|

- 积分
- 0
- 威望
- 0
- 包包
- 0
|

Fondation pour Recherches Médicales, Service of Nephrology, Geneva, Switzerland1 k; J K' n1 E6 b4 k7 n4 Q" D
) a8 b: p+ o# z! w9 ?6 n1 V R4 b
Section of Integrative Physiology, Department of Surgical Sciences, Karolinska Institutet, Stockholm, Sweden0 f7 Q8 |! a* S4 p% N U+ k
$ B9 p3 C. g8 Q% k& CInstitut National de la Santé et de la Recherche Médicale U, Faculté de Médecine Xavier Bichat, Paris, France
/ Y6 n' N, p7 r; [7 `' }) u
5 F% F, d5 @. tABSTRACT1 J' T; T+ A3 ?2 ?, ?/ C
# E* y4 c1 @3 F
In the renal collecting duct (CD), water reabsorption depends on the presence of aquaporin-2 (AQP2) in the apical membrane of principal cells. AQP2 expression and subcellular repartition are under the control of AVP. Some pieces of experimental evidence indicate that additional hormonal factors, including insulin, may also control AQP2 expression and thereby CD water permeability. We have previously shown that AVP induces endogenous AQP2 expression in cultured mouse mpkCCDcl4 CD principal cells (23). In the present study, we investigated the effect of insulin on AQP2 expression in mpkCCDcl4 cells. Addition of insulin to the basal medium of cells grown on filters slightly increased AQP2 mRNA and protein expression, whereas insulin potentiated the effect of AVP. The potentiation of AVP-induced AQP2 expression by insulin was abolished by actinomycin D, a transcriptional inhibitor. Analysis of AQP2 protein expression under conditions of AVP washout and/or in the presence of chloroquine, a lysosomal degradation inhibitor, revealed that insulin did not significantly alter AQP2 protein degradation. Inhibition of ERK, p38 kinase, and phosphatidylinositol 3'-kinase (PI 3-kinase) activities prevented the insulin-induced stimulation of AQP2 expression, whereas inhibition of PKC has no effect. Taken together, our results indicate that insulin increased AQP2 protein expression mostly through increased AQP2 mRNA levels in cultured mpkCCDcl4 cells. This effect most likely relies on increased AQP2 gene transcription in response to MAPK and PI 3-kinase activation.+ |3 k3 g: S, n3 H; E
- ?: V* R1 \. y7 Y' W
kidney; water transport; mitogen-activated protein kinases; phosphatidylinositol 3-kinase
. q' U" A+ J. a3 F" a [! W- C1 M# y* |; k' k- L1 ^( E2 D b
DESPITE LARGE VARIATIONS IN the intake of solutes and water, the kidney is able to maintain the composition of body fluid compartments within a narrow range. Reabsorption of filtered water occurs through a complex process along the renal tubule. Approximately 70 and 20% of the filtered load is reabsorbed by proximal tubules and thin descending limb of Henle's loop, respectively. In contrast, the thick ascending limb of Henle's loop and the distal convoluted tubule are virtually impermeable to water. Fine tuning of water balance occurs in the collecting duct, as well as the connecting tubule in some species (16). In this segment, water permeability is almost completely dependent on the antidiuretic hormone AVP." E7 q% c5 m* R2 s9 @ Q1 N1 O
. N# m; y& L" N. ?3 f' sWater movement across renal tubule epithelial cells is dependent on the presence of aquaporin (AQP) water channels. AQP1 is constitutively expressed in apical and basolateral membrane domains of proximal tubule and thin descending limb cells and accounts for the water permeability of these nephron segments. In the collecting duct, water moves across the membranes of principal cells, which express at least three AQP subtypes (AQP2, AQP3, and AQP4) (11, 36, 52). AQP3 and AQP4 are constitutively expressed in the basolateral membrane domain, whereas AQP2 shuttles between subapical vesicles and apical membranes in a regulated manner. Acute increase in circulating AVP concentration induces the translocation of AQP2 from intracellular stores to the apical plasma membrane and thereby increases water permeability of collecting duct principal cells (27). In addition, prolonged AVP challenge also stimulates AQP2 and AQP3 expression (28).( R/ W* x! T+ l; O4 d- J" o
7 @& b% V4 V3 t+ W6 e7 k9 jSeveral observations indicate that, while circulating AVP is the main regulator of water transport in the collecting duct (22, 36), other factors may participate in the control of AQP2 expression (30, 31). For instance, we and others have recently shown that aldosterone modulates AVP-dependent AQP2 expression in collecting duct principal cells (24). In addition, despite normal or increased circulating AVP levels, AQP2 expression is decreased under various pathological conditions such as nephrotic syndrome (18), hypercalcemia (15, 55), hypokaliemia (35), lithium therapy (32), and liver cirrhosis (20). On the other hand, pregnant rats exhibit increased AQP2 expression in the presence of normal circulating AVP levels (38).
3 E7 t0 W) k6 P& H
1 U) F1 r2 S8 Q T) kIn addition to its central role in glucose metabolism, insulin also controls water and sodium handling by the kidney (12, 17). The control of renal sodium and water excretion by insulin was first suggested by observations in humans with diabetes mellitus. In this setting, ketoacidocis is accompanied by sodium and water excretion, which exceed what can be accounted for by osmotic diuresis alone and which are normalized by insulin therapy (3). Results obtained in the isolated, perfused dog kidney confirmed the stimulatory effect of insulin on renal sodium and water reabsorption (37). Further studies performed in isolated tubules perfused in vitro indicated that insulin stimulates fluid absorption by the proximal tubule (7) and increases water permeability of the inner medullary collecting duct (34). However, the effect of insulin on AQP2 expression has not been investigated.' K3 V( P" h" B1 Q! Q
~: B/ M& i6 s' jThe insulin receptor is a heterotetrameric membrane protein consisting of two - and two -subunits. Insulin binding to the -subunits of the receptor activates the intrinsic tyrosine kinase activity of the -subunit, resulting, first, in an intramolecular transautophosphorylation reaction between two adjacents -subunits (53). The phosphorylated receptor then binds and phosphorylates insulin receptor substrate (IRS) proteins, which bind to a different set of signaling proteins (56). Activated IRS proteins provide docking sites for proteins with Src homology 2 (SH2) domains, including the p85 regulatory subunit of the type IA phosphatidylinositol 3'-kinase (PI 3-kinase) (2). Once recruited, PI 3-kinase catalyzes the phosphorylation of the inositol ring of phosphoinositide (PI) lipids on the 3'-position (19), which induces recruitement and activation of pleckstrin homology domain-containing proteins, including the 3'-phosphoinositide-dependent kinase-1 (PDK-1) and Akt (also known as PKB) (41). PDK-1 can then phosphorylate and activate other effectors, such as the atypical PKC/, Akt, and 90-kDa ribosomal S6 kinase (RSK) (26, 33, 49). This pathway is critical for insulin stimulation of glucose transport and glycogen and protein synthesis (1). Phosphorylation of IRS proteins by the insulin receptor also leads to the recruitment of the Grb-2/Sos complex, which in turn activates ERK through the classic Ras-Raf-MEK-dependent pathway (45). This pathway plays a key role in the mitogenic effect of insulin (13).% N5 D4 Q, _( s& G9 {( x
& x. ^2 j4 E8 |* J0 JThe purpose of the present study was to investigate the effect of insulin on long-term AQP2 expression. For this purpose, we used the immortalized clonal collecting duct mpkCCDcl4 cell line derived from microdissected cortical collecting ducts of a SVPK/Tag transgenic mouse. When grown on permeable filters, these cells form a tight epithelium exhibiting the major properties of collecting duct principal cells, including stimulation of electrogenic Na transport by aldosterone and AVP (8, 51) as well as AVP-dependent AQP2 expression (23). The results of the present study indicate that insulin significantly enhances AVP-dependent AQP2 expression by increasing AQP2 mRNA levels.
* G" R! M( X9 y* G: ~7 U
5 H1 p# L& ?6 B- w) }MATERIALS AND METHODS
7 m. x$ Z' V# u5 m1 I! k
S: \6 e9 K: V4 Y: wCell culture. mpkCCDcl4 cells were grown in modified DMEM/Ham's F-12, 1:1 vol/vol (60 nM sodium selenate, 5 μg/ml transferrin, 2 mM glutamine, 50 nM dexamethasone, 1 nM triiodothyronine, 10 ng/ml epidermal growth factor, 5 μg/ml insulin, 20 mM D-glucose, 2% fetal calf serum, and 20 mM HEPES, pH 7.4) at 37°C in 5% CO2-95% air. Experiments were performed in confluent cells seeded on semipermeable polycarbonate filters (Transwell, 0.4-μm pore size, 1-cm2 growth area, Corning Costar, Cambridge, MA). Cells were grown in DMEM until confluence (day 6 after seeding) and then in serum-free, hormone-deprived DMEM for another 24 h before use. The medium was changed every 2 days, and all experiments were performed between the passages 20 and 35.
; i! Y! p( B9 n! c, p7 g# t# `/ R+ }
Protein extraction. After incubation without or with hormones and/or drugs, cells were washed twice with phosphate-buffered saline and then homogenized in 150 μl of ice-cold lysis buffer [(in mM) 2 EGTA, 2 EDTA, 30 NaF, 30 Na4O7P2, 2 Na3VO4, 1 PMSF, 1 4-(2-aminoethyl)benzenesulfonyl fluoride, and 20 Tris﹞HCl as well as 10 μg/ml leupeptin, 4 μg/ml aprotinin, 0.1% SDS, and 1% Triton X-100, pH 7.4]. Protein concentrations were measured by BCA protein assay (Pierce, Rockford, IL).
) R' k- F8 R4 W1 |/ C1 Q3 c
4 B2 @! Q4 y: y8 f' P8 S0 _+ sWestern blot analysis. Equal amounts of protein samples were separated by 10% SDS-PAGE and transferred to a polyvinylidene difluoride membrane (Immobilon-P, Millipore, Waters, MA), and membranes were blocked with Tris-buffered saline (150 mM NaCl, 50 mM Tris, pH 7.5) containing 0.2% (vol/vol) Nonidet P-40 (TBS-NP-40) and 5% (wt/vol) nonfat dry milk for 30 min at room temperature. Membranes were then probed with a polyclonal rabbit anti-rat AQP2 antibody (1:20,000); a polyclonal rabbit anti-phospho-p44/42 MAP kinase antibody (1:500, Cell Signaling Technologies); a polyclonal rabbit anti-phospho-MAPKAP-2 antibody (1:1,000, Cell Signaling Technologies); a polyclonal rabbit anti-phospho-p38 MAP kinase antibody (1:1,000, Cell Signaling Technologies); or a polyclonal anti-Na-K-ATPase -subunit antibody (1:10,000) overnight at 4°C in TBS-NP-40 with 5% (wt/vol) nonfat dry milk, and then with a secondary horseradish peroxidase-coupled goat anti-rabbit IgG (1:20,000) (Transduction Laboratories, Lexington, KY) for 1 h at room temperature. After three washes in TBS-NP-40, the antigen-antibody complexes were detected by chemiluminescence using the ECL Western blotting detection kit (Amersham Biosciences). Results were quantified under conditions of linearity by integration of the density of total area of each band using a video densitometer and ImageQuant software (Molecular Dynamics, Sunnyvale, CA). Results are expressed as a percentage of the control optical density.
9 j( O2 ]1 }0 H) J+ t* V8 Y+ o# C6 {# Z; |( |6 d# v
RNA extraction and cDNA synthesis. Confluent cells were incubated without or with hormones and/or drugs. After two washes with phosphate-buffered saline, total RNA was extracted using an RNeasy Mini kit (Qiagen) according to the manufacturer's instructions. RNA concentration and purity were measured using UV-spectrophotometry. Equal amounts (1 μg) of RNA were used to synthesize cDNA using SuperScript II RNase H– Reverse Transcriptase (Invitrogen) according to the manufacturer's instructions.7 G0 o m; M4 l ]9 X
& F8 n6 S! H' yReal-time PCR. Mouse AQP2 and acidic ribosomal phosphoprotein P0 PCR-specific primers were designed at intron-exon boundaries using Primer Express software (Applied Biosystems). Primer sequences are CTTCCTTCGAGCTGCCTTC (AQP2 sense); CATTGTTGTGGAGAGCATTGAC (AQP2 antisense); AATCTCCAGAGGCACCATTG (P0 sense); and GTTCAGCATGTTCAGCAGTG (P0 antisense). Amplifications were performed in 50 μl of SYBR Green PCR Master Mix (Applied Biosystems) supplemented with 3 ng of each specific primer and 5 μl of cDNAs diluted 1:25 (vol/vol). Amplification was performed with the ABI prism 7000 apparatus (Applied Biosystems) using the following protocol. After a first cycle consisting of a 2-min incubation at 50°C followed by 10 min at 95°C, samples were submitted to 40 cycles of amplification consisting of a 15-s incubation at 95°C followed by a 1-min incubation at 58°C. Data were analyzed using ABI Prism software (Applied Biosystems), and P0 was used as an internal standard. The amount of AQP2 mRNA in each sample is expressed as fold of control samples after normalization with respect to P0 mRNA.
* t& F/ z) B- [2 x6 V) Z9 m. V' ?9 U$ p. P9 r; T$ B, ]) b% u
Measurement of phosphotyrosine-associated PI 3-kinase activity. PI 3-kinase activity was determined as described elsewhere (48). Aliquots of cell lysate (300 μg protein) were immunoprecipitated with anti-phosphotyrosine antibody (BD Transduction Laboratories) overnight at 4°C. Thereafter, protein A-Sepharose beads were added to the lysates, and samples were incubated for 2 h at 4°C. The immunoprecipitates were washed three times with buffer A [(in mM) 137 NaCl, 2.7 KCl, 1 MgCl2, 10 NaF, 1 EDTA, 5 Na-pyrophosphate, 0.5 Na3VO4, 0.2 phenylmethylsulfonyl fluoride, 1 DTT, 1 benzamidine, and 20 Tris as well as 1% Triton X-100, 10% (wt/vol) glycerol, 1 μg/ml leupeptin, 1 μg/ml aprotinin, and 1 μM microcystin, pH 7.8]; two times with buffer B (0.5 M LiCl and 0.1 M Tris, pH 8.0); and one time with buffer C (0.15 M NaCl, 1 mM EDTA, and 10 mM Tris, pH 7.6). Immunoprecipitates were then washed one time with buffer D (1 mM DTT, 5 mM MgCl2, and 20 mM HEPES, pH 7.3) and resuspended thereafter in 20 μl of buffer E [(in mM) 20 -glycerophosphate, 5 Na4P2O7, 30 NaCl, 1 DTT, and 20 HEPES, pH 7.3]. The kinase reaction was started by adding 30 μl of buffer F {buffer E containing 12.5 μM ATP, 7.5 mM MgCl2, 20 μg phosphatidylinositol/reaction (Avanti Polar Lipids, Alabaster, AL), and 20 μCi [-32P]ATP/reaction} and carried out for 15 min at room temperature. The reaction was terminated by addition of 150 μl of 1% (vol/vol) perchloric acid. Thereafter, a 2:1 mixture of methanol:chloroform was added, followed by two washes with 1% perchloric acid, and the aqueous phase was removed between washes. The reaction product was applied onto a silica gel-coated thin-layer chromatography (TLC) aluminum sheet (Silica gel 60; Merck, Darmstadt, Germany), separated in a preequilibrated tank containing methanol:chloroform:ammonia:water (75:54:20:10), and analyzed using Bio-Imaging Analyzer BAS-1800II (Fuji Photo Film). Quantification was performed using Image Gauge software, version 3.4 (Fuji Photo Film).
: \4 B3 F4 e, S( Q& o, N0 ?
0 \$ Q u/ S6 G. a5 p4 x MStatistics. Results are means ± SE from n independent experiments. Each experiment was performed in cultured cells from the same passage. Statistical differences were assessed using the Mann-Whitney U-test for comparison of two groups or the Kruskal-Wallis test for comparison of more than two groups. P
1 V1 R3 T" I% K; Z: o g0 u/ a) `0 {/ ~1 @+ W0 @
RESULTS, F* A# ^$ X+ p" m/ V! O
& s4 S/ f7 Y# _- g& f
Effect of insulin on AQP2 protein expression in mouse collecting duct principal cells. We have previously shown that the low levels of AQP2 protein expression in untreated mpkCCDcl4 cells grown on filters can be dramatically increased by addition of physiological concentrations of AVP to the basal medium (23). In the present study, we examined the effect of insulin on AQP2 expression in mpkCCDcl4 cells pretreated with AVP. We first analyzed the time course of the effect of insulin by comparing AQP2 protein expression levels in mpkCCDcl4 cells treated with AVP alone or with both AVP and insulin for various lengths of time. AQP2 expression was induced by pretreating mpkCCDcl4 cells with 10–10 M AVP added to the basal medium for 24 h. After preincubation, mpkCCDcl4 cells were incubated for different lengths of time (5–48 h) in the continuous presence of AVP and in the absence or presence of 10–8 M insulin in the basal medium (Fig. 1, A and B). These concentrations of AVP and insulin were chosen because they correspond to the maximal circulating concentrations of both hormones. Western blot analysis of AVP-treated mpkCCDcl4 cells showed a 29-kDa band and a more diffuse 35- to 50-kDa band corresponding to the nonglycosylated and fully glycosylated forms of AQP2 protein (Fig. 1A). Results show that the AVP-induced increase in AQP2 protein expression over time was significantly more pronounced in the presence of insulin (Fig. 1, A and B). The effect of insulin was apparent after 5 h and reached statistical significance after 8-h incubation. These results indicate that insulin potentiates AVP-induced AQP2 protein expression in mpkCCDcl4 cells.
" B# K3 _8 b/ S5 F. ~% w5 Y
+ e7 K% V6 L v1 x# d! |We next studied the dose dependency of the effect of insulin on AVP-induced AQP2 protein expression. After preincubation with 10–10 M AVP for 24 h, mpkCCDcl4 cells were incubated for another 24 h in the continuous presence of AVP and in the presence of increasing concentrations of insulin added to the basal medium (Fig. 1, C and D). Results show that insulin potentiated AVP-induced AQP2 protein expression in a dose-dependent manner in AVP-treated cells. Half-maximal and maximal effects were achieved at 10–9 and 10–8 M insulin, respectively. The observed effect of low concentrations of insulin was independent of the presence of the hormone in the culture medium during the mpkCCDcl4 cell growth and differentiation phases. Indeed, 10–8 M insulin treatment for 24 h produced a similar potentiation of AVP-induced AQP2 expression by mpkCCDcl4 cells grown in either the absence or presence of insulin (data not shown). Therefore, physiological concentrations of insulin modulate AVP-induced AQP2 protein expression in mpkCCDcl4 cells.. G) x& U$ b3 T& O: d+ x
/ F+ X7 |' X0 G+ ~7 r6 J6 MWe investigated whether insulin stimulation of AQP2 protein expression is dependent on the presence of AVP. For this purpose, mpkCCDcl4 cells were serum and hormone starved for 24 h and then treated without or with 10–10 M AVP and/or 10–8 M insulin for 48 h. Results show that insulin alone induced a small increase in AQP2 protein expression (Fig. 2, A and B, lane 1 compared with lane 2) while a combination of insulin and AVP produced a more pronounced increase in AQP2 expression compared with AVP alone (Fig. 2, A and B, lane 3 compared with lane 4). These results indicate that insulin per se is not a strong inducer of AQP2 protein expression while it potentiates the stimulatory effect of AVP on AQP2 expression.
/ e3 `4 g" T4 U" q0 I" |/ ?5 d4 z- V5 J2 Q
To determine whether insulin enhances the sensitivity of mpkCCDcl4 cells to AVP, we compared the dose dependency of the effect of AVP on AQP2 expression in the absence or presence of insulin. Cells were preincubated for 24 h in the absence (Fig. 2, C and D) or presence (Fig. 2, E and F) of 10–8 M insulin added to the basal medium and then treated with increasing concentrations of AVP (from 10–12 to 10–8 M) in the continuous absence or presence of insulin for another 24 h. Results show that AVP dose dependently stimulated AQP2 expression and that half-maximal and maximal effects were achieved at 10–10 and 10–9 M AVP, respectively, and this independently of the presence or absence of insulin (Fig. 2, C and D compared with E and F). Therefore, we conclude that insulin enhances the effect of AVP on AQP2 expression without modifying the sensitivity of mpkCCDcl4 cells to AVP.
2 f% \; v. k) Z) b
' n# Q( m" I+ r5 O; HIn isolated, microperfused collecting ducts, insulin stimulates water transport when added to the bathing medium but not to the luminal perfusate, indicating a basolateral localization of insulin receptors in collecting duct cells (34). To assess whether insulin acts exclusively from the basal pole of mpkCCDcl4 cells or from both basal and apical poles, cells were pretreated with 10–10 M AVP for 24 h and then challenged for another 24 h with 10–8 M insulin added to either the basal or apical side of the filters in the continuous presence of AVP. Insulin potentiated AVP-induced AQP2 expression when added to the basal pole of mpkCCDcl4 cells but did not produce this effect when added to the apical pole (Fig. 2, G and H). These results indicate that similarly to native CD cells, the expression of functional insulin receptors is restricted to the basolateral membrane domain of mpkCCDcl4 cells. s/ p6 q& ]( z. p& c, k3 |
9 S4 B- Y& x6 G* X3 d% X. ZEffect of insulin on AQP2 mRNA expression in collecting duct principal cells. Since insulin potentiates AVP-induced AQP2 protein expression in mpkCCDcl4 cells, this effect might be dependent on an increase in AQP2 mRNA expression levels. We therefore performed real-time PCR experiments to assess the effect of insulin on AQP2 mRNA levels in mpkCCDcl4 cells. Cells were preincubated without or with 10–10 M AVP for 24 h after which 10–8 M insulin was or was not added for another 24 h. Results show that AQP2 mRNA expression levels were dramatically increased in AVP-treated cells (Fig. 3A, open bars) and confirms our previous findings obtained by ribonuclease protection assay (23). Insulin alone slightly increased AQP2 mRNA expression levels, and the effects of insulin and AVP were more than additive (Fig. 3A, filled bars). In contrast, P0 mRNA expression levels were not significantly altered by AVP and/or insulin treatment (Fig. 3B). These results indicate that insulin potentiates the effect of AVP on AQP2 mRNA in mpkCCDcl4 cells.
$ L! J0 r0 Q7 `2 h" O: |' N. T/ u, ^+ s `6 N' [# G
So far, our results suggest that insulin potentiates AVP-induced AQP2 protein expression, at least in part, by increasing AQP2 mRNA levels. To assess whether the effect of insulin is dependent on transcriptional activity, we studied the effect of actinomycin D, a transcriptional inhibitor. After preincubation for 24 h with 10–10 M AVP, mpkCCDcl4 cells were incubated for an additional 8 h in the absence or presence of 10–8 M insulin and/or 5 x 10–6 M actinomycin D. Cells incubated with actinomycin D expressed reduced levels of AQP2 protein compared with cells incubated with AVP alone (Fig. 4, A and B, lane 1 compared with lane 3). The insulin potentiation of AVP-induced AQP2 protein expression (Fig. 4, A and B, lane 1 compared with lane 2) was completely blunted by actinomycin D (Fig. 4, A and B, lane 3 compared with lane 4). We performed the same experimental protocol to analyze the effect of actinomycin D on insulin-stimulated, AVP-dependent AQP2 mRNA expression. Results of real-time PCR experiments show that actinomycin D-treated mpkCCDcl4 cells expressed similar reduced amounts of AQP2 mRNA in the absence or presence of insulin (Fig. 4C). Taken together, these results suggest that insulin increases AVP-induced AQP2 protein expression through enhanced transcription of the AQP2 gene. m+ f+ ^/ b9 e* p) D3 T) M( a4 {5 i% O/ H
) x* r1 K1 a! z/ ^. s9 Y5 M' I5 y# WEffect of insulin on AQP2 protein degradation in collecting duct principal cells. The next step in our study was to investigate the role of the protein degradation in the insulin-dependent potentiation of AVP-induced AQP2 protein expression in mpkCCDcl4 cells. Previous work has already shown that inhibitors of the lysosomal protein degradation pathway enhance AQP2 protein expression in AVP-treated mpkCCDcl4 cells and reduce AQP2 degradation in cells subjected to AVP chase (23). We therefore studied the effect of chloroquine, a weak base that increases lysosomal pH and thereby inhibits the proteolytic activity of lysosomal enzymes on insulin-induced AQP2 expression. The effect of insulin was investigated under conditions of either AVP pulse or AVP chase. Cells were first preincubated for 24 h with 10–10 M AVP and then for an additional 8 h in the absence or presence of 10–8 M insulin and/or 10–4 M chloroquine in the continuous presence of AVP (pulse condition) or after AVP washout (chase condition). As previously shown, insulin enhanced AQP2 protein expression under AVP pulse conditions (Fig. 5, A and B, lane 1 compared with lane 2), and this effect was also observed after AVP washout (Fig. 5, A and B, lane 5 compared with lane 6). As expected, chloroquine enhances AQP2 protein expression (Fig. 5, A and B, lane 1 compared with lane 3), and this effect was more pronounced when cells were subjected to AVP chase (Fig. 5, A and B, lane 5 compared with lane 7). The largest increase in AQP2 protein expression levels was observed in cells treated with both insulin and chloroquine, and under conditions of AVP pulse (Fig. 5, A and B, lane 1 compared with lane 4) as well as under conditions of AVP chase (Fig. 5, A and B, lane 5 compared with lane 8). The magnitude of the insulin-induced increase in cellular AQP2 protein content, expressed as a percentage of control (absence of insulin), remained similar in the continuous presence of AVP (60%) or after AVP washout (50%). In addition, chloroquine treatment increased the total cellular AQP2 protein content but did not significantly alter the extent of the insulin-dependent increase in AQP2 expression. These results suggest that decreased AQP2 protein degradation does not significantly participate in the potentiation of the effect of AVP on AQP2 protein expression by insulin. Moreover, these results suggest that the effect of insulin is most likely independent of an increased rate of AQP2 mRNA translation because insulin increased AVP-dependent AQP2 protein expression to the same extent in the presence or absence of chloroquine. Indeed, as shown previously in response to aldosterone (24), an increase in mRNA translation would have been revealed by a largest stimulatory effect of insulin in the presence of chloroquine.3 X+ W q3 y; C! Q7 F }0 h6 d- W
+ ~* ?. ]( V) ?Analysis of the signaling pathways involved in insulin-induced AQP2 expression in collecting duct principal cells. The next step in our study was to decipher the transduction pathway responsible for the insulin-dependent rise in AQP2 protein expression. We first assessed the role of the PI 3-kinase-dependent signaling pathway in the insulin potentiation of AVP-induced AQP2 expression. After preincubation for 24 h with 10–10 M AVP, cells were incubated for an additional 8 h in the absence or presence of 10–8 M insulin and without or with either 2.5 x 10–5 M LY-294002 or 10–7 M wortmannin, two structurally unrelated PI 3-kinase inhibitors. Western blot analyses show that both drugs prevented the insulin-dependent stimulation of AQP2 protein expression (Fig. 6, A and B, lanes 1 and 2 compared with lanes 3 and 4 and 5 and 6). Control experiments have shown that insulin, but not AVP, stimulated PI 3-kinase activity in mpkCCDcl4 cells and that wortmannin prevented this effect (Fig. 6, C and D). These results strongly suggest that stimulation of PI 3-kinase is required for increased AQP2 protein expression in response to insulin in AVP-treated cells. It should be mentioned that LY-294002 decreased the basal expression levels of AQP2 while wortmannin did not. This result suggests that PI 3-kinase does not play a major role in the control of basal AQP2 expression and that decreased AQP2 expression in response to LY-294002 rather reflects a nonspecific effect of the drug in mpkCCDcl4 cells. The role of PI 3-kinase in the modulation of AVP-dependent AQP2 protein expression was further evaluated by studying the effect of IGF-1, which stimulates PI 3-kinase activity (59), and EGF, which does not activate PI 3-kinase (25), on AVP-induced AQP2 expression. After preincubation for 24 h with 10–10 M AVP, cells were incubated for an additional 24 h in the absence or presence of 10–9 M IGF-1 or 10–9 M EGF. Figure 6, E and F, shows that IGF-1 potentiated the effect of AVP on AQP2 expression (lane 1 compared with lane 3), whereas EGF had no effect on AVP-induced AQP2 expression (lane 1 compared with lane 2). Since IGF-1 stimulates, while EGF does not alter, PI 3-kinase activity (25, 59), these results further indicate that PI 3-kinase modulates the AVP-dependent expression of AQP2 in mpkCCDcl4 cells.
" r! r% }" Z, G) s& {+ T4 E+ e! F' a! V) L' ~8 f) k5 h8 D
Since the MAPK pathway is responsible for the insulin-dependent cell growth and controls the expression levels of many cellular genes (13, 44), we investigated the role of ERK and p38 kinase pathways in insulin potentiation of AVP-induced AQP2 expression in mpkCCDcl4 cells. Cells were preincubated for 24 h with 10–10 M AVP and then for an additional 8 h in the absence or presence of 10–8 M insulin and without or with either 10–6 M U-0126, a specific MEK1 inhibitor, or 10–5 M SB-203580, a p38 kinase inhibitor. Results show that U-0126 abolished the stimulation of ERK1/2 activity by insulin, estimated by Western blotting with anti-phospho ERK antibodies (Fig. 7A). U-0126 prevented the stimulatory effect of insulin on AVP-induced AQP2 protein expression (Fig. 7, A and B, lanes 1 and 2 compared with lanes 3 and 4), whereas it did not alter the effect of AVP alone (Fig. 7A, lane 1 compared with lane 3). Control experiments have shown that insulin stimulated p38 kinase activity estimated by Western blotting with anti-phospho p38 antibodies in mpkCCDcl4 cells (Fig. 7A). Inhibition of p38 kinase activity with SB-203580 prevented the insulin-induced increase in AVP-dependent AQP2 protein expression (Fig. 7, A and B, lanes 1 and 2 compared with lanes 5 and 6). The efficacy of SB-203580 was attested to by inhibition of insulin-induced MAPKAP-2 phosphorylation, which lies downstream of p38 kinase (43) (data not shown). Therefore, the effect of insulin on AQP2 expression is dependent on both ERK and p38 kinase activities.
7 \& L5 h6 @9 \7 t8 R2 v$ l0 G! o+ F$ \3 ?+ A! U
Because activation of atypical PKC isozymes in response to insulin lies downstream of PI 3-kinase (4, 33, 47), we assessed the role that PKC may play in the insulin potentiation of AVP-induced AQP2 protein expression in mpkCCDcl4 cells. Cells were first preincubated 24 h with 10–10 M AVP and then incubated for an additional 8 h in the absence or presence of insulin and without or with 10–6 M GF-109203X, a specific PKC inhibitor. Results show that GF-109203X did not prevent the effect of insulin (Fig. 7, C and D, lanes 1 and 2 compared with lanes 3 and 4). Similar results were obtained with the broad-range PKC inhibitor H7 (data not shown). The absence of an effect of GF-109203X suggests that atypical PKC isozyme activation is not involved in the insulin-induced increase in AVP-dependent AQP2 expression in mpkCCDcl4 cells./ M% a$ L. Q8 t7 B. p. |% f! B- e( u
# H, P' y: Q V3 @
DISCUSSION
9 c7 S" I/ W# T \9 R; X" k! C l& w) I6 u
We have previously shown that physiological concentrations of AVP rapidly upregulate the low endogenous AQP2 protein expression levels of mpkCCDcl4 cells grown on permeable filters (23). We and others have shown that additional factors, including aldosterone (24), atrial natriuretic peptide (14), and extracellular osmolality (50), modulate the AVP- or cAMP-dependent AQP2 expression in cultured collecting duct cells. In the present study, we investigated the effect of insulin on AVP-induced AQP2 expression. Results showed that insulin potentiates the AVP-induced AQP2 protein expression by increasing AQP2 mRNA levels in a MAP kinase- and PI 3-kinase-dependent manner.
1 S9 }' g7 M r4 G- l, {" G. S1 \; o( O
The results of the present study show that insulin induced a coordinated stimulation of AQP2 mRNA and protein expression in AVP-treated mpkCCDcl4 cells (see Figs. 1 and 3). Inhibition of transcription by actinomycin D strongly reduced AQP2 mRNA levels of AVP-treated cells, in agreement with our previous observations (23), and fully prevented the stimulatory effect of insulin on AVP-dependent expression levels of both AQP2 mRNA and protein (see Fig. 4). This observation suggests that increased amounts of AQP2 mRNA are directly responsible for the insulin-dependent increase in AVP-induced AQP2 protein content. Insulin may increase AVP-induced AQP2 mRNA levels by increasing AQP2 gene transcription via modulation of the binding capacity of one or several transcription factors that activate or repress AQP2 gene transcription. Indeed, functional cAMP-responsive element and activator protein-1 binding sites as well as a negatively acting cis-element have been identified in a fragment of the AQP2 promoter (58). Alternatively, insulin may increase AQP2 mRNA stability, resulting in increased mRNA half-life. Regulation of mRNA degradation plays a major role in the control of the expression of specific genes and largely relies on the presence of cis-acting sequences along the sequence of the transcript. Binding of specific proteins to these sequences either target mRNA for degradation or increase mRNA stability (9). The influence of insulin on AQP2 gene transcription and AQP2 mRNA stability remains to be investigated.4 z9 M' ~# d9 E8 t1 l8 `* L3 r
6 x$ h9 [& e0 V" Q' R
In addition to increased mRNA levels, AQP2 protein expression levels can be controlled via modulation of AQP2 mRNA translation and/or AQP2 protein degradation. Previous results from our laboratory have shown that aldosterone increased the turnover of AQP2 protein, implying both increased AQP2 protein synthesis and degradation (24). Results from the present study confirmed that inhibition of the lysosomal protein degradation pathway by chloroquine increased the amounts of cellular AQP2 protein in both the continuous presence of AVP or following AVP washout (23). Insulin increased AVP-dependent AQP2 protein expression levels in a proportional manner in the absence or presence of chloroquine (see Fig. 5). This observation strongly suggests that enhanced translation of AQP2 mRNA and/or decreased degradation of AQP2 protein does not contribute to the rise in AQP2 protein cellular content in response to insulin in AVP-treated collecting duct principal cells.
2 x5 p0 f# S9 C u) b! t
; N/ D' j$ x7 Q3 yOur present results show that insulin slightly stimulated both AQP2 mRNA and protein expression while it potentiated the effect of AVP (see Figs. 2 and 3). Since experiments were performed using a physiological but submaximal concentration of AVP (10–10 M), we addressed the possibility that insulin may have increased the sensitivity of mpkCCDcl4 cells to AVP, resulting in higher AQP2 expression levels in response to lower AVP concentrations. Results clearly show that insulin does not alter the dose responsiveness of AQP2 protein expression in response to AVP (see Fig. 2). This observation suggests that insulin and AVP regulate cellular AQP2 protein content through independent but cooperative mechanisms that control AQP2 mRNA expression. Theoretically, this effect could be accounted for by modulation of AQP2 gene transcription and/or AQP2 mRNA stability. Since inhibition of transcription by actinomycin D abolished the effect of insulin (see Fig. 3) and since several regulatory elements were identified along the sequence of the AQP2 gene promoter (58), enhanced AQP2 gene transcription through altered transcription factor binding that enhance or repress transcriptional activity would be an appealing hypothesis.
) g2 p0 o: v5 f7 r: U" H
, Z! g( c: t& f3 V0 \Insulin classically activates ERK through recruitment of the Grb2-Sos complex IRS proteins (54), leading to activation of the Ras-Raf1-MEK1-ERK1/2 pathway (57). Activation of Raf1 by the atypical PKC and - isoforms represents an alternative ERK-1/2 activation pathway in response to insulin (13, 45). Active ERK1/2 is translocated to the nucleus and phosphorylates various transcription factors, including Elk1 and c-Myc (44). On the other hand, several investigators have demonstrated that insulin also activates p38 kinase (21, 46). Activated p38 kinase subsequently phosphorylates and modulates the function of several transcription factors, including ATF2 (39), Elk1 (40), and Max (61). Our results indicate that, as in most cell types, insulin activated both ERK1/2 and p38 kinase in mpkCCDcl4 cells (see Fig. 7A). Pharmacological inhibition of either ERK or p38 kinase prevented the insulin potentiation of an AVP-induced increase in AQP2 expression (see Fig. 7), suggesting that both kinases are required for the insulin-induced increase in AVP-dependent AQP2 mRNA expression. Max, a p38 kinase substrate, heterodimerizes with cMyc, an ERK1/2 substrate (57), raising the possibility that cMyc/Max heterodimers control the transcription rate of the AQP2 gene.
- J) }, h. Q& b* y+ o' }" r7 O& f7 l) i. c! ^$ g; |( |4 \
Most metabolic effects of insulin rely on type 1A PI 3-kinase activation, leading to the generation of phosphoinositide (3,4,5)-triphosphate (PIP3) (19). PIP3 recruits and activates proteins containing pleckstin homology domains, including Akt/PKB and the 3'-phosphoinositide-dependent kinase-1 (PDK1) (41). In turn, PDK1 phosphorylates and activates downstream effectors, including Akt (49) and atypical PKC- and - isoforms (4, 29, 33, 47). Our results show that insulin induces a sustained activation of type 1A PI 3-kinase in mpkCCDcl4 cells and that PI 3-kinase activation is required for the stimulatory effect of insulin on AVP-dependent AQP2 expression (see Fig. 6). Furthermore, IGF-1, which also stimulates PI 3-kinase activity (59), mimicked the effect of insulin on AVP-induced AQP2 expression, whereas EGF, which does not activate PI 3-kinase (25), did not alter AQP2 expression (see Fig. 6E). PKC activation, lying downstream of PI 3-kinase, is most likely not involved in the effect of insulin since GF-109203X, used at a concentration that inhibits atypical PKC isoforms, did not alter the insulin-induced rise in AVP-dependent AQP2 expression (see Fig. 7, C and D). The PI 3-kinase dependency of the effect of insulin may rely on PDK1-mediated activation of RSK (26). Indeed, activation of RSK requires phosphorylation by both PDK1 and ERK (42) and results in activation of c-Jun (57) and possibly increased AQP2 gene transcription through activator protein-1 binding to the AQP2 promoter (58).# W( }% i, n& h
( c8 ?+ p; n6 {" n `7 t! b ^0 zSeveral investigators have pointed out that in addition to its major anabolic effects, insulin also controls water and sodium handling by the kidney (12, 17). Early observations showed that in insulin-dependent diabetes mellitus, polyuria and sodium wasting cannot be explained by osmotic diuresis alone and that excretion of water and sodium is normalized by insulin therapy (3). The stimulatory effect of insulin on renal sodium and water reabsorption was confirmed in isolated dog kidney preparations (37). The antinatriuretic effect of insulin is, at least in part, explained by stimulation of both the epithelial sodium channel (16) and Na-K-ATPase (17), leading to increased reabsorption in the collecting duct. In addition, in vitro microperfusion studies have shown that insulin increases water permeability and thereby water reabsorption in the collecting duct (34). Therefore, insulin stimulates both sodium and accompanying water reabsorption in the collecting duct. In the present study, we show that in addition to its acute stimulatory effect on water permeability, insulin potentiates AVP-induced expression of AQP2, the major determinant of water permeability, in collecting duct cells. These observations suggest that insulin may strengthen the water-sparing effect of AVP during the postprandial period, which is characterized by an increased filtered water load and which consequently prevents inappropriate water loss. Insulin-dependent diabetes mellitus is associated with enhanced renal concentrating ability in relation to increased AQP2 expression (5) secondary to nonosmotic AVP release in response to hypovolemia (6, 60). However, heavy insulin deprivation characterizing this setting would reduce the maximal stimulatory effect of AVP on AQP2 expression, leading to negative water balance despite high levels of circulating AVP. Finally, the stimulatory effect of insulin on AVP-dependent AQP2 expression may contribute to hypertension associated with chronic hyperinsulinemia (10). Indeed, hyperinsulinemia is associated with increased sodium reabsorption (12), and insulin stimulation of AVP-dependent AQP2 expression would allow increased reabsorption of accompanying water to maintain extracellular isotonicity.* g% [# b* t# U- O4 {0 ~
' O5 ]. G2 F# C* m* b" {3 C
GRANTS
% |5 @/ q0 ~* v; z. d. L0 K( ^) W3 y+ Q
This work was supported in part by Swiss National Foundation Grant 31–67878.02 and a Carlos and Elsie deReuter Foundation grant to E. Féraille.! K0 R- r9 \& Y# w
! q3 _8 A: I+ W8 c5 b8 o, kFOOTNOTES
0 k7 a' s3 G7 w c2 P) e3 a& F" i2 u9 u" G
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
; z& ^* l, n+ s. B2 y; I; ^' E4 A. S( e6 v
REFERENCES: u0 n: n) x- `1 ]( j
+ c* H. Y2 @7 n2 n) g XAlessi DR and Downes CP. The role of PI 3-kinase in insulin action. Biochim Biophys Acta 1436: 151–164, 1998., w6 w/ E: n2 m) [
+ G( h) `4 F+ D$ O* M- E
Antonetti DA, Algenstaedt P, and Kahn CR. Insulin receptor substrate 1 binds two novel splice variants of the regulatory subunit of phosphatidylinositol 3-kinase in muscle and brain. Mol Cell Biol 16: 2195–2203, 1996.
2 S! q$ f- D- W5 e8 `) v j8 p. M+ S( h! D
Atchley DW, Loeb RF, Richards DW, Benedict EM, and Driscoll ME. On diabetic acidosis. J Clin Invest 12: 297–326, 1933.4 d4 `9 V/ x% j. U. k
! L0 y: a0 E0 a: B; ~( nBandyopadhyay G, Standaert ML, Zhao L, Yu B, Avignon A, Galloway L, Karnam P, Moscat J, and Farese RV. Activation of protein kinase C (, , and ) by insulin in 3T3/L1 cells. Transfection studies suggest a role for PKC- in glucose transport. J Biol Chem 272: 2551–2558, 1997.
$ Y5 i, `9 J- T+ t2 y
& M" O4 Z. J g \7 G7 x& PBardoux P, Ahloulay M, Le Maout S, Bankir L, and Trinh-Trang-Tan MM. Aquaporin-2 and urea transporter-A1 are up-regulated in rats with type I diabetes mellitus. Diabetologia 44: 637–645, 2001.
2 [: z% T6 N3 o/ b- J) ^( B! N+ Y8 o: l9 k5 b% y
Bardoux P, Martin H, Ahloulay M, Schmitt F, Bouby N, Trinh-Trang-Tan MM, and Bankir L. Vasopressin contributes to hyperfiltration, albuminuria, and renal hypertrophy in diabetes mellitus: study in vasopressin-deficient Brattleboro rats. Proc Natl Acad Sci USA 96: 10397–10402, 1999.
% Y6 o$ l; z! C- o
. x8 P# E: u+ B/ N0 k+ V3 {8 w. hBaum M. Insulin stimulates volume absorption in the rabbit proximal convoluted tubule. J Clin Invest 79: 1104–1109, 1987.
k+ e9 x! S! Q7 A E/ x) l0 _* L- l) [- X; ]
Bens M, Vallet V, Cluzeaud F, Pascual-Letallec L, Kahn A, Rafestin-Oblin ME, Rossier BC, and Vandewalle A. Corticosteroid-dependent sodium transport in a novel immortalized mouse collecting duct principal cell line. J Am Soc Nephrol 10: 923–934, 1999.
: x2 z4 h& }+ C6 v) M1 K+ ~/ J; _" W! J# r
Brown AJ. mRNA translation and turnover: a cellular perspective on their relationship. Trends Cell Biol 3: 180–183, 1993.* Z) H6 f( ]. w; `9 I
6 L; P% a2 |* s! i. aChiappe De Cingolani GE and Caldiz CI. Insulin resistance and GLUT-4 glucose transporter in adipocytes from hypertensive rats. Metabolism 53: 382–387, 2004./ r: F7 F1 y: u6 m4 s7 Q
8 }+ E( w3 c7 H9 `; b! n# p; bColeman RA, Wu DC, Liu J, and Wade JB. Expression of aquaporins in the renal connecting tubule. Am J Physiol Renal Physiol 279: F874–F883, 2000.
( s; c- L. i0 [5 q, j2 B5 R6 K3 `- z: F& k( f
DeFronzo RA, Cooke CR, Andres R, Faloona GR, and Davis PJ. The effect of insulin on renal handling of sodium, potassium, calcium, and phosphate in man. J Clin Invest 55: 845–855, 1975.
7 |: E8 s- F6 u2 S) |
9 V& s9 n5 V+ ?( k2 G/ TDenton RM and Tavare JM. Does mitogen-activated-protein kinase have a role in insulin action The cases for and against. Eur J Biochem 227: 597–611, 1995.
) v- A$ C; e5 p4 c ~* q1 m; V8 g) Q/ ~1 B
Dillingham MA and Anderson RJ. Inhibition of vasopressin action by atrial natriuretic factor. Science 231: 1572–1573, 1986.% I+ t6 y" t4 e; E9 { Z& R
( t4 s6 z n* ~. i9 l8 f
Earm JH, Christensen BM, Frkir J, Marples D, Han JS, Knepper MA, and Nielsen S. Decreased aquaporin-2 expression and apical plasma membrane delivery in kidney collecting ducts of polyuric hypercalcemic rats. J Am Soc Nephrol 9: 2181–2193, 1998.0 g& |" O) }. }0 s
* t; L, r4 s7 q$ ]2 g# h0 x
Ecelbarger CA, Kim GH, Wade JB, and Knepper MA. Regulation of the abundance of renal sodium transporters and channels by vasopressin. Exp Neurol 171: 227–234, 2001.
8 J8 Q$ T9 ]* F% y0 a
! v& {) o l' [! GFéraille E, Marsy S, Cheval L, Barlet-Bas C, Khadouri C, Favre H, and Doucet A. Sites of antinatriuretic action of insulin along rat nephron. Am J Physiol Renal Fluid Electrolyte Physiol 263: F175–F179, 1992.
1 m3 |, f. P$ _& v+ r( O
2 A5 S z& s: ~Fernandez-Llama P, Andrews P, Ecelbarger CA, Nielsen S, and Knepper M. Concentrating defect in experimental nephrotic syndrone: altered expression of aquaporins and thick ascending limb Na transporters. Kidney Int 54: 170–179, 1998.
) M; ?6 l; Y3 d- n, q2 T- o8 K' {0 Y0 `" e8 W7 o
Fruman DA, Meyers RE, and Cantley LC. Phosphoinositide kinases. Annu Rev Biochem 67: 481–507, 1998.0 B8 h( p+ [# ?+ c- E7 X( P' z, D# x
' X* c3 ]- R, o6 {6 ~0 d6 `- {
Fujita N, Ishikawa SE, Sasaki S, Fujisawa G, Fushimi K, Marumo F, and Saito T. Role of water channel AQP-CD in water retention in SIADH and cirrhotic rats. Am J Physiol Renal Fluid Electrolyte Physiol 269: F926–F931, 1995.
: u1 w1 M( s& k1 J q. G
! g7 r _6 t0 H+ t, U4 fFurtado LM, Somwar R, Sweeney G, Niu W, and Klip A. Activation of the glucose transporter GLUT4 by insulin. Biochem Cell Biol 80: 569–578, 2002.: z, a( N* K6 n4 @+ [( ^/ c0 Q
# @, e9 r+ G( ?' p3 V) B) [Fushimi K, Uchida S, Hara Y, Hirata Y, Marumo F, and Sasaki S. Cloning and expression of apical membrane water channel of rat kidney collecting tubule. Nature 361: 549–552, 1993.
6 E7 q9 j/ Q+ u
: e$ L7 Y& i! k/ P7 }* v2 cHasler U, Mordasini D, Bens M, Bianchi M, Cluzeaud F, Rousselot M, Vandewalle A, Féraille E, and Martin PY. Long term regulation of aquaporin-2 expression in vasopressin-responsive renal collecting duct principal cells. J Biol Chem 277: 10379–10386, 2002.
4 q P) a: ~+ b# K7 O& i; u3 D+ _
Hasler U, Mordasini D, Bianchi M, Vandewalle A, Féraille E, and Martin PY. Dual influence of aldosterone on AQP2 expression in cultured renal collecting duct principal cells. J Biol Chem 278: 21639–21648, 2003.
# a, T7 E/ V) S5 G8 l
, P e" v' ^& ]; o( X( rIwabu A, Smith K, Allen FD, Lauffenburger DA, and Wells A. EGF induces fibroblast contractility and motility via a PKC-dependent pathway. J Biol Chem 279: 14551–14560, 2004.
8 J3 f, o; Y8 J7 I) P2 j3 y0 i3 U, `% ^0 y& d. }
Jensen CJ, Buch MB, Krag TO, Hemmings BA, Gammeltoft S, and Frodin M. 90-kDa ribosomal S6 kinase is phosphorylated and activated by 3-phosphoinositide-dependent protein kinase-1. J Biol Chem 274: 27168–27176, 1999.' E1 g' p2 a& g
( \! R1 z" M0 v3 f% I: p! {+ N1 T8 r
Katsura T, Ausiello DA, and Brown D. Direct demonstration of aquaporin-2 water channel recycling in stably transfected LLC-PK1 epithelial cells. Am J Physiol Renal Fluid Electrolyte Physiol 270: F548–F553, 1996.
- C" ~: G0 G' |2 _9 P: F
6 z |# c# Z+ {7 bKnepper MA. Molecular physiology of urinary concentrating mechanism: regulation of aquaporin water channels by vasopressin. Am J Physiol Renal Physiol 272: F3–F12, 1997.
: M. ~8 l5 I$ n5 S! `% W5 h
( E* Z) J& C, t4 JKotani K, Ogawa W, Matsumoto M, Kitamura T, Sakaue H, Hino Y, Miyake K, Sano W, Akimoto K, Ohno S, and Kasuga M. Requirement of atypical protein kinase lambda for insulin stimulation of glucose uptake but not for Akt activation in 3T3-L1 adipocytes. Mol Cell Biol 18: 6971–6982, 1998.
S2 D4 @' G' j: T7 e) J9 k) }
2 R# U. z( }9 i5 |+ ?9 o; ~ R2 AKwon TH, Frkir J, Fernandez-Llama P, Knepper MA, and Nielsen S. Reduced abundance of aquaporins in rats with bilateral ischemia-induced acute renal failure: prevention by -MSH. Am J Physiol Renal Physiol 277: F413–F427, 1999.
, l" b' X* h1 R# d( E) U
7 i. z& e$ p1 W. J! u. aKwon TH, Frkir J, Knepper MA, and Nielsen S. Reduced AQP1, -2, and -3 levels in kidneys of rats with CRF induced by surgical reduction in renal mass. Am J Physiol Renal Physiol 275: F724–F741, 1998.
U5 L1 }" T$ H, D: {3 d3 I; ?
- j3 R) d, w* g. H, ~/ }Kwon TH, Laursen UH, Marples D, Maunsbach AB, Knepper MA, Frkir J, and Nielsen S. Altered expression of renal AQPs and Na transporters in rats with lithium-induced NDI. Am J Physiol Renal Physiol 279: F552–F564, 2000.; G- ^* v, w# B- L6 n' J
) W$ f6 h" O$ [5 Q( j
Le Good JA, Ziegler WH, Parekh DB, Alessi DR, Cohen P, and Parker PJ. Protein kinase C isotypes controlled by phosphoinositide 3-kinase through the protein kinase PDK1. Science 281: 2042–2045, 1998.
?5 N" ]2 z+ N9 M, X9 R$ k8 T" w- s! D3 v9 k$ b9 s; d( b
Magaldi AJ, Cesar KR, and Yano Y. Effect of insulin on water and urea transport in the inner medullary collecting duct. Am J Physiol Renal Fluid Electrolyte Physiol 266: F394–F399, 1994.
9 R. C7 n& f; Y+ l/ u4 Y7 `
1 x' C6 H$ |5 n+ s3 sMarples D, Frkir J, Dorup J, Knepper MA, and Nielsen S. Hypokalemia-induced downregulation of aquaporin-2 water channel expression in rat kidney medulla and cortex. J Clin Invest 97: 1960–1968, 1996.
5 x2 U, F) a( e+ r. _2 N. f ~, V5 w! a% s3 }' U& x
Nielsen S, DiGiovanni SR, Christensen EI, Knepper MA, and Harris HW. Cellular and subcellular immunolocalization of vasopressin-regulated water channel in rat kidney. Proc Natl Acad Sci USA 90: 11663–11667, 1993.
" V; i+ t# M D0 |
7 a( q% R% Q/ \+ tNizet A, Lefebvre P, and Crabbe J. Control by insulin of sodium potassium and water excretion by the isolated dog kidney. Pflügers Arch 323: 11–20, 1971.% K: M$ n" c' l0 N& ?
# [* L5 e1 T9 W6 z: t: ]/ h1 xOhara M, Martin PY, Xu DL, St John J, Pattison TA, Kim JK, and Schrier RW. Upregulation of aquaporin 2 water channel expression in pregnant rats. J Clin Invest 101: 1076–1083, 1998.
, O1 c1 [5 g* l+ H' d9 l. |! X) E1 @6 Y+ t0 r
Raingeaud J, Gupta S, Rogers JS, Dickens M, Han J, Ulevitch RJ, and Davis RJ. Pro-inflammatory cytokines and environmental stress cause p38 mitogen-activated protein kinase activation by dual phosphorylation on tyrosine and threonine. J Biol Chem 270: 7420–7426, 1995.0 T& s6 m# e1 a! n) o7 z! y s* ?
( ?! u6 k3 F. k( ~- `( Z) CRaingeaud J, Whitmarsh AJ, Barrett T, Derijard B, and Davis RJ. MKK3- and MKK6-regulated gene expression is mediated by the p38 mitogen-activated protein kinase signal transduction pathway. Mol Cell Biol 16: 1247–1255, 1996.$ w/ |+ t' z h8 J X. T+ Q
5 V: F! G2 e8 R! [$ `: CRameh LE and Cantley LC. The role of phosphoinositide 3-kinase lipid products in cell function. J Biol Chem 274: 8347–8350, 1999.4 Z* k9 W5 \$ D3 n6 j1 V0 n. g& t
3 N# q* n0 r x( r8 Q5 LRichards SA, Dreisbach VC, Murphy LO, and Blenis J. Characterization of regulatory events associated with membrane targeting of p90 ribosomal S6 kinase 1. Mol Cell Biol 21: 7470–7480, 2001.
6 Q) g" v) x" C: @0 q. \$ L) ]# m
3 h4 m Q$ ^: k/ TRouse J, Cohen P, Trigon S, Morange M, Alonso-Llamazares A, Zamanillo D, Hunt T, and Nebreda AR. A novel kinase cascade triggered by stress and heat shock that stimulates MAPKAP kinase-2 and phosphorylation of the small heat shock proteins. Cell 78: 1027–1037, 1994.
9 O( v. i. }# u! x+ d. ~
! I7 A4 O% _8 v/ U6 o( r" ySeger R and Krebs EG. The MAPK signaling cascade. FASEB J 9: 726–735, 1995.3 C4 ^, N$ {# b. Z% X
- {$ s) T. [7 cSkolnik EY, Batzer A, Li N, Lee CH, Lowenstein E, Mohammadi M, Margolis B, and Schlessinger J. The function of GRB2 in linking the insulin receptor to Ras signaling pathways. Science 260: 1953–1955, 1993.3 w6 P9 |9 O# p+ @; S. C
+ {% w6 i1 i( { r& w! O. k4 m/ tSomwar R, Perreault M, Kapur S, Taha C, Sweeney G, Ramlal T, Kim DY, Keen J, Cote CH, Klip A, and Marette A. Activation of p38 mitogen-activated protein kinase and by insulin and contraction in rat skeletal muscle: potential role in the stimulation of glucose transport. Diabetes 49: 1794–1800, 2000.$ A1 T6 ]" c4 G- z
: E; s) a; e4 U7 u' tStandaert ML, Galloway L, Karnam P, Bandyopadhyay G, Moscat J, and Farese RV. Protein kinase C- as a downstream effector of phosphatidylinositol 3-kinase during insulin stimulation in rat adipocytes. Potential role in glucose transport. J Biol Chem 272: 30075–30082, 1997.
# K( b, L2 H: Y7 ?
3 F) F1 Y; j$ s8 x2 q2 [0 JSteiler TL, Galuska D, Leng Y, Chibalin AV, Gilbert M, and Zierath JR. Effect of hyperglycemia on signal transduction in skeletal muscle from diabetic Goto-Kakizaki rats. Endocrinology 144: 5259–5267, 2003.2 M# H5 a5 o- Q R
% O9 q, E$ n$ X- gStephens L, Anderson K, Stokoe D, Erdjument-Bromage H, Painter GF, Holmes AB, Gaffney PR, Reese CB, McCormick F, Tempst P, Coadwell J, and Hawkins PT. Protein kinase B kinases that mediate phosphatidylinositol 3,4,5-trisphosphate-dependent activation of protein kinase B. Science 279: 710–714, 1998.( Y& c# ?9 ~5 c. J
9 G6 a' t# G u9 ~7 l7 \6 oStorm R, Klussmann E, Geelhaar A, Rosenthal W, and Maric K. Osmolality and solute composition are strong regulators of AQP2 expression in renal principal cells. Am J Physiol Renal Physiol 284: F189–F198, 2003.9 E" L a- \: y& P ^
, W+ C0 a' J9 W& A; m* b" d6 I( Y* b
Summa V, Mordasini D, Roger F, Bens M, Martin PY, Vandewalle A, Verrey F, and Féraille E. Short term effect of aldosterone on Na,K-ATPase cell surface expression in kidney collecting duct cells. J Biol Chem 276: 47087–47093, 2001.
/ D/ w% s3 [9 k( Y
, Z0 n3 K8 B% H& |6 ^Terris J, Ecelbarger CA, Marples D, Knepper MA, and Nielsen S. Distribution of aquaporin-4 water channel expression within rat kidney. Am J Physiol Renal Fluid Electrolyte Physiol 269: F775–F785, 1995.- z6 J- X- T; y7 ^
; O" F ^" E7 u8 z
Ullrich A, Bell JR, Chen EY, Herrera R, Petruzzelli LM, Dull TJ, Gray A, Coussens L, Liao YC, Tsubokawa M, Mason A, Seeburg PH, Grunfeld C, Rosen OM, and Ramachandran J. Human insulin receptor and its relationship to the tyrosine kinase family of oncogenes. Nature 313: 756–761, 1985.
5 s) a" g# F5 p/ V" n2 _9 }& P h) }+ m6 `. h
Virkamaki A, Ueki K, and Kahn CR. Protein-protein interaction in insulin signaling and the molecular mechanisms of insulin resistance. J Clin Invest 103: 931–943, 1999.; `# c8 @3 o" s( p0 y/ I* v
2 [+ B! O" ]2 p. H
Wang W, Li C, Kwon TH, Knepper MA, Frkir J, and Nielsen S. AQP3, p-AQP2, and AQP2 expression is reduced in polyuric rats with hypercalcemia: prevention by cAMP-PDE inhibitors. Am J Physiol Renal Physiol 283: F1313–F1325, 2002.
$ c; q$ p6 J0 ?; E" V* e% U; x; U2 D
White MF. IRS proteins and the common path to diabetes. Am J Physiol Endocrinol Metab 283: E413–E422, 2002.: w$ \# Q* |! P8 ?9 A" F' z, p5 G0 a4 w
, |7 r) e: Y1 @4 X& Q
Widmann C, Gibson S, Jarpe MB, and Johnson GL. Mitogen-activated protein kinase: conservation of a three-kinase module from yeast to human. Physiol Rev 79: 143–180, 1999. L3 _1 ]) O4 N$ X
: f$ Y1 K1 O* B5 D3 eYasui M, Zelenin SM, Celsi G, and Aperia A. Adenylate cyclase-coupled vasopressin receptor activates AQP2 promoter via a dual effect on CRE and AP1 elements. Am J Physiol Renal Physiol 272: F443–F450, 1997.# B" ^1 J6 G! `
$ @* h+ a7 R: v q1 a3 QZahradka P, Litchie B, Storie B, and Helwer G. Transactivation of the insulin-like growth factor-1 receptor by angiotensin II mediates downstream signalling from the angiotensin II type 1 receptor to phosphatidylinositol 3-kinase. Endocrinology 145: 2978–2987, 2004.
2 G+ @# W, f$ y8 O: @
1 J4 v; @/ C% b, d8 [Zerbe RL, Vinicor F, and Robertson GL. Plasma vasopressin in uncontrolled diabetes mellitus. Diabetes 28: 503–508, 1979.4 H: U5 e0 k3 _2 ~+ f
0 v; F( h6 `8 {; o
Zervos AS, Faccio L, Gatto JP, Kyriakis JM, and Brent R. Mxi2, a mitogen-activated protein kinase that recognizes and phosphorylates Max protein. Proc Natl Acad Sci USA 92: 10531–10534, 1995.(Mauro Bustamante, Udo Has) |
|