|

- 积分
- 0
- 威望
- 0
- 包包
- 0
|

作者:JieXu, ZhaohuiWang, SharoneBarone, MilanPetrovic, HassaneAmlal, LauraConforti, SnezanaPetrovic, ManoocherSoleimani,作者单位:1 Division of Nephrology, Department of Medicine,University of Cincinnati, and Veterans AffairsMedical Center, Cincinnati, Ohio 45267-0585
" Z! q0 i/ }+ Y# R: @+ ?$ f
& ]- T/ P+ n; Z4 I: q% ~
) J5 s- e+ g4 ]! F
; O& y1 p# y: ~2 R0 ]9 O3 {# b
5 m' k6 t \; ^3 w* a& E/ N7 @ & `! T* G+ v3 }' K% D
1 i5 [ x4 _' e
, c. b) N/ _0 g. `/ }. B $ A. R( E, f5 f5 i
" ~2 ^3 z* c [: G
3 ]$ t" q& q( t2 d' u" | + i7 h: g; G. _! c
4 D) s' n# Q+ r' y
【摘要】
5 m6 F( [! _+ m4 ~+ u The purpose of the present studies was toexamine the renal distribution and functional properties ofNa -HCO 3 − cotransporter type 4 (NBC4), thelatest NBC isoform to be identified. Zonal distribution studies in ratkidney by Northern blot hybridization and RT-PCR demonstrated that NBC4is highly abundant in the outer medulla and cortex but is low in theinner medulla. Nephron segment distribution studies indicated that NBC4is predominantly expressed in the medullary and cortical thickascending limb of the loop of Henle. Using specific primers on thebasis of the published sequence (GenBank accession no. AF-207661), afull-length NBC4 variant was cloned from human liver and examined. Thesequence of this variant (called NBC4e) is shorter by 86 amino acidsvs. the published sequence. Xenopus laevis oocytes injected with the full-length NBC4e cRNA were compared withNBC1-expressing oocytes. Although exposure of NBC1-expressing oocytesto CO 2 /HCO 3 − resulted in immediatehyperpolarization, the NBC4-expressing oocytes did not show anyalteration in membrane potential. NBC activity in oocytes, assayed asthe Na -dependent, HCO 3 − -mediatedintracellular pH recovery from acidosis, indicated that NBC4 is aDIDS-inhibitable NBC. We propose that NBC4 is expressed in the thickascending limb of the loop of Henle and mediates cellularHCO 3 − uptake in this segment. ) H# B) `8 h6 ], a* C) P: {( t( p
【关键词】 sodiumbicarbonate cotransporter NBC NBC acidbasetransporters thick limb of the loop of Henle3 K0 I( S0 V2 r
INTRODUCTION
; V2 o. h) }0 |" \3 |8 Y. ~6 T! U' ^3 t& x, P1 q" K0 ?! K- B1 d
FIRST DESCRIBED IN THE KIDNEY, the Na -HCO 3 − cotransporter(NBC) is responsible for the bulk of HCO 3 − reabsorption across the basolateral membrane of kidney proximal tubule( 3, 6, 9, 32, 33 ). Subsequent studies have shownthe presence of NBC in numerous tissues, including brain, liver,cornea, heart, and lung, suggesting that the process of Na -dependent HCO 3 − flux has an important role in overall HCO 3 − transport in both epithelial andnonepithelial cells ( 7, 15-17, 21, 23, 24, 27 ).
6 g* M0 Z' N" h3 [
; c* x( H/ h1 F7 q8 KOn the basis of functional data, the presence of more than one NBCisoform was suggested ( 3, 6, 8, 9, 12, 32-34, 39 ).Recent molecular cloning experiments have confirmed this prediction byidentifying four NBC isoforms (NBC1-4) and two related proteins(NCBE and AE4) ( 1, 2, 4, 10, 11, 13, 20, 25, 26, 28, 29, 33, 34, 36, 39 ). For each NBC isoform, a number of splice variants havebeen identified. NBC1 has four distinct splice variants, with kidney(kNBC1) and pancreatic (pNBC1) variants being the two most abundantones ( 1, 2, 10, 11, 28, 29, 33 ). With respect to NBC2,three splice variants have been identified. These are retinal NBC2,skeletal muscle NBC3 (mNBC3), and vascular NBCn1, which is a ratortholog of NBC2 ( 13, 20, 25 ). NBC3 has three identifiedsplice variants, with kNBC3 (also referred to as NDCBE) being the mostcommon ( 4, 19, 40 ). NBC4 has three variants that have beenreported so far ( 26, 31 ). These are referred to as NBC4a-c( 26, 31 ). NBC1-3 mediateNa -HCO 3 − cotransport, and NCBE works as aNa -dependent Cl /HCO 3 − exchanger (reviewed in Refs. 32 and 33 ). Despitestructural homology to NBCs, AE4 does not transport Na andworks only in Cl /HCO 3 − exchange mode( 36 ). NBC4 is the latest member of the NBC family to becloned ( 26, 31 ); however, little is known about itsfunctional properties and renal distribution. A dendrogram of theNBC/AE family demonstrates that NBC4 cDNA has the highest homology toNBC1, whereas NBC2 is closely related to NBC3 ( 33 ).7 ?3 c' h* U( P: B2 H( _& d ~
8 j; u' ]9 o5 v! b, G* {: SThe purpose of the present studies was to study the renal distributionand functional properties of NBC4. Specifically, we were interested incomparing the electrogenicity of this transporter vs. NBC1, as bothshow the highest degree of homology to each other.
% N+ x ^9 X! |# l2 y
+ Q( x2 Z' y$ _# I2 ^EXPERIMENTAL PROCEDURES
2 y' L |) K: i: ^% C# _+ p g* l' S+ z! H; x
RNA Isolation
. r8 l8 i5 ^) N) |- E1 b: Z
! B9 Y; `1 F& K/ g/ `8 [8 [RNA was extracted from various rat tissues by using TriReagent(Molecular Research, Cincinnati, OH) according to the manufacturer's instructions. The extracted RNA was quantitated spectrophotometrically and stored at 80°C.. [; _* A8 |5 l; H
2 W/ Z: ~: v4 y: o3 O' ~
Northern Blot Hybridization$ @1 S; p1 F5 r" C& m( K
) G& b+ j' f+ [8 `$ b
RNA samples (30 µg/lane) were fractionated on 1.2%agarose-formaldehyde gels and transferred to nylon membranes. RNA wascovalently bound to the nylon membranes by ultraviolet cross-linking.Hybridization was performed according to established methods and asused previously ( 4 ), with [ 32 P]dCTP (NEN,Boston, MA)-labeled cDNA probes. Radiolabeled blots were exposed toPhosphorImager storage screens for 24-72 h and imaged by usingImageQuant software (Molecular Dynamics). For NBC4, a PCR fragmentencoded by the rat NBC4-specific primers (ATGGTTGACCGATCCTTG andGCTGGCTCTTAATAATGATGGC for the sense and antisense directions,respectively) was purified from the rat kidney cortex RNA and used as aspecific probe for Northern blot hybridization. For NBC1, an ~700-bpPCR fragment corresponding to nucleotides 1910-2650 of the ratkidney NBC1 cDNA was used as a specific probe.
- B, T# ?9 [9 W: x3 R$ ^; Z
: n X e4 s+ b& w/ x0 `# tNephron Segment Distribution of NBC4 in Rat$ N7 d f# e7 D V( w2 M) i
! ?7 i# z( |' q/ o3 o' c
To examine the tissue and nephron segment distribution of NBC4in rat, a rat NBC4 cDNA fragment was cloned by RT-PCR. The followingprimers were designed on the basis of the human NBC4 cDNA sequence: GCCAGC TAT GCA TGA AAT TG (sense) and ATG GGT CCT GTG CTG CTG AG(antisense). Using a gradient-based RT-PCR cycler, a cDNA fragment of1.1 kb, which is the expected size for the fragment, was amplified fromrat kidney. The cDNA sequence of this fragment is 76% homologous tohuman NBC4. Rat-specific primers (ATGGTTGACCGATCCTTG andGCTGGCTCTTAATAATGATGGC for the sense and antisense directions,respectively) were designed on the basis of the sequence of theamplified fragment and used for NBC4 RT-PCR. The rat PCR fragmentcorresponds to nucleotides 1434-1751 of NBC4a (AF-243499),1781-2098 of NBC4b (NM-033323), 1781-2098 of NBC4c(AF-293337), and 1615-1932 of NBC4e (AF-452248). This fragment istherefore common to all NBC4 variants that have been cloned to date.. J% F. a) I' B0 o2 r7 _- {
- C3 ~7 U- }/ J- ~* y
Single nephron segments from the medullary thick ascending limb (mTAL),cortical thick ascending limb (cTAL), proximal straight tubule, orcortical collecting duct (CCD) were dissected from freshly killed ratkidney at 4-6°C. The dissection media comprised the following(in mM): 140 NaCl, 2.5 K 2 HPO 4, 2 CaCl 2, 1.2 MgSO 4, 5.5 D -glucose, 1 Na-citrate, 4 Na-lactate, and 6 L -alanine, pH 7.4, bubbledwith 100% O 2. Tubule lengths were ~0.5-0.7 mm. The mTAL, cTAL, proximal straight tubule, or CCD segments were pooled in asmall volume (5-10 µl) of ice-cold PBS, three or four segments per pool. The tubules were centrifuged at 12,000 g for 1 minat room temperature, and then PBS was removed and replaced with 10 µlof a tubule lysis solution consisting of 0.9% Triton X-100, 5 mmol/lDTT, and 1 U/µl rRNasin (Promega, Madison, WI). After 5 min on ice,the tubules were gently agitated by tapping the tube, and (in µl) 1 (0.5 µg) oligo(dT) primer, 1 H 2 O, 4 5× reverse transcription buffer, 2 DTT (0.1 mol/l), and 1 dNTPs (10 mmol/l each)were added. The reaction was equilibrated to 42°C for 2 min, and 1 µl SuperScript II RT (Life Technologies, Grand Island, NY) was added,mixed, and incubated for 1 h at 42°C. After reverse transcription, 30 µl of TE (10 mmol/l Tris · Cland 1 mmol/l EDTA, pH 8.0) were added, and the combined mixture washeated to 95°C for 5 min and then placed on ice. Amplification of theNBC4 cDNA by PCR was performed with rat NBC4-specific primers(ATGGTTGACCGATCCTTG and GCTGGCTCTTAATAATGATGGC for the sense andantisense directions, respectively). Cycling parameters were 95°C for32 s, 50°C for 37 s, and 68°C for 4 min., G$ Y$ Q% O# [5 [# N( C
# W& w% q; Y- m: ]( a$ `# GCloning of Human NBC4/ }, i3 o$ L4 d4 Q4 U" e
+ ?9 c9 j( o+ p
Total RNA (2 µg) from human liver was reverse transcribed withan oligo(dT) RT and then subjected to PCR by using human NBC4-specific primers. The primers were designed on the basis of the published sequence (AF-207661) ( 26 ). One NH 2 -terminaland two distinct COOH-terminal fragments from human liver wereidentified by RT-PCR. To obtain the COOH-terminal fragment, thefollowing primers were used: 5'-TCA GTC TCC ACC ACA AAT CGC AGT C(sense) and 5'-TTGTCA ATC CAG GCC AGG TCG TGC (antisense). Thisfragment encodes nucleotides 2869-5397 of the published cDNA. Toobtain the NH 2 -terminal end, the following primers wereused: 5'-GGA CAT GGT TCA GAA ACA GCT AAA GCA GAC (sense) and 5'-CGG TGAAGC GGG TGA TAT ATT TGA TG (antisense). This fragmentcorresponds to nucleotides 1989-4078 of the published cDNA. Toobtain the full-length cDNAs, the following primers were used: GGA CATGGT TCA GAA ACA GCT AAA GCA GAC (1989, sense) and TTG TCA ATC CAGGCCAGGTCG TGC (5397, antisense) for RT-PCR on RNA isolated from rat liver.Two full-length NBC4 variants were isolated that are referred to asNBC4e and NBC4f and contain 3345 and 3067 nucleotides, respectively.The NBC4f cDNA is shorter than NBC4e by only 278 bp; however, it showsa truncation of 377 amino acids on its COOH-terminal end due to a stopcodon at position 2464. The hydropathy plot analysis of this truncatedvariant shows only six transmembrane-spanning domains (data not shown),which most likely makes it nonfunctional. NBC4e, on the other hand, has10 transmembrane-spanning domains (as judged by the hydropathy plotanalysis) and encodes a 1,051-amino acid protein ( RESULTS ). For the purpose of these studies, we focused on NBC4e characterization. Cycling parameters were as 30 cycles of 94°C for 30 s, 57°Cfor 30 s, and 72°C for 3 min. All fragments were subcloned intopGEM-T vector and sequenced.
0 {! U P5 s2 b; U2 H s1 E
# g" G. Q4 \1 f& b+ y5 a2 F' qExpression Studies in Xenopus laevis Oocytes
$ D/ ?7 u# f: o2 Y% U: x
4 ^; I T& \2 a# OSynthesis of NBC1 and NBC4 cRNAs. The capped NBC1 (kidney variant) and NBC4e cRNAs were generated byusing the mCAP RNA Capping Kit (Stratagene, La Jolla, CA) according tothe manufacturer's instruction. Briefly, the plasmids containingfull-length human NBC1 or NBC4 were linearized by restriction enzymedigestion. The products were then in vitro transcribed to cRNAs. Thepurified linear template, at 1 µg, was mixed with transcriptionbuffer, rNTP mix, mCAP analog, and T7 polymerase and incubated at37°C for 30 min. The template was removed by adding RNAse-free DNAseI to the reaction, and the product was purified by phenol-chloroformextraction and ethanol precipitation. The size of the in vitrotranscription product, its quantity, and its quality were evaluated bydenaturing agarose gel electrophoresis. The cRNAs were stored inRNase-free water at 80°C.
; O6 c) l' o* I5 _3 J9 H& l& v& F! n4 c$ K! A! E( a
Expression of NBC transporters in X. laevis oocytes. X. laevis oocytes were injected with NBC1 or NBC4e cRNA.Stage IV and V oocytes were isolated as previously described( 14 ) and used for expression studies according toestablished methods ( 35 ). Fifty nanoliters cRNA(0.2-1.3 µg/µl) were injected with a Drummond 510 microdispenser via a sterile glass pipette with a tip of 20-30µm. After injection, the oocytes were maintained in a solution of thefollowing composition (in mM): 96 NaCl, 2.0 KCl, 1.0 MgCl 2,1.8 CaCl 2, 5 HEPES, 2.5 Na pyruvate, and 0.5 theophylline, as well as 100 U/ml penicillin and 100 µg/ml streptomycin, pH 7.5. Injected oocytes were stored in an incubator at 19°C and were usedfor electrophysiological experiments after 2-4 days.
4 g- x: L3 {& B) m: U) o \( H+ h0 I
Electrophysiology. Oocytes were placed on nylon mesh in a perfusion chamber andcontinuously perfused (3 ml/min perfusion rate). The perfusion solutionhad the following composition (in mM): 96 NaCl, 2 KCl, 1 MgCl 2, 1.8 CaCl 2, and 15 HEPES, pH 7.5. After astabilization period, when the membrane potential( V m ) was constant, the perfusion solution wasswitched to a CO 2 /HCO 3 − -containing solution of the following composition (in mM): 10 NaHCO 3,86 NaCl, 2 KCl, 1 MgCl 2, 1.8 CaCl 2, and 15 HEPES, pH 7.5 (gassed with 1.5% CO 2 ). Experiments wereperformed at room temperature (22-25°C). The V m values were recorded with conventionalmicroelectrode techniques by glass microelectrodes (resistance 3-5m ) filled with 3 M KCl and connected to an Axoclamp 2A amplifier(Axon Instruments, Foster City, CA) ( 14, 40 ). Thedigitized signals were stored and analyzed on a personal computer withAxotape (Axon Instruments).
( T* E/ y/ y' N' ^9 j
& Y" V+ Q8 K3 \; m7 z# \% E+ jIntracellular pH studies. Intracellular pH (pH i ) in oocytes was measured with thepH-sensitive fluorescent probe BCECF (Molecular Probes, Eugene, OR) asdescribed ( 30, 40 ). Briefly, oocytes were incubated with 10 µM BCECF-AM for 8-10 min at room temperature and thentransferred onto nylon mesh attached to the bottom of a 1-ml perfusionchamber. Fluid was delivered to the chamber by a peristaltic pump inthe CO 2 -impermeable tubing (Cole Palmer) and exchanged atthe rate of 4 ml/min. The chamber was closed by a custom-made tightlyfitting lid and constantly superfused with the gas mixture of 1.5%CO 2 -98.5% O 2 to prevent CO 2 lossand keep the pH constant. pH of the fluid in the chamber was frequentlychecked with a Horiba pH meter (model B213). Ratiometric fluorescencemeasurements were performed on a Zeiss Axiovert S-100 invertedmicroscope equipped with the Attofluor RatioVision digital imagingsystem (Attofluor, Rockville, MD). Achroplan ×40/0.8 water objectivewith 3.6-mm working distance was used. Ratiometric fluorescencemeasurements were performed by using the Attofluor digital imagingsystem. Excitation wavelengths were 450 and 488 nm, and fluorescenceemission intensity was recorded at 520 nm. Digitized images wereanalyzed by using the Attograph and Attoview software packages providedby Attofluor. Intracellular calibration studies were performed by thehigh-K -nigericin method. Accordingly, at the end of theexperiment, each oocyte was perfused with at least three different pHcalibration solutions (6.4, 7, and 7.5). Nigericin (40 µM) was addedto each calibration solution, and pH was constantly monitored until it reached a stable value, usually in ~10 min or less. Calibration points were fitted to a linear regression curve, which was then usedfor conversion of calculated F 488 /F 450 ratiosto cell pH (see Fig. 6 B, right, a representativecalibration tracing) and was performed at the end of the experimentdepicted in Fig. 6 B, left. The dynamic range ofour measurements, the range of acquired ratios vs. the range of pHvalues used for calibration, was comparable to those publishedpreviously for oocytes ( 30 ). Rather than performingcalibration studies in oocytes separate from the experimental oocytes( 30 ), we obtained a calibration curve at the end of eachexperiment in the same oocyte that was used for the actual experiment.This modification may account for the differences in the absolutepH i values in our present study compared with the publishedresults ( 30 ).! w( ^- r: d9 k
2 [. b/ w7 \& \5 q0 R3 ~
To measure NBC activity, oocytes were first incubated in aHCO 3 − -free solution that was identical to the solutionused for electrophysiology experiments (see Electrophysiology ). After the equilibration in thissolution, oocytes were switched to a Na - andHCO 3 − -containing solution that was similar to thesolution used for electrophysiology experiments (see Electrophysiology ), which had a pH of 7.5 and was gassed with 1.5% CO 2 -98.5% O 2. Exposure to theCO 2 -containing solution resulted in rapid intracellularacidification. NBC activity was measured as the rate ofNa - and HCO 3 − -dependent pH i recovery from acidosis. All experiments were performed at roomtemperature (22°C), and perfusion solutions were continuously bubbledwith either 100% O 2 or 1.5% CO 2 -98.5%O 2.
7 _. ?! h; r6 p" O- l8 e
. _# A k: g# G" ]Materials
! ?9 q' \% E1 X0 ^5 S! r3 G2 e7 u" k6 y( x* o/ c
A Marathon cDNA Amplification Kit was purchased from ClontechLaboratories (Palo Alto, CA). DMEM/F-12 medium was purchased from LifeTechnologies. All other chemicals were purchased from Sigma (St. Louis, MO).- R4 C \1 V8 \7 P
: {& ^ H" L- b; `; L. I/ o
Statistics- I) l, Q2 N: l% A+ C$ q) }
! P6 M# B6 I5 Q% L5 hResults are given as means ± SE. Statistical comparisonsbetween the groups were performed by ANOVA. The data were considered significant if P
/ X. f1 d# j& L8 N0 t s0 G3 a' l" N+ [
RESULTS1 c. w0 a# F% U) o& D
0 J8 Z9 @+ C+ `! I
Tissue Distribution of NBC4 in Rat
6 p7 N* p) ]* q; u1 E+ ^% o
1 I: P# ~, K. e9 K3 d* VFigure 1 A is arepresentative Northern blot hybridization and demonstrates that NBC4mRNA levels are abundant in proximal colon, distal colon, and kidney,moderate in duodenum and stomach, and very low in heart andliver. To determine whether NBC4 is indeed present in liver andheart, an RT-PCR experiment was performed by using rat-specific primers(see EXPERIMENTAL PROCEDURES ). As shown in Fig. 1 B, an NBC4 transcript of expected size is detected in RNAisolated from liver and heart. The expression of NBC4 in the kidney isshown for comparison. The cDNA sequence of the purified PCR bandverified its identity as NBC4.
$ p- n5 U* K3 {7 k5 f R/ z
9 `2 E2 ?7 V" J' `: z; g. e2 s4 iFig. 1. A : tissue distribution of ratNa -HCO 3 − cotransporter type 4 (NBC4) byNorthern blot hybridization. Rat NBC4 is highly expressed in the colon,with lower expression levels in the kidney and stomach. Expression ofNBC4 in the heart and liver was very low. B : tissuedistributions of rat NBC4 by RT-PCR. Ethidium bromide staining of anagarose gel demonstrates a PCR product of expected size (~300 bp) forNBC4 in rat heart, liver, and kidney. Sequencing of the productverified its identity as NBC4. For each tissue, experiments wereperformed with and without RT. Lane 7, DNA ladder.6 H+ n5 p, z! q; p2 e' _
9 b( c' Y% D4 I' ^! N6 c3 U( n7 E" C
Renal Distribution of NBC4! y# ^, u8 g0 @ `( b4 ` H
4 C+ N1 o! ^* h( U8 V& e2 KThe studies in Fig. 1 indicated that NBC4 mRNA is expressed in thekidney. To examine the zonal distribution of NBC4 in the kidney, RNAfrom rat kidney cortex, outer medulla, and inner medulla was utilizedfor RT-PCR by using rat-specific primers. As shown in Fig. 2, a PCR fragment, which has abundantexpression in the cortex and outer medulla but very low expression inthe inner medulla, was identified. The cDNA sequence of the purifiedPCR fragment verified its identity as NBC4.) b+ Q+ r, ]1 S6 g0 X
7 i- J v/ A7 {. q8 R
Fig. 2. Distribution of NBC4 in rat kidney by RT-P7CR. Zonaldistribution of NBC4 mRNA in the rat kidney by RT-PCR indicates highexpression levels in the cortex and outer medulla. NBC4 expression inthe inner medulla was very low. Lane 9, DNA ladder. Theexperiments were performed with and without RT.
8 U# s7 B1 f: ?+ o
- u; X' V1 P* q1 t. @/ Y: G, kTo determine whether detectable NBC4 mRNA levels are expressed invarious kidney zones, Northern blot hybridizations were performed onRNA isolated from cortex, outer medulla, and inner medulla. Arepresentative blot is shown in Fig. 3 A and indicates high NBC4mRNA expression levels in the outer medulla followed by the cortex. Theabundance of NBC4 in the inner medulla was very low (Fig. 3 A ). This pattern of expression is distinct from NBC1, whichis predominantly expressed in the cortex and is very faint or absent inthe outer medulla or inner medulla, respectively (Fig. 3 B ).5 V, t3 G7 p D* W8 x
# Q/ f- v0 h& T6 E0 _Fig. 3. A : renal distribution of NBC4 by Northern blothybridization. A representative blot indicates high NBC4 mRNAexpression levels in the outer medulla followed by the cortex.Abundance of NBC4 in the inner medulla was low. B : renaldistribution of NBC1 by Northern blot hybridization. A representativeblot indicates that NBC1 mRNA is exclusively expressed in the cortex.
1 B! g) _8 n& W" J/ u2 u7 z1 G6 W
) X% O1 d4 t: Y( {9 K! `Nephron Segment Distribution of NBC4
* K) s7 q' |7 k
$ l2 G- n) d0 ~7 FThe presence of NBC4 in the outer medulla (and cortex) isinteresting. To determine whether NBC4 expression in the outer medulla (and cortex) is originating in part from mTAL (and cTAL),single-nephron RT-PCR was performed on isolated tubules. Three singlemTAL tubules and three single cTAL tubules were pooled separately andsubjected to RT-PCR. As indicated in Fig. 4 A, mTAL and cTAL tubulesabundantly express NBC4. In separate experiments, the expression ofNBC4 mRNA in proximal tubule and CCD was examined. Figure 4 B shows very faint bands of expected size in proximal tubule and CCD. Thetubule lengths were comparable and cycling parameters were identical inall nephron segment RT-PCR experiments.
; O/ ^7 E+ k( _7 J' F$ \2 m" ~0 w- g# u6 b1 ^( N5 z
Fig. 4. Nephron segment RT-PCR of NBC4 in rat kidney. A : representative ethidium bromide staining of agarose geldemonstrates a PCR product of expected size (~300 bp) for NBC4 in ratmedullary thick ascending (mTAL) and cortical thick ascending limb(cTAL). Sequencing of the product verified its identity as NBC4.Experiments were performed with and without RT (separate experimentsverified that similar to mTAL, no band was detected in no-RT samplesfrom cTAL, data not shown). Lane 4, DNA ladder. B : PCR product of expected size was detected in the proximalstraight tubule (PST) and cortical collecting duct (CCD). Bandintensity was vanishingly faint in the CCD and very low in the proximaltubule.
) C! I* ~ f/ i. A2 L$ w3 v
4 Z. u( b* _* ?Cloning of a Novel NBC4 Variant (Nucleotide and Amino AcidSequence)$ L' m' _2 J0 q" v) F, }2 v3 C( C+ p; |
4 z5 n9 C- X+ p: K5 _, ~RT-PCR of human liver RNA with primers encoding the full-lengthcoding region of NBC4 (see EXPERIMENTAL PROCEDURES )identified two distinct transcripts that when sequenced were confirmedto be novel variants of NBC4 (see EXPERIMENTAL PROCEDURES ).Figure 5 depicts and compares theconceptual translation of the open reading frame of NBC4e with NBC4aand kidney NBC1. As indicated, the sequence of NBC4e is shorter by 86 amino acids compared with the published sequence of NBC4a. The openreading frame of NBC4e encodes a 1,051-amino acid protein. The sequenceof NBC4f, which is shorter than NBC4a by 377 amino acids, is not shownhere but can be accessed from GenBank (AF-453528).
. u6 i w' K P: b( J0 L6 p
/ @' M1 e5 v5 q/ jFig. 5. Amino acid sequence of human NBC4. The amino acid sequence of thenovel NBC4e variant is compared against NBC4a and kidney NBC1.Potential NH 2 -linked glycosylation sites were found atamino acids 436, 688, 693, 703, and 711 of NBC4e. Casein kinase IIphospholation sites were found at amino acids 78, 82, 115, 161, 227, 255, 277, 356, 428, 471, 472, 713, 721, 813, and 1046. A potentialcAMP- and cGMP-dependent protein kinase phosphorylation site was foundat amino acid 422. Protein kinase C phosphorylation sites were observedat amino acids 132, 220, 238, 351, 491, 676, 721, 736, 760, 801, and905.: G3 Y" v' N P$ S: C2 ~9 n/ z! {' E
. V0 d+ w& ~) _6 t9 `- dNBC4 Expression in Oocytes: pH i Studies$ B/ M4 R/ t( z
- V( k' V% R; ^+ s& m8 u& _In this series of experiments, the functional properties of NBC4ewere examined. Toward this end, pH i was monitored inoocytes that were injected with NBC4e cRNA. For comparison, oocytesthat were injected with water were utilized. As shown in Fig. 6, switching to aCO 2 /HCO 3 − -containing solution resulted inintracellular acidification. The pH i recovered in thepresence of Na and HCO 3 − inNBC4e-injected oocytes (Fig. 6 A, bottom ) but notin water-injected oocytes (Fig. 6 A, top ). ThispH i recovery from acidosis in oocytes injected with NBC4ewas completely abolished in the presence of 0.5 mM DIDS (Fig. 6 A, bottom ). In Na -free solution, nopH i recovery from acidosis was observed in NBC4ecRNA-injected oocytes (0.000 ± 0.00 pH/min, n = 5). A representative pH i tracing indicating the absence ofpH i recovery from acidosis in Na -free (butHCO 3 − -containing) solution in an NBC4e-injected oocyteis shown in Fig. 6 B, left. Figure 6 B, right, is a calibration curve tracing generated by theKCl-nigericin method at the end of the experiment depicted in Fig. 6 B, left, using the same oocyte.- ]( K! I+ f. j% z# ?$ k
; X2 F9 ?0 h4 t+ B
Fig. 6. A : NBC4 expression in oocytes [representativeintracellular pH (pH i ) tracings]. pH i wasmonitored in oocytes injected with NBC4e cRNA or water. NBC activitywas measured as the Na -dependent,HCO 3 − -mediated pH i recovery fromacidosis-induced by exposure to aCO 2 /HCO 3 − -containing solution. Top : control oocytes showed no pH i recovery fromacidosis. Bottom : NBC4e-injected oocytes demonstratedsignificant Na - and HCO 3 − -dependentpH i recovery from acidosis. DIDS, at 0.5 mM, completelyinhibited NBC4e-mediated pH i recovery from acidosis. B, left : Na -dependency of NBC4e (representativepH i tracing). pH i was monitored as above. Inthe absence of Na in the perfusate, no pH i recovery was observed in NBC4e-injected oocytes. Right :KCl-nigericin calibration curve (representative tracing). ApH i calibration tracing generated by KCl-nigericin methodat the end of the above experiment is depicted. The 488/450 ratios( right ) were utilized to acquire pH i values( left ).3 S3 c# M* @0 w% Q
0 p6 s4 \% C. e) J; f7 j DThe results of Na -dependent,HCO 3 − -mediated pH i recovery studies inwater-injected oocytes (control) and in oocytes injected with NBC4 cRNAwere compiled. As shown in Fig. 7, theNa -dependent HCO 3 − cotransport activity was 0.08 ± 0.007 pH/min in oocytes injected with NBC4 cRNA( n = 6) and was completely inhibited in thepresence of 0.5 mM DIDS. The pH i recovery rate incontrol oocytes was negligible (0.006 ± 0.001 pH/min, n = 5). In HCO 3 − -free solutions,NBC4e-injected oocytes did not demonstrate any significant Na -dependent pH i recovery from acidosis(0.004 ± 0.00 pH/min, n = 4 oocytes), which wasgenerated by switching from a Na -containing to aNa -free solution (the recovery from acidosis was assayedin the presence of 50 µM EIPA to block the endogenousNa /H exchange)." ^7 a5 d x: P, z) i7 M+ S
, K0 v% p$ {9 |& E7 v2 ZFig. 7. NBC4 expression in oocytes (summary of pH i tracings). The Na -dependent HCO 3 − cotransport activity was 0.08 ± 0.007 pH/min in oocytes injectedwith NBC4e cRNA ( n = 6) and was completely inhibited inthe presence of 0.5 mM DIDS. The pH i recovery rate incontrol oocytes was negligible (0.006 ± 0.001 pH/min, n = 5).
" ?( K% Z/ Z% j% z/ X
* z7 H$ H. g4 o) _1 f$ YBaseline pH i was 7.37 ± 0.029 in control oocytes( n = 5) and 7.41 ± 0.025 in oocytes injected withNBC4 cRNA ( n = 6; P 0.05 for both).The rate of Na -dependent pH i recovery inNBC4-injected oocytes was similar in normal (Cl-containing solutions)and Cl-depleted oocytes (perfused with Cl-free, gluconate-containingsolutions for 45 min before pH i recording), indicating thatNBC4 does not function in Na -dependentCl /HCO 3 − exchange mode (thepH i recovery rate from acidosis was 0.09 ± 0.008 inthe absence of Cl and 0.08 ± 0.007 in the presence of Cl, P 0.05, n = 6 for each group)." s% H' @' j3 H( ?, b/ O
) ^* F+ R0 u3 q
NBC4 Expression in Oocytes: Electrogenecity
: B0 m6 }$ p2 x, a: d# q
/ Q. c: C8 ]6 Q5 Q" ~8 s3 _' rIn this series of experiments, we monitored V m in oocytes injected with NBC4e cRNA. Forcomparison, oocytes injected with NBC1 cRNA were utilized. Exposure toCO 2 /HCO 3 − in oocytes expressing NBC1(2-4 days after cRNA injection, 1 µg/µl) resulted in animmediate membrane hyperpolarization, which reached a peak within3 min (Fig. 8 B, representativetracing). The hyperpolarization showed mild decay during the time ofexposure to HCO 3 − and was reversible on returning tothe HCO 3 − -free perfusion solution. This is consistentwith published reports and indicates that NBC1 is highly electrogenic( 6, 28, 29, 33, 40 ).% _2 B$ r; F5 X1 t9 P" J
; Y/ X6 y- v" QFig. 8. NBC4 expression in oocytes: electrophysiologicalproperties (representative tracings). A : water-injectedoocyte. Membrane potential ( V m ) was measured byconventional intracellular microelectrodes in Xenopus laevis oocytes 2-4 days after injection with NBC1 (50 ng/50 nl; B ) and NBC4e (10-65 ng/50 nl; C ) cRNAs.After an equilibrating period, the perfusion solution was switched to asolution containing 10 mM HCO 3 − and gassed with 1.5%CO 2 -98.5% O 2 at pH 7.5. A continuous lineindicates the time of exposure toCO 2 /HCO 3 −. B : exposure ofNBC1-injected oocytes to CO 2 /HCO 3 − resulted in an immediate and sustained hyperpolarization. Thehyperpolarization was reversible on removal ofCO 2 /HCO 3 − from the perfusion medium. C : exposure of NBC4e-injected oocytes toCO 2 /HCO 3 − did not alter the V m.
/ ` a6 B$ v. d! v: C7 V6 X+ `8 P2 |1 F
Interestingly, exposure to CO 2 /HCO 3 − inoocytes expressing NBC4e (2-4 days after cRNA injection, 0.2-1.3 µg/µl) did not affect the V m (Fig. 8 C, representative tracing). Figure 8 A isfrom a control oocyte and indicates that exposure toCO 2 /HCO 3 − did not affect the V m in water-injected oocytes.
9 U- j# S0 E9 ]$ G
7 Y% u# o2 v- j) C& WThe summary of the effects of CO 2 /HCO 3 − inwater-injected oocytes and oocytes injected with NBC1 or NBC4e aredepicted in Fig. 9. There was nosignificant difference in the resting V m (measured within 1 min before perfusing with HCO 3 − ) ofthe oocytes in these three groups: 59 ± 2 mV in control oocytes( n = 7), 61 ± 1 mV in NBC1 ( n = 11), and 62 ± 1 mV in NBC4 ( n = 12). Theaverage V m measured after 3-min exposure toCO 2 /HCO 3 − was significantly altered onlyin NBC1-injected, but not in NBC4e-injected, oocytes.
# K `5 e" e2 S) _ \0 H. b! h) I% n G0 \* e, w+ c
Fig. 9. Summary of expression studies in oocytes injected withNBC1 or NBC4 cRNA. V m was measured by standardintracellular recording techniques. The oocytes were exposed to acontrol medium (HCO 3 − -free) followed by a medium thatcontained CO 2 / HCO 3 − (same protocol as inFig. 8 ). The values of V m were measured within 1 min before exposure to CO 2 /HCO 3 − (filledbars) and 3 min after CO 2 / HCO 3 − exposure (open bars). Values are means ± SE of number of oocytes[ n = 12 control (CTRL), n = 9 NBC4,and n = 21 NBC1]. A statistically significanthyperpolarization on exposure toCO 2 / HCO 3 − was observed in NBC1- but notNBC4-injected oocytes (* P
: d' y" R* @+ |: K3 c% b1 e9 E6 O7 w- u0 P
The above V m recordings and pH i tracings were obtained from separate oocytes. In the next series ofexperiments, we performed V m recordings followedby pH i measurement in the same oocyte. Accordingly, oocyteswere subjected to electrophysiological measurement and, on thecompletion of V m recording, were removed fromthe chamber, loaded with BCECF, and subjected to pH i measurement. Figure 10 A is arepresentative recording and indicates that no changes in V m were observed in response to exposure toCO 2 − /HCO 3 − in NBC4e-transfectedoocytes. Figure 10 B is a representative pH i tracing from the same oocyte and indicates a significantpH i recovery from acidosis. Control oocytes did notdemonstrate any pH i recovery from acidosis. The averagedresults of six separate measurements in six NBC4e-expressing oocytesindicated no significant changes in V m inresponse to exposure to CO 2 − /HCO 3 − ( P 0.05 vs. control oocytes, n = 6).The pH i recovery rate from acidosis was 0.11 ± 0.01 in NBC4e-expressing oocytes, whereas it was undetectable in controloocytes ( P n = 6 for each group). Taken together, these results further confirm that NBC4e is anelectroneutral NBC isoform.
* D- P2 l: a) A1 U$ ?
" }0 ?4 T2 u: nFig. 10. NBC4 expression: V m andpH i monitoring in the same oocyte (representativetracings). A : V m was measured inNBC4e-injected oocytes in a manner similar to Fig. 8. B :after the completion of an electrophysiological recording, oocytes wereremoved from the chamber, loaded with BCECF, and monitored for NBCactivity by determining the pH i recovery from acidosis in amanner similar to that in Fig. 6. A : as indicated, exposureof NBC4-injected oocytes to CO 2 /HCO 3 − didnot alter the V m. B : same oocyteshows a robust pH i recovery from acidosis. Control oocytes(noninjected or water injected) did not demonstrate any pH i recovery from acidosis.1 ^+ L0 ?4 r' L4 V% z( [5 y
5 A/ [; N3 t; A5 q7 A
DISCUSSION+ | X0 y0 }+ a5 W1 J, Y. {
, u' y- r5 K' {; {NBC4 mRNA expression in the kidney is abundant in the outermedulla and cortex and low in the inner medulla (Figs. 2 and 3 ). NBC4is predominantly expressed in the mTAL and cTAL of the loop of Henle(Fig. 4 ). Functional studies indicated that NBC4 mediates aDIDS-inhibitable, Na -dependent HCO 3 − cotransport (Figs. 6, 7, and 10 ) and, unlike NBC1, which is highlyelectrogenic, is electroneutral (Figs. 8-10 ).+ C" n$ O' W# }0 r: a: u A
7 Y2 s4 ^& u- R" E w: TIn the present studies, a novel human NBC4 transcript was cloned andcharacterized. The NBC4 variant has a 3153-nucleotide open readingframe and encodes a 1,051-amino acid protein (Fig. 5 ). Similar to otherNBC isoforms, NBC4e has 10 transmembrane-spanning domains. Amino acidsequence analysis demonstrated that similar to NBC1 ( 9 ),NBC4 has one cAMP-dependent protein kinase phosphorylation site and onetryosine kinase phosphorylation site (Fig. 5 ). NBC4e has five potentialNH 2 -linked glycosylation sites (436, 688, 703, and 711 amino acids) and multiple casein kinase and protein kinase Cphosphorylation sites.) O k" ?, O. d& U& C6 H3 z1 `
7 o! n# U- a. `8 v& U5 z- QAn interesting aspect of these studies is the distinct pattern of NBC4distribution in the kidney (Figs. 2-4 ). NBC4 expression isabundant in the outer medulla, with lower levels in the cortex. Theinner medulla has the least amount of NBC4 among kidney zones. This isdistinct from NBC1, which is highly expressed in the cortex and is veryfaint or absent in the outer medulla and inner medulla, respectively(Fig. 3 B and Refs. 2, 29, and 33 ). NBC4 is predominantly expressed in mTAL and cTAL ofthe loop of Henle, sites that do not express NBC1 ( 2, 29, 33 ), suggesting that NBC4 and NBC1 perform distinct functions.The accuracy of nephron segment isolation was verified by examining theisolated tubules for the expression of apical Na-K-2Cl cotransporter,which is exclusively expressed in mTAL and cTAL. RT-PCR studiesverified the expression of Na-K-2Cl cotransporter in isolated mTAL and cTAL tubules.7 X* E. n, k$ W6 Z' L3 `0 ?8 W5 Q
1 O: g E7 `3 W1 p pNBC1 is highly electrogenic (Figs. 8 and 9 ) and mediates the transportof HCO 3 − and Na from cell to blood in thekidney proximal tubule ( 1-3, 6, 9-11, 28, 29, 33, 41 ). This occurs despite unfavorable chemical gradients forNa and HCO 3 − efflux across the plasma membrane ( 3, 6, 9, 34, 41 ). The only driving force forNBC1 to work in the efflux mode is the fact that it is electrogenic andcarries a net negative charge ( 3, 6, 9, 28, 33 ), consistent with published reports that it carries 3 HCO 3 − /Na ( 34, 41 ). As such,the inside-negative V m of the proximal tubulecell can drive the net exit of HCO 3 − across thebasolateral membrane against the inward Na andHCO 3 − gradients. Interestingly, expression of NBC4 inoocytes did not alter the V m (Figs. 8-10 ), consistent with the conclusion that this transporter is electroneutral. The electroneutrality of the NBC indicates the cotransport of 1 HCO 3 − with 1 Na (or 2 HCO 3 − with 2 Na ). We suggest that on thebasis of its electroneutrality, NBC4 works in the influx mode underphysiological conditions and transports HCO 3 − andNa into cells.6 I& M; z* P* t/ H9 T8 `3 \' V0 f
1 p& r2 `& N7 E6 D2 jThe inward NBC4 flux direction should result in the transport ofHCO 3 − into the cell, with subsequent cellalkalinization. As such, NBC4 is likely activated in response to cellacidosis (such as in metabolic acidosis). In this regard, NBC4 canfunction as a housekeeping transporter and maintain the cell pH in anarrow physiological range. With respect to the mTAL, the transport ofHCO 3 − into the cell may prevent the cell acidificationthat results from the reabsorption of NH 4 + via theapical Na-K (NH 4 + )-2Cl cotransporter ( 22 ).As such, NBC4 may play an important role in systemic acid-baseregulation by allowing the reabsorption of NH 4 + tocontinue uninterrupted in the mTAL of the loop of Henle. It should bementioned that the presence of Na -dependentHCO 3 − cotransport in the basolateral membrane of thicklimb of the loop of Henle in rats on a normal diet has beencontroversial; whereas some studies have found functional evidence insupport of NBC, others have not ( 5, 38 ). One plausibleexplanation with respect to this discrepancy may be the use ofdifferent methods of cell isolation for functional studies ( 5, 38 ). This latter study found that mTAL tubules express NBCn1(which is a rat ortholog of NBC2) on their basolateral membranes( 38 ). The expression of NBCn1 was found to be increased inacidosis ( 22 ). Our studies indicate that in addition toNBCn1 ( 38 ), mTAL tubules also express NBC4. In view of thefact that NBCn1 is resistant to DIDS ( 13 ), we propose thatthe DIDS-sensitive NBC activity in the basolateral membrane of the mTAL( 38 ) may reflect NBC4 activity and not NBCn1. With respectto the liver, NBC4 can function in tandem with the electrogenic NBC andplay an important role in the transport of HCO 3 − intohepatocytes ( 17 ).6 R' d& g0 I5 _2 i' j! L
+ Q0 v, n: D% ?4 M
Two recent reports suggested that NBC4c (a variant of NBC4) iselectrogenic and carries a net negative charge ( 31, 37 ). This conclusion, although at variance with the present results (Figs. 8-10 ), may be due to the possibility that those studies ( 31, 37 ) used a splice variant of NBC4 distinct from our clone.Whether the truncation of NBC4 by 86 amino acids could be responsible for the lack of electrogenecity of NBC4e in the present results (Figs. 8-10 ) remains to be studied. It should be mentioned that the recordings of V m and pH i recoveryfrom acidosis in response to CO 2 /HCO 3 − exposure in the same oocyte (Fig. 10 ) prove beyond any doubt that NBC4eis indeed electroneutral. In support of this conclusion, it is worthmentioning that no electrogenic NBC has been identified in the rat mTALof the loop of Henle, lending support to the conclusion that NBC4e isindeed electroneutral.
# Y: `/ K! v! y# v. J6 d7 ]! _, S* U5 f4 u# ^! U% S
Rat NBC4 has a molecular mass of 3.5 kb (Figs. 1-3 ), which is muchsmaller than the human NBC4 molecular mass of 6 kb( 26 ). The difference likely results from thepresence of a long noncoding region in human NBC4, because the codingregion of human NBC4 is only ~3.2 kb. The mRNA of rat NBC4 in theouter medulla and cortex appears as two transcripts, raising thepossibility that similar to human NBC4, rat NBC4 has more than onesplice variant. Interestingly, the larger transcript is absent in theinner medulla and stomach. Additional studies are needed to clone andexamine the regulation of rat NBC4 transcripts.7 |! K& ^8 t3 S, T- i! E
; f3 ?0 K) q& X6 M9 }2 E
Although the subcellular localization of NBC4 was not determined inthese studies, it is likely that this transporter is expressed on thebasolateral membrane of epithelial cells. This conclusion is stronglysupported by nephron segment studies indicating the expression of NBC4in the mTAL and cTAL (Fig. 4 ) as well as functional studies indicatingthe lack of any luminal Na -dependentHCO 3 − cotransporter activity in mTAL and cTAL( 18 ). As such, the expression of NBC4 in these two nephronsegments is likely limited to the basolateral membrane domain.% Y) G+ @8 X' c0 A0 X
& g, B) e! \! T8 [2 Z4 X, e/ X
In conclusion, NBC4e is a novel variant of NBC4 and mediates aDIDS-sensitive electroneutral cotransport of Na andHCO 3 −. On the basis of its tissue distribution, wepropose that NBC4 mediates the transport of HCO 3 − intothe cells of the thick ascending limb of the loop of Henle.
5 w7 m: h0 `. {' k# z ~; o0 |1 X) |. w2 @( e2 h3 s
ACKNOWLEDGEMENTS
: B2 F, q0 @9 o
+ V1 K$ ~) V$ ~3 Q) WThese studies were supported by National Institute of Diabetes andDigestive and Kidney Diseases Grant DK-54430, a Merit Review grant, agrant from the Cystic Fibrosis Foundation, and grants from DialysisClinic, Inc. (M. Soleimani). L. Conforti was supported by AmericanHeart Association Grant 0030091N.
0 P+ Z- m( v( p! e$ X 【参考文献】! z2 V9 ] d; S V! k2 S
1. Abduladze, N,Lee I,Newman D,Hwang J,Boorer K,Pushkin A,andKurtz I. Molecular cloning, chromosomal localization, tissue distribution, and functional expression of the human pancreatic sodium bicarbonate cotransporter. J Biol Chem 273:17689-17695,1998 .
: @4 ~5 g# Y a) v+ k
" X" j( ~; o* u) K$ e& ]
* y5 c# M% q" S
3 Q$ q' m5 w1 v/ g7 `* L1 {2. Abduladze, N,Lee I,Newman D,Hwang J,Pushkin A,andKurtz I. Axial heterogeneity of sodium-bicarbonate cotransporter expression in the rabbit proximal tubule. Am J Physiol Renal Physiol 274:F628-F633,1998 .( C2 f p$ Q j9 d( t+ e
& F, R* F9 M, M; y6 g$ s3 o" |
% V. p# Y: \3 f E% U
+ ^1 _7 n: x) \# x% ?& H5 T3. Alpern, RJ. Mechanism of basolateral membrane H /OH /HCO 3 − transport in the rat proximal convoluted tubule. A sodium-coupled electrogenic process. J Gen Physiol 86:613-636,1985 .
% T# j7 u+ g! ~
3 s4 k- F$ E* V b
. _9 e. ~+ S: x$ E) X
5 z& B/ V: B1 }/ Y4. Amlal, H,Burnham CE,andSoleimani M. Characterization of the Na :HCO 3 − cotransporter isoform NBC-3. Am J Physiol Renal Physiol 276:F903-F913,1999 .2 }3 k% d/ j+ O* _3 Y
; _' \" u' L* e$ l/ f8 b
$ N2 q1 \/ Z5 d; m+ `2 N9 O
6 p2 V; _: o/ b( B, ]. a2 ]+ I
5. Amlal, H,Habo K,andSoleimani M. Potassium deprivation upregulates expression of renal basolateral Na -HCO 3 − cotransporter (NBC-1). Am J Physiol Renal Physiol 279:F532-F543,2000 .
2 e3 M0 `# g8 w- M. w& M5 K6 `2 Z0 z: P7 D6 h4 R& P
& [* Y1 N7 D- j' q9 T: Y$ F
* ~# f: _6 T) z1 R$ P8 ^
6. Aronson, PS,Soleimani M,andGrassl SM. Properties of the renal Na( )-HCO 3 − cotransporter. Semin Nephrol 11:28-36,1991 .& E. F- v8 ?& g* h g: c7 N ~( ~
& _9 s. {( A6 a5 i! @& ~( U& i+ T) H8 ~2 e
3 G/ r- g0 V8 v7. Astion, ML,Obaid AL,andOrkand RK. Effects of barium and bicarbonate on glial cells of Necturus optic nerve. J Gen Physiol 93:731-744,1989 .$ y) I' I# a1 o
# d$ \% O" V/ a' K# V" M* l8 m
. v/ [5 ]) Q& \) |4 ^9 V: m
% |( N0 Q& T# K+ o# \; W5 q8. Bonanno, JA,andGiasson C. Intracellular pH regulation in fresh and cultured bovine corneal endothelium. II. Na :HCO 3 − cotransport and Cl /HCO 3 − exchange. Invest Ophthalmol Vis Sci 33:3068-3079,1992 .6 z9 H# k" o2 G R- R8 w* f& k
) l, o& R% D4 {, {
: P, q; N8 j: p' M) V0 l! W
$ _8 b9 A% o' f/ b1 ^9. Boron, WF,andBoulpaep EL. Intracellular pH regulation in the renal proximal tubule of the salamander: basolateral HCO 3 − transport. J Gen Physiol 81:53-94,1983 .* s; a# P9 q+ ^
: b% g) k6 [; X/ j: j7 P9 y
5 x/ m4 Z7 S& h. a$ G2 o" i
. M: |$ o5 f+ y2 ^- C n10. Burnham, CE,Amlal H,Wang Z,Shull GE,andSoleimani M. Cloning and functional expression of a human kidney Na :HCO 3 − cotransporter. J Biol Chem 272:19111-19114,1997 .
! _5 {, W& \ M) s7 i! ?, j: ^( |6 E! G' L
g7 y% d7 w* G9 |
" P, S' C7 W: B11. Burnham, CE,Flagella M,Wang Z,Amlal H,Shull GH,andSoleimani M. Cloning, renal distribution, and regulation of the rat Na -HCO 3 − cotransporter. Am J Physiol Renal Physiol 274:F1119-F1126,1998 .( M/ r+ D0 u6 K# a
: a* C2 z/ y& ^" e( u0 |8 d1 u2 L' k7 X% s
% S: V/ U5 i$ d8 [12. Camilion Hurtado, MC,Alvarez BV,Perez NG,andCingolini NE. Role of an electrogenic Na /HCO 3 − cotransport in determining myocardial pH i after an increase in heart rate. Circ Res 79:698-704,1996 .7 R# ?- O% B' h9 }# ~
, q* V1 F* }, E% A+ H# D7 f; h
: D# @" T" u7 E" e# ]- k6 H7 J
, @+ f* l' Q$ W& _0 f. f
13. Choi, I,Aalkjær C,Boulpaep EL,andBoron WF. An electroneutral sodium/bicarbonate cotransporter NBCn1 and associated sodium channel. Nature 405:571-575,2000 .+ k( i: i% p5 n$ [- S
_5 i. l1 F& K O
' g- I# n* U0 g8 ~2 D: U$ j* E1 Q4 E* B+ }$ k
14. Conforti, L,andSperelakis N. The patch clamp technique for measurement of K channels in Xenopus oocytes and mammalian expression systems.In: Potassium Channels in Cardiovascular Biology, edited by Archer A,and Rusch M.. New York: Kluwer Academic/Plenum, 2001, p. 143-161.5 H! l0 L8 i9 P3 U6 A0 Y7 y
4 x9 o6 B3 D3 d- l- n/ w: B* F* i) ?4 i
( {% q9 _; b: G/ U% t
15. Dart, C,andVaughan-Jones RD. Na( )-HCO 3 − symport in the sheep cardiac Purkinje fibre. J Physiol 451:365-385,1992 .6 D4 ? f6 d2 g- o7 t ~! X
5 {( o$ C+ r8 |9 M" P- A
$ T3 z2 r8 J- ]+ B& T# S# i# E- }1 {0 G% p
16. Fitz, JC,Persico M,andScharschmidt BF. Electrophysiological evidence for Na-coupled bicarbonate transport in cultured rat hepatocyte. Am J Physiol Gastrointest Liver Physiol 256:G491-G500,1989 .
# o: |- N4 Z% `8 [- i, v
1 P3 X' N% L: s* n, v3 z+ O
6 J9 {5 |( ?6 G' i/ A% T1 u& ]# T1 U \' M
17. Gleeson, D,Smith ND,andBoyer JL. Bicarbonate dependent and independent intracellular pH regulatory mechanisms in rat hepatocyte. J Clin Invest 84:312-321,1989 .
2 w. s3 t2 g; L+ j9 W; i3 J- x+ X* U
' z. o( P* c% ~6 h. S5 h+ U7 P& T8 B1 j$ q: |/ t7 G' r
/ t1 z9 {$ v% _2 P9 w
18. Good, DW. The thick ascending limb as a site of renal bicarbonate reabsorption. Semin Nephrol 13:225-235,1993 .
0 K) N2 @$ k: g- N7 [
# d& a: l8 S: K, J: y0 G E7 \8 T) r# s% q8 R. |! z* t
6 {, \8 p+ g- T9 W
19. Grichtchenko, II,Choi I,Zhong X,Bray-Ward P,Russell JM,andBoron WF. Cloning, characterization and chromosomal mapping of a human electroneutral Na - driven Cl-HCO 3 exchanger. J Biol Chem 276:8358-8363,2001 .
. W/ F3 _0 {) r2 U' X- T* l& `- N" e, ^8 m. B! r. m# r
3 R# `. S& H7 L/ Q8 \, b1 l
, C6 ^3 j# A0 k% k$ t20. Ishibashi, K,Sasaki S,andMarumo F. Molecular cloning of a new sodium bicarbonate cotransporter cDNA from human retina. Biochem Biophys Res Commun 246:535-538,1998 .
5 B. r% P: C2 G8 V0 M0 [$ A; v( ?( y0 Y$ j. p" m
. j& |( T$ J: M
+ [ m7 I/ M" m. z# h21. Jentsch, TJ,Stahlknecht TR,Hollwede H,Fischer DG,Keller SK,andWiederholt M. A bicarbonate-dependent process inhibitable by disulfonic stilbenes and a Na /H exchanger mediate 22 Na uptake into cultured bovine corneal endothelium. J Biol Chem 260:795-801,1985 .
" \. W! Y7 ?2 L+ A" Y2 c) K# {- N* `+ ^/ N6 x
7 j* g; M' z& C, R1 [7 f- P
1 C% q( g1 ~( t% }* X g: \22. Kwon, TH,Fulton C,Wang W,Kurtz I,Frøkiær J,Aalkjær C,andNielsen S. Chronic metabolic acidosis upregulates rat kidney Na-HCO 3 − cotransporters NBCn1 and NBC3 but not NBC1. Am J Physiol Renal Physiol 282:F341-F351,2002 .
- F9 B- N- y* k# z4 v ?" m2 O1 e+ c4 T5 i* M
! B9 X0 v6 m5 S! i- Y
1 S' I5 U9 `3 g. t23. Lagadic-Gossmann, D,Buckler KJ,andVaughn-Jones RD. Role of HCO 3 − in pH recovery from intracellular acidosis in the guinea-pig ventricular myocyte. J Physiol 458:361-384,1992 .
0 o2 R* V" ?3 b; V" O( m. G" S G2 G V5 w: z
) R9 r* g, z' `/ B. C0 _& }" f. R9 r' w: B3 w! a1 M" [% z9 _
24. Lubman, RL,Chao DC,andCrandall ED. Basolateral localization of Na-HCO 3 − cotransporter in alveolar epithelial cells. Respir Physiol 100:15-24,1995 .
, h; L( e3 d5 u3 _/ a) |( p
) G# K0 c9 ~+ k5 N2 T$ A J& g; f( M! L5 U* s& e
x4 E0 T' ]! |! ~8 ~4 o [4 @
25. Pushkin, A,Abuladze N,Lee I,Newman D,Hwang J,andKurtz I. Cloning, tissue distribution, genomic organization, and functional characterization of NBC3, a new member of the sodium bicarbonate cotransporter family. J Biol Chem 274:16569-16575,1999 .; R2 _- R7 b' ]/ a" [$ Y* l! U
, q3 J4 j2 V; P0 z Z' D+ w. n2 o0 ~9 O! d- j
2 d9 i+ J: H5 p$ ~9 S26. Pushkin, A,Abuladze N,Newman D,Lee I,Xu G,andKurtz I. Two C-terminal variants of NBC4, a new member of the sodium bicarbonate cotransporter family: cloning, characterization, and localization. IUBMB Life 50:13-19,2000 .
, X+ e7 h4 H# \% ]0 S$ ]
# ]; b/ a4 `- Y+ \/ |, H4 V' f5 Y; A4 r6 D# o& }. J' W
8 I& D. k: `+ c# U; S0 t3 Q27. Rajendran, VM,Oesterlin M,andBinder HJ. Sodium uptake across basolateral membrane of rat distal colon. Evidence for Na-H exchange and Na-anion cotransport. J Clin Invest 88:1379-1385,1991 .7 g+ r- p+ L2 P. \7 F
j( K. f& @$ |; k" ?7 i
' R4 h# i Z+ ~* k# j" \2 z2 Q0 T& ~6 r4 }9 @9 `! }
28. Romero, MF,Fong P,Berger UV,Hediger MA,andBoron WF. Cloning and functional expression of rNBC, an electrogenic Na -HCO 3 − cotransporter. Am J Physiol Renal Physiol 274:F425-F432,1998 .2 e5 a* ^* I! p
9 B( }+ d9 [7 Z. n9 P. m9 ]
% P6 ]' v; H" O$ \- Y/ ?- f ?7 {
29. Romero, MF,Hediger MA,Boulpaep EL,andBoron WF. Expression cloning and characterization of a renal electgrogenic Na :HCO 3 − cotransporter. Nature 387:409-413,1997 .
^- o2 B' b/ E3 e( N8 K2 H5 `
% l3 M/ o! `* b7 ^ `' b! y" L+ C+ R; \7 x" F z6 K
4 @# c9 L: D/ ?" b3 N" c( l4 G) j. r3 `30. Sasaki, S,Ishibashi K,Nagai T,andMarumo F. Regulation mechanisms of intracellular pH of Xenopus laevis oocyte. Biochim Biophys Acta 1137:45-51,1992 .7 M6 p; e) z* c: Y
; K* E: o/ o6 v% d t' C8 y- E) _# U
4 V& v4 T N. U2 F5 g
31. Sasani, P,Pushkin A,Gross E,Abuladze N,Dukkipati R,Carpenito G,Newman D,andKurtz I. Functional characterization of NBC4: a new electrogenic sodium-bicarbonate cotransporter. Am J Physiol Cell Physiol 282:C408-C416,2002 ., Y& Y* |5 J0 l3 l
6 d" B @& u9 L' c' l) x
; l, J9 @/ ?6 U4 {, W6 m8 O3 T9 P# {3 J* D
32. Soleimani, M,andBurnham C. Physiologic and molecular aspects of the Na :HCO 3 − cotransporter in health and disease processes. Kidney Int 57:371-384,2000 .
+ k+ z, t' f! ]/ k. T% G+ G" V2 f+ ^( R5 J
* p) {* w; w9 P" b2 p
! ^3 X6 F* [( R& R6 }/ v3 T33. Soleimani, M,andBurnham CE. Na :HCO 3 − cotransporters (NBC): cloning and characterization. J Membr Biol 183:71-84,2001 . X; u" i8 v9 Z
+ T. ^ Y @% W# o3 j5 u
9 D) G! Y) P! E* `( [& r9 C( @
) j `) w* @+ `# {! D34. Soleimani, M,Grassl SM,andAronson PS. Stoichiometry of the Na -HCO 3 − cotransporter in basolateral membrane vesicles isolated from rabbit renal cortex. J Clin Invest 79:1276-1280,1987 .* Q+ T. q& k9 W& h: y. E: w
) @" S; v. T9 O9 D q. b& I! `* x5 X. ^3 G9 a: m% a# b# y
7 _% Z% L- `( }! g
35. Stuhmer, W,andParekh AB. Electrophysiological recordings form Xenopus oocytes.In: Single-Channel Recording (2nd ed.), edited by Sackman B,and Neher E.. New York: Plenum, 1995, p. 341-356.
0 }7 x4 i6 C; G" _7 @; r9 }) y2 K' F* q- d/ {. N
2 E1 \" G& W7 x1 W: x9 P
9 E U* \* w8 t# {2 V; a36. Tsuganezawa, H,Kobayashi K,Iyori M,Araki T,Koizumi A,Watanabe SI,Kaneko A,Fukao T,Monkawa T,Kim DK,Kanai Y,Endou H,Hayashi M,andSaruta T. A new member of the HCO 3 − transporter superfamily is an apical anion exchanger of beta-intercalated cells in the kidney. J Biol Chem 276:8180-8189,2001 .% W M' y7 \9 ^& z- b9 Y8 v9 ^
/ @7 K" h$ j) ~6 T4 e7 U! w; D5 I% U0 V2 A$ ]2 j
6 {6 h8 ?1 K! e0 c5 X- H/ g8 E( X% [' O37. Virkki, LV,Wilson DA,Vaughan-Jones RD,andBoron WF. Functional characterization of human NBC4 as an electrogenic Na -HCO 3 − cotransporter (NBCe2). Am J Physiol Cell Physiol 282:C1278-C1289,2002 .
; R1 P$ D3 s! S+ f! T: O: }, I$ F: o! W. R, L6 W
5 a2 i0 U$ p* F; R! U3 M# t
( X' n/ L1 k+ A8 `7 p( p8 b7 ^% f38. Vorum, H,Kwon TH,Fulton C,Simonsen B,Choi I,Boron W,Maunsbach AB,Nielsen S,andAalkjær C. Immunolocalization of electroneutral Na-HCO 3 − cotransporter in rat kidney. Am J Physiol Renal Physiol 279:F901-F909,2000 .0 m: l) N2 J$ ^+ X: r, D% y4 Z$ U
" q0 o6 h* x# k0 u G/ F7 k A
& Q" b( c; o, Q# F! T2 U
6 z( L, Y# i( h5 M4 Y0 i7 c! L
39. Wang, CZ,Yano H,Nagashima K,andSeino S. The Na driven Cl/HCO 3 − exchanger. Cloning, tissue distribution, and functional characterization. J Biol Chem 275:35486-35490,2000 .
& R# g' _+ h4 b5 k3 L) Y
/ f" B3 X# D$ h
% Y, D! z* C9 J/ M8 m, X) d' C7 p D* Y4 i0 R0 [ S9 S" o
40. Wang, Z,Conforti L,Petrovic S,Amlal H,andBurnham C. Mouse Na :HCO 3 − cotransporter isoform NBC-3 (kNBC-3): cloning, expression and renal distribution. Kidney Int 59:1405-1414,2001 .
/ n" |# W v' ^0 I1 ~+ V4 N6 ?$ a9 h8 z! w/ N4 r b5 C4 b! u
$ s0 Q( P0 ^! E) n( N% }
& H4 ?. t5 _: d" _+ k9 ?& o41. Yoshitomi, K,Burckhardt BC,andFromter E. Rheogenic sodium-bicarbonate co-transport in the peritubular cell membrane of rat renal proximal tubule. Pflügers Arch 405:360-366,1985 . |
|