2 ]i and activating BK- 1 channels. This mechanism is supported by the finding that two proteins from the transient receptor potential (TRP) superfamily of Ca2 and nonselective cation channels, polycystin 1 and polycystin 2, are located in the cilia of renal epithelia and mediate the mechanosensative increase in [Ca2 ]i, which occurs in response to increased flow (37, 49).4 G: d- K. V! d( f, A! h
, f- ?; m, v! ^: V, _Although this process seems plausible, several reports in the literature are conflicting as to the mechanism of BK activation. Whereas BK channels are reportedly stretch activated (10, 14, 54), studies differ on whether this stretch activation is dependent on [Ca2 ]i (42, 55). Furthermore, while it has been demonstrated that high flow rates and stretch cause [Ca2 ]i to increase in rabbit CCDs (24), these increases in Ca2 are fairly minimal and may not be large enough to significantly activate BK. Nevertheless, it is possible that microdomains near the membrane are exposed to higher concentrations of Ca2 that are able to activate BK.
& A* E! O) m, W/ Y( t* F$ N+ [+ B
An alternative hypothesis is that nitric oxide (NO) mediates activation of BK under conditions of volume expansion/high flow rate. NO is known to affect numerous transport processes in the nephron (40). A recent study by Ortiz et al. (41) demonstrated flow-activated eNOS and NO production in the thick ascending limb (THAL). We and others showed that BK are activated by the NO-cGMP-protein kinase G pathway (1, 51, 52) and that this activation requires the presence of a BK-1 or BK-2 subunit (22, 61). We observed nearly a doubling of the open probability (PO) on cGMP addition in an expressed cell system (22). Therefore, it follows that if increased flow enhances NO delivery to the CNT, this may cause a dramatic increase in the PO of BK- 1. One main question regarding this hypothesis is whether NO is produced in the CNT, or alternatively whether NO produced in the THAL can mediate a downstream effect in the CNT.; N8 T( y6 c+ y' t8 r$ @
& W3 _0 i5 ~; `3 `
Finally, one must consider the possibility that the loss of flow-mediated K secretion in BK-1–/– may be due to an alteration of trafficking or expression of BK- in the CNT. However, it has been previously shown that in the smooth muscle cells of these knockout mice, the number of BK channels/patch is not altered (7), implying that the absence of BK-1 does not alter trafficking or expression of the channel. However, because trafficking in polarized epithelial cells is more complex, we double stained for NCX and BK- (Fig. 6). Our results show that neither the localization of BK- to the CNT nor the apical distribution of BK- is altered in BK-1–/–, implying that BK- is correctly trafficked in the BK-1–/– CNT.
& x" ^5 D) v, m( E1 ]% g# P, g2 N# R2 J' n, ^ u
In conclusion, we demonstrated that the mammalian kaliuretic response to volume expansion has a large dependency on the BK-1 subunit. The results of this study urge further exploration of the role of the CNT as a focal point in flow-mediated K secretion. In addition, future studies are needed to identify the mechanism for this response. Our results emphasize the need to explore the potential role of other accessory BK- subunits in renal function. Although BK-1 is believed to play a functional role in mesangial cells (22, 44), little is known about the expression of BK-2, -3, or -4 in the kidney. Finally, this study accentuates the important roles of accessory subunits to modify channel properties to best perform tissue-specific functions.
% k' H- V: s+ T5 E3 z, \1 b: W0 x T6 @& Q( i1 F) ?2 {5 m
GRANTS
2 k% X) g7 ~9 f; d) ^
, v, H9 Z" n0 O }$ b7 WThis work was supported by National Institutes of Health Grants RO1-DK-49561 (to S. C. Sansom) and 1T32-HL-0788 (Cardiovascular Research Training Grant; to J. L. Pluznick), as well as the University of Nebraska Presidential Graduate Fellowship (to J. L. Pluznick).0 a* K3 N7 t6 J: s5 [5 _
3 s! R n$ r8 n, _1 E
ACKNOWLEDGMENTS& D! o, A+ j% [! a6 W
, y1 U/ E6 ~0 G2 P( VThe authors thank Dr. D. H. Ellison (Oregon Health and Science University) for the kind gift of NCC antibody and Dr. T. R. Kleyman (University of Pittsburgh) for supplying the BK- antibody. The authors also thank Drs. R. Brenner (University of Texas Health Science Center at San Antonio) and R. Aldrich (Stanford University) for graciously supplying the BK-1–/– mice.1 N0 h) ^$ y/ M* U% G- A+ Z+ B% ?
9 n$ ]. n# |. `, X4 D8 rFOOTNOTES
4 X; ~2 t% a! |* A% O& ^
5 C% }! F; s. ]8 q) e- w1 OThe costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
+ Z1 C2 c% w4 H: _5 q* g, l2 Q" x @3 X
+ V* Q, t6 ^' d% F, G0 LREFERENCES
# E& | F; W" G% f; j6 `& ?
" Q+ I* F* ]7 WAlioua A, Tanaka Y, Wallner M, Hofmann F, Ruth P, Meera P, and Toro L. The large conductance, voltage-dependent, and calcium-sensitive K channel, Hslo, is a target of cGMP-dependent protein kinase phosphorylation in vivo. J Biol Chem 273: 32950–32956, 1998.
! O# o9 r' G* T1 b6 }! J+ N/ V+ {6 \2 b' n2 j- H* @+ G( P# n
Behrens R, Nolting A, Reimann F, Schwarz M, Waldschutz R, and Pongs O. hKCNMB3 and hKCNMB4, cloning and characterization of two members of the large-conductance calcium-activated potassium channel beta subunit family. FEBS Lett 474: 99–106, 2000.
0 {2 G5 d5 _ @$ | w5 |
/ c6 ?) Z2 B/ |% BBelfodil R, Barriere H, Rubera I, Tauc M, Poujeol C, Bidet M, and Poujeol P. CFTR-dependent and -independent swelling-activated K currents in primary cultures of mouse nephron. Am J Physiol Renal Physiol 284: F812–F828, 2003.
2 ]$ h7 K' y2 E9 U- ~8 T, r& S6 @, W+ q( H" l
Biner HL, Arpin-Bott MP, Loffing J, Wang X, Knepper M, Hebert SC, and Kaissling B. Human cortical distal nephron: distribution of electrolyte and water transport pathways. J Am Soc Nephrol 13: 836–847, 2002.; H/ o3 s/ c" B' o1 _
* @& J6 R1 e; {- I8 ]4 pBolivar JJ and Cereijido M. Voltage and Ca2 -activated K channel in cultured epithelial cells (MDCK). J Membr Biol 97: 43–51, 1987.
& o- _& M/ ^: K/ _$ g* i
- N( C0 Y' B0 Y+ oBostanjoglo M, Reeves WB, Reilly RF, Velazquez H, Robertson N, Litwack G, Morsing P, Dorup J, Bachmann S, Ellison DH, and Bostonjoglo M. 11-Hydroxysteroid dehydrogenase, mineralocorticoid receptor, and thiazide-sensitive Na-Cl cotransporter expression by distal tubules. J Am Soc Nephrol 9: 1347–1358, 1998.
, r& V9 G/ k" A& @ n& e4 U" A
9 D! F% J/ {/ p5 g5 nBrenner R, Perez GJ, Bonev AD, Eckman DM, Kosek JC, Wiler SW, Patterson AJ, Nelson MT, and Aldrich RW. Vasoregulation by the 1-subunit of the calcium-activated potassium channel. Nature 407: 870–876, 2000.
% k, F# U5 V% k" S3 C7 ^0 H( Q2 {# C
5 n& n1 M8 y0 y: i' m% cCampean V, Kricke J, Ellison D, Luft FC, and Bachmann S. Localization of thiazide-sensitive Na -Cl– cotransport and associated gene products in mouse DCT. Am J Physiol Renal Physiol 281: F1028–F1035, 2001.4 M9 j, ?3 P+ V: z& M
" Z6 }3 o8 W8 P! h0 u
Coleman RA, Wu DC, Liu J, and Wade JB. Expression of aquaporins in the renal connecting tubule. Am J Physiol Renal Physiol 279: F874–F883, 2000.0 i' n4 h$ R, @7 l# B( Y; d/ @0 |
- F0 C: x) {+ F6 p }Davidson RM. Membrane stretch activates a high-conductance K channel in G292 osteoblastic-like cells. J Membr Biol 131: 81–92, 1993.3 f p/ y9 n1 r2 f4 M# U
1 K3 K4 M- a! \' d
Frindt G and Palmer LG. Ca-activated K channels in apical membrane of mammalian CCT, and their role in K secretion. Am J Physiol Renal Fluid Electrolyte Physiol 252: F458–F467, 1987.
: {. h( N( n; A8 E
. C. P/ l# e U$ v; f7 l! n, eFrindt G and Palmer LG. Apical potassium channels in the rat connecting tubule. Am J Physiol Renal Physiol 287: F1030–F1037, 2004.8 i( _" W' s3 x, }
' N/ F) o! ]+ d, r: ~$ [) v& `9 @
Frindt G and Palmer LG. Na channels in the rat connecting tubule. Am J Physiol Renal Physiol 286: F669–F674, 2004.
+ T+ i8 r6 D" c2 u( V: q( X# [! T( A- b. S6 H8 D- b) V
Gasull X, Ferrer E, Llobet A, Castellano A, Nicolas JM, Pales J, and Gual A. Cell membrane stretch modulates the high-conductance Ca2 -activated K channel in bovine trabecular meshwork cells. Invest Ophthalmol Vis Sci 44: 706–714, 2003.
2 ]9 z% l. W3 f4 y% Q9 [2 |/ R5 h5 L* a# v
Geibel J, Zweifach A, White S, Wang WH, and Giebisch G. K channels of the mammalian collecting duct. Renal Physiol Biochem 13: 59–69, 1990.
8 \7 k- F: i& t! A3 G
1 B. ^' k8 w/ S6 [$ o0 a' HGuggino SE, Guggino WB, Green N, and Sacktor B. Ca2 -activated K channels in cultured medullary thick ascending limb cells. Am J Physiol Cell Physiol 252: C121–C127, 1987.
' O! i( w1 H* |, B0 q; o, b+ Q8 ^2 p
Hunter M, Lopes AG, Boulpaep E, and Giebisch G. Regulation of single potassium ion channels from apical membrane of rabbit collecting tubule. Am J Physiol Renal Fluid Electrolyte Physiol 251: F725–F733, 1986.
& p; h) w; Z/ ^1 _7 y$ b, m: d* S3 A, f$ ?# V
Hunter M, Lopes AG, Boulpaep EL, and Giebisch GH. Single channel recordings of calcium-activated potassium channels in the apical membrane of rabbit cortical collecting tubules. Proc Natl Acad Sci USA 81: 4237–4239, 1984.
: h( [- V* K7 \& q# |7 E9 B! A/ I) t# y( R7 }' _5 F/ O% ~! J
Imai M. The connecting tubule: a functional subdivision of the rabbit distal nephron segments. Kidney Int 15: 346–356, 1979.2 J+ h/ w5 ~7 Y1 R- B7 j# K. r3 r
+ z+ [4 Y. F! |$ h* [8 eKaufman JS and Hamburger RJ. Potassium transport in the connecting tubule. Miner Electrolyte Metab 22: 242–247, 1996.9 a/ e# G( j" S+ i/ C
/ S5 E6 ^ z) L; ~Khuri RN, Strieder WN, and Giebisch G. Effects of flow rate and potassium intake on distal tubular potassium transfer. Am J Physiol 228: 1249–1261, 1975.# f$ T) L( ^. N( ]- ^, v% Z
1 B1 H9 I) I# A7 j' oKudlacek PE, Pluznick JL, Ma R, Padanilam B, and Sansom SC. Role of hbeta1 in activation of human mesangial BK channels by cGMP kinase. Am J Physiol Renal Physiol 285: F289–F294, 2003.
3 ]* P# _2 E/ C2 x: D" l1 G! ?3 Z/ v1 J/ t6 V' k
Lang F and Paulmichl M. Properties and regulation of ion channels in MDCK cells. Kidney Int 48: 1200–1205, 1995.
1 D" m0 Z9 g$ [8 m
1 a: n2 x9 ]5 v9 D+ aLiu W, Xu S, Woda C, Kim P, Weinbaum S, and Satlin LM. Effect of flow and stretch on the [Ca2 ]i response of principal and intercalated cells in cortical collecting duct. Am J Physiol Renal Physiol 285: F998–F1012, 2003.5 h5 i8 U. Z. j$ G4 t& Y
3 N) L3 o. D) v8 B# ]) L. U; L( ~0 l; ZLoffing J and Kaissling B. Sodium and calcium transport pathways along the mammalian distal nephron: from rabbit to human. Am J Physiol Renal Physiol 284: F628–F643, 2003.! H' a5 v( t" F( z9 m
+ i$ V% i& u- U6 I/ N% p& ]Loffing J, Loffing-Cueni D, Macher A, Hebert SC, Olson B, Knepper MA, Rossier BC, and Kaissling B. Localization of epithelial sodium channel and aquaporin-2 in rabbit kidney cortex. Am J Physiol Renal Physiol 278: F530–F539, 2000.
6 o6 c" b3 G5 B" b9 o4 r1 W, C ]8 ]( C* N+ Q; p
Loffing J, Loffing-Cueni D, Valderrabano V, Klausli L, Hebert SC, Rossier BC, Hoenderop JG, Bindels RJ, and Kaissling B. Distribution of transcellular calcium and sodium transport pathways along mouse distal nephron. Am J Physiol Renal Physiol 281: F1021–F1027, 2001.: r6 n, k# @- Q, e/ o/ L( |* [& {
: @! v& k7 H9 Y# |6 F
Lohn M, Lauterbach B, Haller H, Pongs O, Luft FC, and Gollasch M. 1-Subunit of BK channels regulates arterial wall [Ca2 ] and diameter in mouse cerebral arteries. J Appl Physiol 91: 1350–1354, 2001.
8 q; i7 j4 m4 P$ C) f/ z; N
0 l4 ]" ?: @) d" X4 dLorenz JN and Gruenstein E. A simple, nonradioactive method for evaluating single-nephron filtration rate using FITC-inulin. Am J Physiol Renal Physiol 276: F172–F177, 1999.6 b/ W0 G0 F* @ Z$ c. y7 T1 G
/ m8 P/ E: E4 s |' HLu M, Wang T, Yan Q, Yang X, Dong K, Knepper MA, Wang W, Giebisch G, Shull GE, and Hebert SC. Absence of small conductance K channel (SK) activity in apical membranes of thick ascending limb and cortical collecting duct in ROMK (Bartter's) knockout mice. J Biol Chem 277: 37881–37887, 2002." D# L7 t6 V0 E; K+ t
1 [6 i) ^' U5 u. ^
Malnic G, Berliner RW, and Giebisch G. Flow dependence of K secretion in cortical distal tubules of the rat. Am J Physiol Renal Fluid Electrolyte Physiol 256: F932–F941, 1989.7 s: ~/ Q- X: d. j: ]6 i
2 a5 C5 Q; R) R8 b @8 j% y$ c6 k
Malnic G, Klose RM, and Giebisch G. Microperfusion study of distal tubular potassium and sodium transfer in rat kidney. Am J Physiol 211: 548–559, 1966.* R( |, }6 _2 G. f
t7 e! ~9 Q0 O# g9 }) Q; t) y
McCobb DP, Fowler NL, Featherstone T, Lingle CJ, Saito M, Krause JE, and Salkoff L. A human calcium-activated potassium channel gene expressed in vascular smooth muscle. Am J Physiol Heart Circ Physiol 269: H767–H777, 1995.
2 q' ]6 ]% j9 c8 ]
' y! h- N8 b7 `& B& `+ {; SMeneton P, Loffing J, and Warnock DG. Sodium and potassium handling by the aldosterone-sensitive distal nephron: the pivotal role of the distal and connecting tubule. Am J Physiol Renal Physiol 287: F593–F601, 2004.
0 |! v) j) f) k/ j5 c0 y5 E0 o; f+ J( f
Merot J, Poncet V, Bidet M, Tauc M, and Poujeol P. Apical membrane ionic channels in the rabbit cortical thick ascending limb in primary culture. Biochim Biophys Acta 1070: 387–400, 1991.
" Q% D. ?2 S, K5 W, C1 p' z! Y' k. ]8 R# B+ r: S/ F3 L
Morita T, Hanaoka K, Morales MM, Montrose-Rafizadeh C, and Guggino WB. Cloning and characterization of maxi K channel -subunit in rabbit kidney. Am J Physiol Renal Physiol 273: F615–F624, 1997.
. C7 R p* M0 a; k3 u$ S0 l9 d! G0 X0 h
Nauli SM, Alenghat FJ, Luo Y, Williams E, Vassilev P, Li X, Elia AE, Lu W, Brown EM, Quinn SJ, Ingber DE, and Zhou J. Polycystins 1 and 2 mediate mechanosensation in the primary cilium of kidney cells. Nat Genet 33: 129–137, 2003.( a2 B( R$ f& B6 g6 W G; o
' k @" W; a( ?( |' R2 }5 A
Nielsen S, Frokiaer J, Marples D, Kwon TH, Agre P, and Knepper MA. Aquaporins in the kidney: from molecules to medicine. Physiol Rev 82: 205–244, 2002.
5 z* F3 o( @$ N* a6 U( g- s8 B0 a9 |! n0 A* D1 V
Okusa MD, Velazquez H, and Wright FS. Effect of Na-channel blockers and lumen Ca on K secretion by rat renal distal tubule. Am J Physiol Renal Fluid Electrolyte Physiol 260: F459–F465, 1991.
2 E1 `: S7 v/ ?" X2 }
# a7 `2 @3 l# H {$ A. ?Ortiz PA and Garvin JL. Role of nitric oxide in the regulation of nephron transport. Am J Physiol Renal Physiol 282: F777–F784, 2002.. \& V9 y4 ?; ~1 [$ v& X
( b7 p# p9 b9 @! M4 X/ ^
Ortiz PA, Hong NJ, and Garvin JL. Luminal flow induces eNOS activation and translocation in the rat thick ascending limb. Am J Physiol Renal Physiol 287: F274–F280, 2004.
' | h9 J& t* V2 r8 v b! G1 P8 _# E
Pacha J, Frindt G, Sackin H, and Palmer LG. Apical maxi K channels in intercalated cells of CCT. Am J Physiol Renal Fluid Electrolyte Physiol 261: F696–F705, 1991.% F5 }6 L: `5 Y* h+ J
/ C9 y+ q* w6 a e# m1 R0 b
Pluger S, Faulhaber J, Furstenau M, Lohn M, Waldschutz R, Gollasch M, Haller H, Luft FC, Ehmke H, and Pongs O. Mice with disrupted BK channel beta1 subunit gene feature abnormal Ca2 spark/STOC coupling and elevated blood pressure. Circ Res 87: E53–E60, 2000.9 V. Q* `( l) |$ i: O4 \
( @1 Z8 C& _9 w" Y6 ~Pluznick JL, Wei P, Carmines PK, and Sansom SC. Renal fluid and electrolyte handling in BKCa-1 –/– mice. Am J Physiol Renal Physiol 284: F1274–F1279, 2003.
0 ~1 \+ L: \3 i t4 I' @ u
; D m# X2 x; H0 SPraetorius HA and Spring KR. Bending the MDCK cell primary cilium increases intracellular calcium. J Membr Biol 184: 71–79, 2001.8 |' b% j% {9 G0 ?1 e! Q
) `$ T; ~6 d; H' c! u+ P0 f
Reineck HJ, Osgood RW, Ferris TF, and Stein JH. Potassium transport in the distal tubule and collecting duct of the rat. Am J Physiol 229: 1403–1409, 1975.
% e0 I1 a7 ^: j0 r% f5 g" N3 [$ I7 t
Rubera I, Loffing J, Palmer LG, Frindt G, Fowler-Jaeger N, Sauter D, Carroll T, McMahon A, Hummler E, and Rossier BC. Collecting duct-specific gene inactivation of aENaC in the mouse kidney does not impair sodium and potassium balance. J Clin Invest 112: 554–565, 2003.* K* k( C5 U! O: A
. S7 j1 ]2 R6 J' }: `5 ?
Satlin LM. Developmental regulation of expression of renal potassium secretory channels. Curr Opin Nephrol Hypertens 13: 445–450, 2004.; h8 N4 m x; F' V
# f- @- K3 B! VScheffers MS, Le H, van der BP, Leonhard W, Prins F, Spruit L, Breuning MH, de Heer E, and Peters DJ. Distinct subcellular expression of endogenous polycystin-2 in the plasma membrane and Golgi apparatus of MDCK cells. Hum Mol Genet 11: 59–67, 2002.
& d* g2 Y! C" N, a6 x O1 ~7 s4 f4 E
Schmitt R, Ellison DH, Farman N, Rossier BC, Reilly RF, Reeves WB, Oberbaumer I, Tapp R, and Bachmann S. Developmental expression of sodium entry pathways in rat nephron. Am J Physiol Renal Physiol 276: F367–F381, 1999.
% R, @# k: g; p. s
, u& s% a* r/ _6 p9 [Stockand JD and Sansom SC. Mechanism of activation by cGMP-dependent protein kinase of large Ca2 -activated K channels in mesangial cells. Am J Physiol Cell Physiol 271: C1669–C1677, 1996.8 x) H# {7 t) |/ V5 l
[; I9 Q; P1 o3 S& G
Stockand JD and Sansom SC. Role of large Ca2 -activated K channels in regulation of mesangial contraction by nitroprusside and ANP. Am J Physiol Cell Physiol 270: C1773–C1779, 1996.
3 @8 J# n0 W* o+ q9 O9 q# Z. u1 S; n/ l* {
Strieter J, Weinstein AM, Giebisch G, and Stephenson JL. Regulation of K transport in a mathematical model of the cortical collecting tubule. Am J Physiol Renal Fluid Electrolyte Physiol 263: F1076–F1086, 1992.
4 A4 W( v. e3 T
4 M+ A7 G+ P" d. D3 `4 j* yTaniguchi J and Guggino WB. Membrane stretch: a physiological stimulator of Ca2 -activated K channels in thick ascending limb. Am J Physiol Renal Fluid Electrolyte Physiol 257: F347–F352, 1989.
n C3 V6 a: a: r) p" q
9 |# j' t1 X) X/ e0 MTaniguchi J and Imai M. Flow-dependent activation of maxi K channels in apical membrane of rabbit connecting tubule. J Membr Biol 164: 35–45, 1998.
6 q, Z0 n% X- b' c; F. ^
9 C" q: e8 i; V! I) P+ kUchida S and Endou H. Substrate specificity to maintain cellular ATP along the mouse nephron. Am J Physiol Renal Fluid Electrolyte Physiol 255: F977–F983, 1988.
. b% {/ z+ c- K8 v; L7 h. j; \( q5 m) n0 |1 P- N. }
Wang T, Inglis FM, and Kalb RG. Defective fluid and HCO3– absorption in proximal tubule of neuronal nitric oxide synthase-knockout mice. Am J Physiol Renal Physiol 279: F518–F524, 2000.0 X5 X5 U6 E+ e+ X
- s! |6 n! Y. f! N3 N8 `
Woda CB, Bragin A, Kleyman TR, and Satlin LM. Flow-dependent K secretion in the cortical collecting duct is mediated by a maxi-K channel. Am J Physiol Renal Physiol 280: F786–F793, 2001., i6 x! r; |" k
% z: w( r0 g0 T, s! h. o4 gWoda CB, Miyawaki N, Ramalakshmi S, Ramkumar M, Rojas R, Zavilowitz B, Kleyman TR, and Satlin LM. Ontogeny of flow-stimulated potassium secretion in rabbit cortical collecting duct: functional and molecular aspects. Am J Physiol Renal Physiol 285: F629–F639, 2003.* L& \* f6 E+ x; L: x
, [: n) d5 ^) b
Wright FS. Potassium transport by successive segments of the mammalian nephron. Fed Proc 40: 2398–2402, 1981.
& e7 W+ Z) l) \& N- F W+ q( a6 Y: A3 [, k% d
Wu L, Cao K, Lu Y, and Wang R. Different mechanisms underlying the stimulation of K(Ca) channels by nitric oxide and carbon monoxide. J Clin Invest 110: 691–700, 2002.(Jennifer L. Pluznick, Pei) |
|