|

- 积分
- 0
- 威望
- 0
- 包包
- 0
|

作者:Susan M.Wall, Kathryn A.Hassell, Ines E.Royaux, Eric D.Green, Judy Y.Chang, Gregory L.Shipley, Jill W.Verlander作者单位:1 Departments of Medicine and Integrative Biology and Pharmacology, University ofTexas Medical School at Houston, Houston, Texas 77030; Genome Technology Branch, National Human GenomeResearch Institute, National Institutes of Health, Bethesda, Maryland20892; and Department of Medicine, University of
* F1 o! z7 i# ]5 l V, y8 R 3 j8 f% R! [9 `
9 T2 ^# Z+ A$ ~/ c' |7 R
7 q5 [! ^7 T* ?
- C5 B- b6 \/ }) Y 3 Y# F. N. z2 r' X
4 f" l1 b, e0 a; Q7 N; e& D5 k# Z
( X' M! W! v# k- Y7 C+ C- k8 n
; M; _6 L. F% z. f# ^, }& g 0 p. Q! D0 |, a6 _" S3 Z7 V
3 o ?/ @( W- e4 c0 F: X
+ ]- Y" \# J% e+ j' u4 c0 S L# z
0 E% l/ N0 Z. G5 K+ r
【摘要】
5 j( F S5 y4 H& k- a0 ^ Pendrin is an anion exchangerexpressed in type B intercalated cells of the cortical collecting duct(CCD). Whether pendrin localizes to other nephron segments withintercalated cells is unknown. Moreover, whether pendrin is expressedin proximal tubule is debated. Thus the distribution of pendrin mRNAand protein expression in mouse kidney was investigated by using lightand electron microscopic immunohistochemistry and quantitativereal-time PCR. We observed that pendrin mRNA is expressed mainly incortex. Within cortex, pendrin mRNA is at least fivefold higher in CCD and the connecting tubule (CNT) than in the other segments. Pendrin protein was observed in a subset of cells within the distal convoluted tubule as well as in type B and in non-A-non-B intercalated cells ofthe CNT and CCD. In type B intercalated cells, pendrin immunoreactivity was highest in apical cytoplasmic vesicles with little immunolabel along the apical plasma membrane. In non-A-non-B intercalated cells,intense pendrin immunoreactivity was detected along the apical plasmamembrane. These differences in the subcellular distribution of pendrinimmunolabel were confirmed by morphometric analysis. In conclusion,pendrin is expressed in the mouse distal convoluted tubule, CCD, andCNT along the apical plasma membrane of non-A-non-B intercalated cellsand in subapical cytoplasmic vesicles of type B intercalated cells. & e9 R' h+ i$ z% K5 N- v& ] k
【关键词】 intercalated cell distal convoluted tubule cortical collectingduct connecting tubule anion exchange
% z4 K4 B, B* f% ^6 h. e9 K INTRODUCTION
% K- O4 b+ X2 c- T
$ o+ c9 N; A: Y8 G/ yINTERCALATED CELLS MEDIATE transepithelial transport of net H equivalents along the collecting duct ( 24 ), a processmediated largely through vacuolar H - ATPase. However,Brown et al. ( 3 ) observed that H -ATPase hasopposite polarity within subpopulations of intercalated cells. Thusthese cells are thought to either secrete or absorb net H equivalents depending on whether H -ATPase localizes to theapical or the basolateral plasma membrane. Intercalated cells areclassified as type A, B, or non-A-non-B from immunological andultrastructural characteristics ( 30 ). Theimmunohistochemical classification of these cells is based on thepresence or absence of AE1 immunoreactivity and the distribution ofH -ATPase within the cell ( 16, 24, 30 ). Thedistribution and expression of each of these transporters ineach intercalated cell subtype is displayed in Fig. 1. The ultrastructure of each cell type (A, B, and non-A-non-B) has been characterized( 30 ). Type A intercalated cells have a centralizednucleus, prominent apical plasma membrane microprojections, andprominent apical cytoplasmic membrane tubulovesicles. In the type Aintercalated cell, H -ATPase is expressed on the apicalcytoplasmic vesicles and the apical plasma membrane, where it functionsin series with the Cl /HCO 3 − exchangerAE1 on the basolateral plasma membrane to mediate secretion of netH equivalents into the luminal fluid ( 1, 6, 23 ) in both the medullary and the cortical collecting duct( 24 ). In the kidney, a truncated splice variant oferythrocyte AE1 or band 3 ( 17 ) is observed (kAE1). BothH -ATPase and kAE1 are highly regulated by changes inacid-base status ( 21 ). For example, kAE1 andH -ATPase are upregulated during metabolic acidosis( 2, 21, 33 ), which increases secretion of H equivalents into the luminal fluid.5 H8 B( B/ b, ]0 B5 m
; [1 X# u( V. K& @, }( d tFig. 1. Immunohistochemical classification of intercalated cells of thecortical collecting duct (CCD). AE1, anion exchanger type 1.7 a1 |0 k& J( }$ @
% W8 s! G! {! e& }8 J
The non-A-non-B intercalated cell has been described in mice and rats( 1, 16, 30 ). Non-A-non-B cells have a very high mitochondrial density, prominent apical plasma membranemicroprojections, and sparse apical cytoplasmic vesicles( 30 ). Similar to type A intercalated cells, this cell typehas H -ATPase in both the apical plasma membrane and inapical cytoplasmic vesicles; however, it does not express kAE1( 1, 16, 30 ). The physiological role of non-A-non-Bintercalated cells in the regulation of acid-base homeostasis is,however, unknown ( 30 ).
! g4 |3 S( W; G; }8 [1 N* X+ Z. ]) l2 o
Type B intercalated cells are distinguished from other intercalatedcell subtypes ultrastructurally by the presence of a relatively smoothapical plasma membrane, an eccentric nucleus, clustered mitochondria,and cytoplasmic vesicles distributed throughout the cell. In the type Bintercalated cell, H -ATPase is expressed on thebasolateral plasma membrane and in cytoplasmic vesicles throughout thecell ( 1, 16, 30 ). Type B intercalated cells are thought tomediate HCO 3 − secretion into the luminal fluid( 24 ). In rabbits and mice, the majority of non-Aintercalated cells of the cortical collecting duct (CCD) displayelectroneutral Na -independentCl /HCO 3 − exchange across the apicalmembrane ( 8, 10, 35 ). The gene product(s) responsible forapical anion exchange-mediated HCO 3 − secretion, thought to occur across type B intercalated cells, has been a matter ofcontroversy. It has been proposed that kAE1 represents the putativeapical anion exchanger of the type B intercalated cell( 32 ). However, there is now abundant evidence that kAE1 does not represent the gene product of the apical anion exchanger ofthe type B intercalated cell ( 1, 9, 12, 16, 25, 30 ). Morerecent studies have shown that pendrin and AE4 represent othercandidate genes for the putative apical anion exchanger.' l+ x8 J( o# Z! y1 v: I
1 Y7 d, |! n( w6 S& x# P+ v9 LAE4 is an Na -independentCl /HCO 3 − exchanger first cloned inrabbit kidney by Tsuganezawa et al. ( 31 ). In rabbit CCD,AE4 localizes to the apical membrane of some type B intercalated cells( 31 ). However, preliminary reports indicate that in ratCCD, AE4 resides along the basolateral membrane of both type A and typeB cells ( 7 ). Like apical anion exchange in the type Bintercalated cell, AE4 is insensitive to stilbene inhibitors whenexpressed in Xenopus laevis oocytes ( 31 ).However, because its distribution in intercalated cell subtypes isdebated and because no AE4 mouse knockout model exists, thephysiological significance of AE4 in kidney is unknown.4 O) V% X ~6 l* L# Y" Q5 _5 i. U
5 a; o; a' t" s1 I. n# q; I5 S7 ZPendrin represents another Na -independentCl /HCO 3 − exchanger ( 27, 28 ). The molecular structure of the pendrin gene was deduced byEverett et al. ( 11 ). RNA in situ hybridization, Northernblot analysis, and immunocytochemistry data have shown that pendrinmRNA and protein are highly expressed in the inner ear, thyroid, andkidney ( 11, 19, 20 ).' r2 c6 Z- I$ y% u& o, o1 ]
( j6 w# g& ~. { ]) Y, N3 WThe distribution of pendrin in the mammalian kidney has been debated.Light and fluorescent microscopic immunolocalization studies of Royauxet al. ( 20 ) reported that pendrin protein is highlyexpressed in the apical region of a subpopulation of cells within theCCD of mice, rats, and humans in which H -ATPase is eitherbasolateral or apical (Fig. 1 ) but not in cells that express kAE1. Thuspendrin protein is expressed in the apical region of non-A intercalatedcells. Localization of pendrin to the apical region of the type Bintercalated cell raises the possibility that this transporterrepresents the putative apical anion exchanger of this cell type.However, other laboratories have reported a different distribution ofpendrin expression within the cortex. Soleimani et al.( 28 ) have investigated the distribution of pendrin mRNAand protein expression in rat kidney by using RT-PCR of individualnephron segments and immunoblots of brush-border membrane vesicles.They observed that pendrin message and protein are highly expressed notonly in the CCD but also along the brush border of the proximal tubule.Pendrin mRNA expression was not measured in the other segments of thecortex. Localization of pendrin to the brush border suggests adifferent functional role for the transporter than is suggested withlocalization of the transporter to the apical membrane of the type Bintercalated cell. The purpose of the present study was therefore toexplore the cellular and subcellular distribution of pendrin messageand protein in mouse kidney in greater detail.
* S/ o- ^; A$ C7 h. W8 h5 T6 Y: ~7 p" b1 N) Q5 m+ \
METHODS
+ T" U; i. u; y \' b. E7 g E- c9 F5 P
Animals. Nonalbino Swiss mice weighing 20-30 g were studied (Harlan,Ardmore, TX). Mice consumed a balanced rodent diet (Zeigler Brothers, Gardners, PA) and tap water. Mice were anesthetized with 100% O 2 at 1 l/min with 4% isofluorane before death.. n, r5 V# U1 i9 J
2 E- N/ R/ J; ~$ r! ADissection of tubules. Mice were injected with 1.5 mg furosemide ip 30 min before death. Thekidney was perfused initially with 10 ml of ice-cold dissectionsolution and then with 20 ml of the same solution containing 1 mg/mlcollagenase B (0.2 U/mg; Roche, Indianapolis, IN) and 1 mg/ml BSA(Sigma). The dissection solution contained (in mM) 144 NaCl, 5 KCl, 1 Na 2 HPO 4, 1.2 MgSO 4, 2 CaCl 2, 5.5 glucose, and 10 HEPES, pH 7.4. The kidneys wereremoved, and a coronal section was made that contained the entirecorticopapillary axis. The cortex was separated from the rest of thesection and incubated in collagenase solution for 5 min at 37°C. Thetissue was transferred to the dissection solution with 1 mg/ml albuminbut without collagenase. Tissue was dissected at 4°C for not morethan 30 min. Nephron segments from the cortex were dissected asdescribed previously ( 22 ). Cortical thick ascending limbs(cTALs), proximal straight tubules, and CCDs were dissected from themedullary rays. CCD segments were at least 0.5 mm in length, had nobranched points, and displayed the typical "cobblestone"appearance. Proximal convoluted tubules, glomeruli, and connectingtubules (CNTs) were dissected from the cortical labyrinth. CNTs alsodisplayed the typical cobblestone appearance and were cut to span twobranched points. The distal convoluted tubule (DCT) was dissectedbetween its juncture with the macula densa and the beginning of theCNT. Tubule length was measured with a calibrated optical micrometer.The tubules were then transferred to an Eppendorf tube containing 0.5 ml dissection solution plus 10 µl RNAlater (Qiagen, Valencia, CA) butwithout collagenase or albumin. Transfer of tubules was accomplished by using glass tubing coated with dissection solution containing 1%albumin and connected to a Hamilton syringe with Silastic tubing. Samples were centrifuged at 11,750 g for 1 min at 4°C. Thesupernatant was removed. The tissue was then snap frozen in liquidnitrogen and stored at 80°C.& [" u i' C. O- ?9 U
# U8 W7 V3 T, C- ~1 O! W) O
Preparation of total RNA from kidney slices. After death, the left kidneys were excised from the mice and coronalslices were made. Each slice was cut into three regions: cortex, outermedulla, and inner medulla. Each piece was snap frozen in liquidnitrogen and then weighed. Isolation of total RNA was performed byusing an RNeasy minikit (Qiagen). The kidney tissue was placed in RLTbuffer (20 ml buffer/g kidney tissue) with 10 µl/ml -mercaptoethanol, homogenized (Omni tissue homogenizer, Omni/TechQuest, Warrenton, VA) at 15,000 rpm for 40 s, and placed on ice. A600-µl aliquot of the lysate was centrifuged at 16,000 g for 3 min. Six hundred microliters of 70% ethanol were added to thesupernatant and mixed. The resulting solution was then added directlyto an RNeasy spin column, and total RNA was isolated with a kit,following the manufacturer's instructions (Qiagen). Total RNA (3.125 µg) was added to 125 µl diethyl pyrocarbonate-treated watercontaining 0.016 U/µl RNAse-free DNase I, 4.2 mM MgCl 2, 1 mM KCl, and 0.3 mM Tris, pH 8.4. The mixture was incubated at 37°Cfor 30 min and then at 75°C for 10 min and then placed on ice andstored at 80°C.9 R" B- Q- _; ?3 f
( H6 l0 F& ^) x mPreparation of total RNA from individual tubules. Total RNA was prepared from individual nephron segments by using theEpicentre Kit (Epicentre Technologies, Madison, WI) following theinstructions of the manufacturer with minor modifications. Cell lysissolution (150 µl) with 25 µg proteinase K was added to each sample.Samples were incubated at 65°C for 30 min while being vortexed for5 s every 10 min and then placed on ice for 3-5 min.MasterPure complete protein precipitation reagent (75 µl) was addedto each lysed sample, vortexed for 10 s, and then centrifuged at10,000 g for 10 min. Ice-cold isopropanol (250 µl)was added to the supernatant of each sample. Samples were then inverted30-40 times and centrifuged at 10,000 g for 10 min at4°C. The isopropanol was decanted, and the pellet was rinsed twicewith ice-cold 75% ethanol and then resuspended in 65 µl diethylpyrocarbonate-treated water with 4 mM MgCl 2, 1 mM KCl, 0.3 mM Tris, pH 8.4, and 0.016 U/µl DNAse I. The samples were vortexedand incubated at 37°C for 30 min. The DNase I reaction was stopped bytransferring the samples to 75°C for 10 min. Samples were then storedat 80°C.! p, U, J: R# z- q% @; L
+ _- d+ G% p9 C0 Y* L6 G
Quantitative real-time RT-PCR. Quantitative real-time PCR was performed in the Quantitative GenomicsCore Laboratory in the Department of Integrative Biology andPharmacology utilizing a 7700 Sequence Detector (Applied Biosystems, Foster City, CA) ( 4, 15 ). Specific quantitative assays for mouse pendrin and -actin were developed by using Primer Express software (Applied Biosystems) following the recommended guidelines onthe basis of sequences from GenBank: 1 ) mouse pendrinqRT-PCR assay (accession no. AF-1674110), 1483( ): GCTGGCCTCATCTCAGCTG, 1552( ): GCAAGGGTTCCAGAAGCCT, 1504( ):6-carboxyfluorescein (FAM)/ 6-carboxy-tetramethylrhodamine(TAMRA): ATTGTGATGGTTGCCATCGTTGCC; and 2 ) mouse -actinqRT-PCR assay (accession no. X03672 ), 1035( ): GCTCTGGCTCCTAGCACCAT,1108( ): CCACCGATCCACACAGAGTAC, 1059( ): FAM/TAMRA: ATCAAGATCATTGCTCCTCCTGAGCGC.
( d: o, a0 Y- d3 t' L+ Z1 v5 o
: d- A" ~4 \8 h( m) p% ecDNA was synthesized in 10-µl total volume by the addition of 6 µl/well RT master mix consisting of 400 nM assay-specific reverseprimer, 500 µM deoxynucleotides, Superscript II buffer, DTT, and 10 USuperscript II RT (Invitrogen, Carlsbad, CA), added to an ABI 7700 96-well plate followed by the unknown RNA solution (4 µl). Eachsample was measured in triplicate plus a control without RT. Each platealso contained serial dilutions of an assay-specific sDNA (syntheticamplicon oligonucleotides) standard spanning a 5-log range and ano-template control. Each plate was covered with Biofilm A (MJR,Waltham, MA) and incubated in a thermocycler (MJR) for 30 min at 50°Cfollowed by 72°C for 10 min. Subsequently, 40 µl of a PCR mastermix [400 nM forward and reverse primers, 100 nM fluorogenic probe, 3 mM MgCl 2, and 200 µM deoxynucleotides, PCR buffer, and1.25 U Taq polymerase (Invitrogen)] were added directly toeach well of the cDNA plate. RT master mixes and all RNA samples werepipetted by a Tecan Genesis RSP 100 robotic workstation (Tecan US,Research Triangle Park, NC). PCR master mixes were pipetted utilizing aBiomek 2000 robotic workstation (Beckman, Fullerton, CA). Eachassembled plate was then capped and run in the ABI 7700 with thefollowing cycling conditions: 95°C for 1 min and 40 cycles of 95°Cfor 12 s and 60°C for 1 min. The resulting data were analyzed byusing SDS software (Applied Biosystems, Foster City, CA) with TAMRA asthe reference dye.
% Z4 x& w3 S F
/ N, B+ o8 N2 nSynthetic DNA oligonucleotides used as standards (sDNA) encompassed theentire amplicon for the assay (Biosource International, Camarillo, CA).We have shown in several assays that in vitro transcribed RNA ampliconstandards (sRNA) and sDNA standards have the same PCR efficiency whenperformed as described above (data not shown).
9 b1 i2 O9 w8 O0 t$ q/ A* Z! M: |; n) a- `
As a negative control, -actin transcript levels were measured ineach sample assayed for pendrin mRNA. -Actin and pendrin mRNA areexpressed as pendrin transcript per millimeter tubule (or per 10 glomeruli).8 a, {+ a6 P# o$ W: ` d/ }1 G l
B9 y2 x0 B) \# b9 P# {0 Q) zAntibody. The primary anti-pendrin antibody was a polyclonal antibody raised inrabbit that recognizes amino acids 766-780 of the human pendrinprotein sequence. This antibody has been characterized previously andused for immunolocalization of pendrin in normal mouse kidney( 20 ). For immunohistochemical localization of the thiazide-sensitive Na-Cl cotransporter (TSC), we used a polyclonal antibody raised in rabbit against a 110-amino acid segment of theNH 2 terminus of rTSC1, which corresponds to amino acids2-112 of the rat rTSC1. This antibody has beencharacterized previously ( 18 ) and was a gift from Dr.Steven C. Hebert (Yale University School of Medicine, New Haven, CT).% @8 R4 t7 c6 h$ t& u
2 J( Z' J# { `: D, [4 f, hTissue preparation for light microscopy. For light microscopic studies, ~2-mm-thick transverse sections ofkidney from each animal were embedded in polyester wax (polyethylene glycol 400 distearate, Polysciences, Warrington, PA), and 5-µm-thick sections were cut and mounted on gelatin-coated glass slides.
5 I* p9 ?2 s# s8 s
8 S# t- g" m1 yColocalization of pendrin and TSC immunoreactivity. Colocalization of pendrin and thiazide-sensitive cotransporterimmunoreactivity was accomplished by using sequential immunoperoxidase procedures. Five-micrometer sections were dewaxed in ethanol, rehydrated, and then rinsed in PBS. Endogenous peroxidase activity wasblocked by incubation of the sections in 0.3%H 2 O 2 for 30 min. The sections were rinsed inPBS, treated for 20 min with 5% goat serum in PBS, and then incubatedat 4°C overnight with the anti-pendrin antibody diluted 1:1,000 inPBS. The sections were washed twice in PBS for 5 min and then incubatedfor 30 min with peroxidase-conjugated goat anti-rabbitF(ab) 2 secondary antibody (Jackson Immunoresearch, WestGrove, PA) diluted 1:200 in PBS and then washed with PBS. The sectionswere then exposed to diaminobenzidine (peroxidase substrate kit, VectorLaboratories, Burlingame, CA). The sections were washed inglass-distilled water and then in PBS and incubated in 0.3%H 2 O 2 for 30 min. The sections were again washedin PBS and incubated for 20 min with 5% normal goat serum in PBS. Thesections were treated for 60 min with the anti-TSC antibody diluted1:8,000 in PBS, washed in PBS, incubated for 30 min with theperoxidase-conjugated anti-rabbit secondary antibody, and then againwashed with PBS. For detection of TSC immunoreactivity, Vector SG(Vector Laboratories) was used as the chromogen to produce a bluelabel. This label was easily distinguishable from the brown labelproduced by the diaminobenzidine used for detection of pendrin immunoreactivity. The sections were washed with glass-distilled water,dehydrated with xylene, mounted with Permount (Fisher Scientific, FairLawn, NJ), and observed by light microscopy. In each colocalization experiment, three control slides were included in which PBS only wassubstituted for the anti-pendrin primary antibody, the anti-TSC primaryantibody, or both primary antibodies.# \- P" P( C* R2 a: W
0 L3 i( D9 c1 G! ?! y3 I
Tissue processing for immunoelectron microscopy. Mice were anesthetized and the kidneys were preserved by in vivocardiac perfusion with 3% paraformaldehyde, 0.12% picric acid in PBS,pH 7.4, followed by overnight immersion at 4°C. The tissue was rinsedin PBS, and samples from the outer and inner cortex were immersed in0.1 M NH 4 Cl for 1 h at 4°C. The tissue samples werethen dehydrated in a graded series of alcohols and processed andembedded in Lowicryl K4M (Electron Microscopy Sciences, Ft. Washington,PA). Lowicryl polymerization was carried out under ultraviolet lightfor 24 h at 20°C and then for 48 h at room temperature. Samples containing well-preserved connecting segment and collecting duct were selected after light microscopic examination of 1-µm-thick sections stained with toluidine blue. Ultrathin sections of these weremounted on Formvar/carbon-coated nickel grids for immunogold cytochemistry.
1 B7 u! S9 m: L# x7 k7 |, }3 S' ]* j2 U2 U. m3 Y' t; V5 y* T8 {
Immunogold labeling. Briefly, the immunogold labeling procedure was performed by exposure ofthe ultrathin tissue sections to the primary antibody and then to agoat anti-rabbit IgG secondary antibody conjugated to 0.8-nm colloidalgold particles (Aurion UltraSmall gold conjugate, Electron MicroscopySciences), followed by silver enhancement (Aurion R-Gent SE-EM,Electron Microscopy Sciences). Unless noted otherwise, all steps weredone by floating the grids on droplets of solution at room temperature.The following solutions were used: incubation solution, 0.2琫tylated BSA (Aurion BSA-c, Electron Microscopy Sciences) and 10 mMNaN 3, in PBS, pH 7.4; and blocking solution, 5% BSA, 0.1%cold-water fish-skin gelatin, and 5% normal goat serum, in PBS. Thesections were exposed to 0.05 mM glycine in PBS for 15 min, incubatedwith the blocking solution for 30 min, washed with incubation solution,and then incubated in a humidified chamber overnight at 4°C with theprimary antibody diluted 1:1,000 in incubation solution. The sections were then washed with incubation solution and incubated for 1.5 hwith the secondary antibody diluted 1:100 in incubation solution. Thesections were washed with incubation buffer, washed with PBS, postfixedwith 1.25% glutaraldehyde in PBS, washed with PBS, and finally washedwith glass-distilled water. The sections were then exposed to thesilver- enhancement reagent for 40 min, washed with glass-distilledwater, and counterstained with saturated uranyl acetate and leadcitrate. Each group of sections subjected to the immunogold procedureincluded a control section that was exposed to incubation buffer inplace of the primary antibody.( S0 @6 W) S- j2 H8 m
9 _! s4 g& f- _6 CElectron microscopy. Ultrathin sections were examined with a Zeiss-EM10 transmissionelectron microscope. The CCD was identified by its characteristic heterogeneous epithelial cell population, which included principal cells and intercalated cells, and its location parallel to a cTAL ofHenle's loop in the medullary ray. Connecting segments and initialcollecting tubules (ICTs) were located in the cortical labyrinthbetween medullary rays. ICTs were identified by their epithelial cellmorphology, which is similar to that described for the CCD. Connectingsegments were distinguished from ICTs by the increased height of theepithelial cells and presence of tall vertical mitochondria in theconnecting segment cells.
3 O; p& g5 P0 T! M X4 ~" M1 c6 `9 p0 A% m
The mouse CCD and CNT contain at least three morphologically distinctintercalated cell subtypes: type A, type B, and a third cell type thathas been identified in both rat and mouse kidney and referred to asnon-A-non-B ( 30 ). The morphological characteristics usedto identify these intercalated cell subtypes were established inmorphological and immunocytochemical studies of both rat and mousecollecting duct ( 16, 30 ). Type A intercalated cells typically contain a centralized nucleus, mitochondria that are distributed throughout the cell, moderate apical plasma membrane microprojections, and prominent apical cytoplasmic membranetubulovesicles that have relatively electron-dense limiting membranes.Type B intercalated cells typically exhibit a rounded cell outline,eccentric nucleus, clustered mitochondria, relatively smooth apicalplasma membrane, and cytoplasmic vesicles throughout the cell.The cytoplasmic vesicles of type B intercalated cells are typicallysmaller in profile, and the limiting membranes are less electron densethan those in type A intercalated cells. Type B interalated cellsfrequently exhibit a vesicle-free band of cytoplasm along the apicalplasma membrane. The third intercalated cell subtype, non-A-non-B, has distinctive morphological features, including a very high mitochondrial density, prominent apical plasma membrane microprojections, and relatively few cytoplasmic vesicles, which are apical.
% k; a+ @8 ~& z+ H" h: b& B$ R6 ]. ?9 E @
Morphometric analysis. The boundary length of the apical plasma membrane, cytoplasm area,number of gold particles along the apical plasma membrane, and numberof gold particles over the cytoplasm, including cytoplasmic vesicles,were quantified in type B and non-A-non-B intercalated cells( 34 ) in three individual mice. A minimum of five of each intercalated cell type in each animal were selected randomly and photographed at a primary magnification of ×6,200. Individual photomicrographs were examined at a final magnification ofapproximately ×23,400. The exact magnification was calculated byusing a calibration grid with 1,134 lines/mm.
9 J6 ?& x) Q- r% I; c
; Y$ I2 V) }+ F6 E. W# r" v9 KThe boundary length of the apical plasma membrane was determined byintersection counting using the Merz curvilinear test grid with adistance of 20 mm between the points corresponding to 0.856 µm( D ) ( 34 ).
4 `, |& k$ C9 @# v( ^, N$ m3 q* x
& D. O; \+ X" P+ s4 e7 VThe boundary length ( B ) was calculated from the equation9 ?# g3 N9 F& F
- ^# M6 Q' F, |$ ~- `: x+ T* F, U9 M$ Gin which I represents the number of intersectionsbetween the test line and the plasma membrane, and B wasexpressed in millimeters.# _, U- M) }6 ^) T# a' M6 [# i
0 n. B9 k. |' u' F' v. rThe area of cytoplasm in the intercalated cell profiles was determinedby counting points over the cytoplasm by using the Merz curvilineartest grid and the formula for area ( A ) 23 `8 b4 J" a, L% F
: p0 H3 J9 m; q0 [& S
in which P is the number of points over thecytoplasm, and A was expressed in square millimeters.: i* I; d& U% V" V# Z" a4 P8 t
. c/ U' {+ Y$ S( a, s
Gold particles that were touching the apical plasma membrane and thoseover the cytoplasm, including cytoplasmic vesicle membranes, werecounted and were related to either the apical plasma membrane boundarylength (gold particles/mm of apical plasma membrane boundary length) orthe cytoplasm area (gold particles/mm 2 cytoplasm),respectively. In addition, the ratio of gold particles associated withthe apical plasma membrane to gold particles over the cytoplasm wasdetermined for each cell type.9 B' T0 _) F0 V- k$ v5 X# D z, [
8 Z8 s) N- k, L" [7 }2 `7 c5 f2 Q
Statistical analysis. For the RT-PCR, data comparisons among three or more groups were madeby using ANOVA with Tukey's posttest. For comparisons of gold labeldensity, repeated-measures ANOVA with Tukey's posttest was used.Statistical significance was achieved with a P Data are displayed as means ± SE.
: t; F& f* E+ z& T3 b$ a
) N5 j# c; E+ L0 IRESULTS
3 K- y5 Y/ w' X4 A, a0 J0 w* z" l1 H- E+ {; R3 @
Distribution of pendrin message in mouse kidney. Pendrin message abundance was examined in the cortex, outer medulla,and inner medulla of mouse kidney. As shown in Fig. 2, expression of pendrin relative to -actin mRNA was low in both the outer and the inner medulla.However, pendrin transcript expression was 6- to 10-fold higher in thecortex than in the medulla, similar to previously published results inrats ( 28 ). However, -actin mRNA/100 ng total RNA wasthe same in all three regions of the kidney (Fig. 2 ). Because pendrinmRNA is highly expressed in mouse cortex, the distribution of pendrinmessage within this region of the kidney was studied in greater detail.
7 o* a5 f5 c; c3 ?1 D0 C: B8 m ^& R
Fig. 2. Pendrin transcript in mouse kidney. Pendrin mRNA wasmeasured in cortex (COR), outer medulla (OM), and inner medulla (IM) ofmouse kidney. Pendrin mRNA was expressed as the percentage of -actintranscript measured in the same sample. The pendrin/ -actintranscript ratio was greater in cortex than in either inner or outermedulla, P -actin mRNA/100 ng total RNA was(×10 6 ), inner medulla, 2.0 ± 0.4; outer medulla,2.7 ± 0.2; and cortex, 2.5 ± 0.09 ( n = 6, P = not significant).* t5 e9 O% |( _+ ^: {
% l6 R. ?' S, ^. s9 J' s3 U
Figure 3 shows pendrin mRNA expression inindividual nephron segments of mouse cortex. As shown, pendrin messageexpression was detected in glomeruli, proximal convoluted tubule,proximal straight tubule, and cTAL. However, pendrin mRNA expressionwas at least fivefold higher in CNT and CCD ( P 1 To determine whetherthis distribution resulted from variation in RNA integrity in thesesegments, -actin mRNA abundance was measured in each sample studied.In contrast to the distribution of pendrin expression, -actinmessage was not lower in glomeruli, cTAL, and proximal tubule than inCCD and CNT (Fig. 3 ). Therefore the relatively low levels of pendrinmRNA detected in glomeruli and proximal tubule were not the result ofRNA degradation. We conclude that nephron segments containing type Bintercalated cells, such as CNT and CCD, express high levels of pendrinmRNA.
: A+ f* G- X/ s& x, B/ i/ I3 P' ]3 Y8 B7 ~9 X: [' Z7 k; r; w
Fig. 3. Pendrin transcript abundance in nephron segments of themouse cortex. A : pendrin mRNA/mm tubule length was measuredin individual nephron segments of mouse cortex. B : in eachof these nephron segments, -actin mRNA was also measured. Pendrintranscript was higher in CCD and connecting tubule (CNT) than incortical thick ascending limb (cTAL), proximal straight tubule (PST),or proximal convoluted tubule (PCT) ( P
- D' o' G& Y9 J: F
+ U- ] T, s' r! g& P: S- u6 a4 {Light and electron microscopic immunolocalization of pendrinprotein in mouse kidney cortex. Because pendrin protein and mRNA ( 20, 28 ) are most highlyexpressed in cortex, the distribution of pendrin immunoreactivity inmouse cortex was studied in greater detail by using light microscopic immunohistochemistry of mouse kidney cortex labeled for pendrin. Weobserved that within the mouse kidney, the distribution of pendrinprotein was similar to the distribution of pendrin mRNA describedabove. As reported previously ( 20 ), pendrinimmunoreactivity was not observed in the glomerulus, proximal tubule,or thick ascending limb of Henle's loop (Fig. 4 ). Figure 4 shows labeling of a subsetof cells within the collecting duct, as described previously( 20 ). Because the DCT contains intercalated cells ( 16 ), pendrin expression in this segment was explored. Todetermine whether pendrin is expressed in the DCT, sections werelabeled with antibodies specific for pendrin and for the TSC, a marker of DCT. Although the majority of DCT profiles did not exhibit pendrin-positive cells, a minority of cells with pendrinimmunoreactivity were present in occasional tubules that expressed TSC(Fig. 4 ). In rare profiles, continuous apical TSCimmunoreactivity was interrupted by a few pendrin-positive cells (Fig. 4 d ). Thus pendrin is expressed in a subset of cells withinthe DCT. Furthermore, some tubule profiles were observed that containedthe transition from the DCT to the CNT (Fig. 4 b ). In thesetubules, the DCT portion contained nearly continuous apical TSCimmunoreactivity with rare pendrin-positive cells, whereas the CNTportion contained primarily cells that were negative for TSCimmunoreactivity and a minority of cells with apical pendrinimmunoreactivity (Fig. 4 b ). In addition, occasional CNTprofiles were observed that had negative cells, pendrin-positive cells,and TSC-positive cells interspersed (Fig. 4 c ).* f& c9 I3 s- B z# _5 I9 h- l% d
5 L! s ~; }, ~0 U0 c0 C; E
Fig. 4. Light micrographs illustrating immunohistochemical colocalizationof pendrin and thiazide-sensitive Na-Cl cotransporter (TSC) protein inmouse cortex. Brown represents pendrin immunoreactivity, whereas bluerepresents TSC immunoreactivity. a : Low-power view of mousecortex. Pendrin is expressed in a subset of cells within the collectingducts (CD). Distal convoluted tubule (D) profiles typically exhibitonly apical TSC immunoreactivity. A single CNT with interspersed celltypes is also visible. This profile is enlarged in c andcontains negative cells, pendrin-positive cells (arrows), andTSC-positive cells (arrowheads). b : Transition from the latedistal convoluted tubule (D) to the CNT. The late distal convolutedtubule illustrated here exhibits continuous apical TSC immunoreactivitywith the exception of a single pendrin-positive cell (arrowhead) beforethe transition to the CNT, which contains TSC-negative cells andpendrin-positive cells (arrows). d : Several distalconvoluted tubule profiles are illustrated; some containpendrin-positive cells (arrows) among the TSC-positivecells.
8 `; ?; L5 |" i+ U5 K+ ^
. L! l& ?$ y. u0 {8 c6 U, gTo further characterize the distribution of pendrin, immunoelectronmicroscopy was performed. Again, no labeling was observed in theglomerulus, proximal tubule, or thick ascending limb (Fig. 5 ). However, in all sections observed,significant immunogold label was present in a subset of cells withinthe CCD, ICT, and CNT identified morphologically as intercalated cells(see below). As reported previously with light microscopic techniques( 20 ), principal cells and CNT cells were consistentlynegative (not shown), exhibiting no more than background levels, whichwas the level of gold particles also observed over tubule lumens orintercellular spaces.' z7 K) N8 [+ b& t/ ^
! V5 S- Y* [8 S! I7 d
Fig. 5. Transmission electron micrograph of a mouse proximaltubule cell subjected to immunogold labeling for pendrin. Only raregold particles are present. No significant label was observed in anyproximal tubule segment. Magnification, ×8,600.
! |/ F7 g5 v! D* @- _
3 e3 ]" s' X& B: _Three distinct types of intercalated cells, type A, type B, andnon-A-non-B, were observed in mouse CCD, ICT, and CNT( 30 ). Type A intercalated cells were observed frequentlyin the CCD and ICT and were consistently negative for pendrinimmunoreactivity (Fig. 6 ). However, allother intercalated cells throughout the CCD, ICT, and CNT were positivefor pendrin. Although both type B and non-A-non-B intercalated cellsexhibited pendrin immunoreactivity (see below), the subcellulardistribution of the immunolabel differed qualitatively between thesecell types.( u9 T3 C! }$ _
7 ~" @" A9 x0 \" O! m" B- G
Fig. 6. Transmission electron micrographs of type A intercalated cells fromthe mouse CCD subjected to immunogold labeling for pendrin. a : Lower magnification electron micrograph illustrating thetypical morphological features of the type A intercalated cell. Goldparticles are rare and are randomly distributed over the cell.Magnification, ×8,900. Higher magnification transmissionelectron micrographs of the apical ( b ) and basal( c ) regions of a type A intercalated cell from mouse CCDsubjected to immunolabeling for pendrin. Virtually no gold particlesare present. Magnification, ×19,200 ( b ) and ×19,000( c ).7 S" \ s) d& z
) O8 U: x8 d4 y' q& q. w5 EIn type B intercalated cells, pendrin immunolabel was predominantlyassociated with apical cytoplasmic vesicles (Fig. 7 ). Although type Bcells have cytoplasmic vesicles distributed throughout thecell, only vesicles in the apical region were labeled (Fig. 7, a and b ); vesicles in the basal region werenegative (Fig. 7 c ). The apical plasma membrane of type Bintercalated cells was also labeled. However, in most type B cells, theamount of label on the apical plasma membrane was low. In these cells,the apical plasma membrane surface was small and smooth, with fewapical microprojections. However, occasional type B intercalated cells displayed prominent apical plasma membrane microprojections, and thesecells also exhibited increased pendrin immunolabel on the apical plasmamembrane (Fig. 7 d ). Sections that were exposed to incubationbuffer in place of the primary antibody exhibited only rare goldparticles in any location (Fig. 8 ). TypeB intercalated cells were frequently identified in the CCD and the ICTand were rarely found in the CNT, as reported previously ( 1, 30 ).
0 t, N3 B6 Y4 C
4 ~+ D) `" P' nFig. 7. Transmission electron micrographof a type B intercalated cell from the mouse CCD subjected toimmunogold labeling for pendrin. a : Typical morphologicalfeatures of the type B intercalated cell, including a relatively smalland smooth apical surface, cytoplasmic vesicles throughout the cell, aneccentric cell nucleus, and prominent basolateral plasma membraneinfoldings. Pendrin immunolabeling is primarily associated with apicalcytoplasmic vesicles. Magnification, ×11,800. Higher magnificationtransmission electron micrographs of the apical ( b and d ) and basal ( c ) regions of a type B intercalatedcell from mouse CCD subjected to immunogold labeling for pendrin areshown. b : In the majority of type B intercalated cells,numerous gold particles were associated with cytoplasmic vesicles inthe apical region (arrowheads), whereas only occasional particles arepresent along the apical plasma membrane (arrows). c : Nosignificant labeling was present in the basolateral region of type Bintercalated cells, over either the basolateral plasma membrane(arrows) or the cytoplasmic vesicles (arrowheads). Magnification, b and c, ×21,000. d : Occasional typeB intercalated cells contained more prominent apical plasma membranemicroprojections and more pendrin immunolabeling along the apicalplasma membrane (arrows) compared with the typical type B intercalatedcell illustrated in a and b. Prominent labelingof apical cytoplasmic vesicles was also present (arrowheads).Magnification, ×26,400.1 g, p: \3 d' O; }0 u8 Q3 g
# C5 e+ G! k5 D0 l' ]7 FFig. 8. Transmission electron micrograph of the apical region ofa type B intercalated cell from the mouse CCD subjected to theimmunogold labeling procedure with buffer substituted for theanti-pendrin primary antibody. Virtually no gold particles are present.Magnification, ×15,500.
4 O+ A' [/ k- a$ v3 t' m9 Q0 h) }) B4 Q' U ` h
In non-A-non-B intercalated cells, which typically exhibited extensiveapical plasma membrane microprojections, pendrin immunolabel waspredominantly located on the apical plasma membrane (Fig. 9 ). Fewer gold particles were associatedwith apical cytoplasmic vesicles (Fig. 9 ). As we reported previously( 30 ), non-A-non-B intercalated cells were prevalent in theCNT. They were detected less often in the ICT and were not found in theCCD.3 M3 f: Q4 _* p0 q6 B; E
0 u& i2 {, |$ F! a- e% C( b9 a
Fig. 9. Transmission electron micrographs of non-A-non-B intercalated cellsin the mouse CNT subjected to immunogold labeling for pendrin. a : Typical morphological features of the non-A-non-Bintercalated cell, including long and numerous apical plasma membranemicroprojections, numerous mitochondria throughout the cell, apicalcytoplasmic vesicles, and a surface that bulges into the tubule lumen.Immunolabeling for pendrin was restricted to the apical region of thecell and was predominantly located along the apical plasma membrane.Magnification, ×12,900. b : At higher magnification,prominent immunogold labeling for pendrin is visible along the apicalplasma membrane (arrows). Although numerous apical cytoplasmic vesiclesare present, very few of these are labeled with gold particles(arrowheads) and the majority of these are negative for pendrin.Magnification, ×26,100.
0 N$ K5 C$ v( a) u2 v9 m- X: b* x6 Z
* I: o4 j4 z- G, o3 H4 N+ GThe distribution of gold label in type B and non-A-non-B intercalatedcells was quantified. In these two cell types, we compared the totalamount of gold label and the density of label in the apical membraneand in the cytoplasm and cytoplasmic vesicles (Table 1 ). Both the density of gold label andthe total gold label in the apical plasma membrane were markedlygreater in non-A-non-B cells compared with type B intercalated cells.In contrast, the density of gold label in the cytoplasm was greater intype B cells than in non-A-non-B cells; however, there was nodifference in the total cytoplasmic label in the two cell types.Furthermore, the ratio of label in the apical plasma membrane to labelin the cytoplasm was markedly greater in non-A-non-B cells than in type B cells.$ Q" F, R, \/ d1 ~$ g4 [0 F
8 O2 Q, G. j! J5 m- O* @Table 1. Distribution of gold label in type B and non-A-non-B intercalatedcells# d$ ]2 E: p; w6 |5 z1 A
9 j+ z6 Z9 o, j5 s9 JWe also observed profiles of intercalated cells that were positive forpendrin immunoreactivity that did not exhibit the full complement ofmorphological features that are characteristic for either type B ornon-A-non-B intercalated cells and thus could not be definitivelyidentified. However, the pattern of pendrin immunolabel was similar tothat observed in cells identified as type B and non-A-non-B in thatthey exhibited variable degrees of pendrin immunolabel in the apicalcytoplasmic vesicles and apical plasma membrane. s" |" L, E8 O! a/ S9 `
/ I# L1 n& x2 I; n9 ~& SDISCUSSION2 M q* g5 U8 ^2 E5 K# K* R
' s: \' C- h$ f. u8 B- LThe kidney has a tremendous capacity to excrete alkaline loads.For example, after drinking hypertonic NaHCO 3 for 5-8days, rats develop only a mild metabolic alkalosis ( 14 ).During metabolic alkalosis apicalCl /HCO 3 − exchange is upregulated, which augments secretion of OH equivalents along the CCD( 29 ). Thus determination of the gene product responsiblefor apical anion exchange represents an important issue in renal physiology.( g' g- B' ?+ {' E6 }% u
% _9 ?2 c |. ?+ Z0 u
Apical anion exchange in the CCD has been well studied by usingisolated CCD tubules perfused in vitro. During metabolic alkalosis, theCCD secretes HCO 3 − through an active process( 29 ), which is dependent on Cl present inthe luminal fluid but is Na independent andelectroneutral, consistent with Na -independentCl /HCO 3 − exchange( 29 ). In rabbit and mouse CCD, more than one-halfof intercalated cells in the CCD display apical, stilbene-insensitive,Na -independent Cl /HCO 3 − exchange ( 8, 10, 35 ). Because the gene product mediatingapical anion exchange has not been established, the immunohistochemicalclassification of non-A intercalated cells (Fig. 1 ) is incomplete.Identification of the gene product responsible for the apical anionexchanger would generate an immunohistochemical classification systemof intercalated cell subtypes that better reflectsH /OH transport function for eachintercalated cell subtype.1 q2 x: F! R& ^* [: u
* z# J2 w" `/ S( T+ i/ eBecause pendrin mediates Cl /OH,Cl /HCO 3 −, andCl /formate exchange in heterologousexpression systems ( 26, 28 ) and because it localizes tothe apical membrane of type B intercalated cells, pendrin represents acandidate gene for the putative apical anion exchanger of the type Bintercalated cell ( 20 ). Pendrin could mediateHCO 3 − secretion in native mouse CCD, either throughdirect transport of HCO 3 − by pendrin or throughpendrin-mediated transport of another base such as OH orformate. However, the physiological role of pendrin maybe more for regulation of halide balance, such as Cl orI, rather than for regulation of acid-base balance./ J4 K* c1 D4 T5 D
. D5 r2 Z# _! r9 f4 X7 E
Pendrin is expressed in type B cells, the predominant non-Aintercalated cell of the mouse CCD ( 30 ). Thus both pendrinand apical Na -independentCl /HCO 3 − exchange are found in a large percentage of intercalated cells of the mouse CCD. However, virtually all of the pendrin immunolabel was restricted to apical cytoplasmic vesicles, even though type B cells have cytoplasmic vesiclesdistributed throughout the cell. Very little immunolabel was detectedon the apical plasma membrane of the type B intercalated cell. However, under the conditions of previous studies, pendrin is sufficiently expressed along the apical plasma membrane of type B cells to modulatetransepithelial transport of HCO 3 − in the mouse CCD( 20 ). During metabolic alkalosis, CCD from wild-type, Pds( / ), mice secrete HCO 3 − ( 20 ). However,CCDs from mice with a genetic disruption of the pendrin gene, Pds( / ), absorbed HCO 3 − when studied under the sametreatment conditions ( 20 ). Thus it is likely that pendrinrepresents a gene product that contributes to the apical anion exchangeprocess of the type B intercalated cell. However, low levels ofHCO 3 − secretion reported in wild-type mice( 20 ) might reflect low levels of pendrin protein expressedalong the apical plasma membrane of the type B intercalated cell. It isalso possible that under the conditions of the perfusion studies,pendrin is trafficked to the apical membrane of the type B cell.
0 l7 m. @/ I U3 g' z" U3 {/ W
+ B P8 B/ ]* L8 p6 V5 DIn mice, cells with the morphological characteristics of intercalatedcells of the B type express H -ATPase along the basolateralplasma membrane and diffusely within cytoplasmic vesicles( 30 ). The presence of pendrin in the subapical space ofcells known to express H -ATPase within the cytoplasmraises the question of whether these cells have the capacity to up- ordownregulate transepithelial transport of net H orOH equivalents or Cl through trafficking ofthese transporters between the cytosol and the plasma membranefollowing changes in acid-base balance. These questions, however,will remain the subject of future studies.1 g! J2 L( w# X9 r" N0 \
+ O! B& Z _& q1 rAs described previously in ultrastructural studies of the mouse( 30 ), we observed that non-A-non-B cells are mostprevalent in the CNT, less frequently observed in the ICT, and notdetected in the CCD. The subcellular distribution of pendrin differsmarkedly in type B vs. non-A-non-B cells. In non-A-non-B cells, pendrin protein is highly expressed along the apical plasma membrane. Theseobservations predict that in mice under basal conditions, apical anionexchange, due to pendrin, occurs to a greater extent in non-A-non-Bcells than in type B cells. Thus in untreated mice, pendrin-mediatedanion exchange is likely greater in the CNT than in the CCD. However,this hypothesis cannot be tested directly because the CNT is not easilyperfused in vitro.
( w2 h& G0 k& p3 Y8 j
" M7 h! ^) y: [! o6 JOccasional intercalated cells are found in the late DCT of mouse kidney( 16 ). In the DCT, the vast majority of non-A intercalated cells in mouse DCT are non-A-non-B intercalated cells( 16 ). Because pendrin labeling was observed by lightmicroscopic immunohistochemistry in a subset of cells within occasionalDCT profiles, it is likely that pendrin is expressed in non-A-non-Bintercalated cells. However, this could not be confirmed byultrastructural observation because DCT profiles containingintercalated cells were not observed by electron microscopy. Thefailure to observe by electron microscopy DCT profiles containingintercalated cells is not surprising, because the great majority of DCTprofiles did not contain pendrin-positive cells.
. t/ C: ^ q/ B- Y. D0 I) c' P G3 G$ Z/ y0 X. P1 k+ u
In mice, intercalated cells that display the morphologicalcharacteristics of non-A-non-B intercalated cells expressH -ATPase in the apical plasma membrane and diffuselywithin cytoplasmic vesicles ( 30 ). Expression of bothpendrin and H -ATPase along the apical plasma membrane ofnon-A-non-B cells is surprising because pendrin is thought to mediateHCO 3 − secretion ( 20 ), whereasH -ATPase mediates H secretion( 13 ). It is possible that through upregulation of onetransporter, in parallel with downregulation of the other, the cell canbe converted from an H - to an HCO 3 − -secreting cell and vice versa, depending on the acid-base derangementof the animal. Alternatively, H -ATPase and pendrin may actin tandem to modulate transepithelial Cl transport.8 ]% ^2 b3 W( O5 S! \' U
* B4 `0 n/ U: A% R+ f3 @We observed the distribution of pendrin protein and mRNA to be similarin mouse kidney. Previous studies have detected pendrin mRNA inproximal tubule and CCD of rats by using Northern blots and RT-PCR( 28 ). Use of quantitative real-time PCR has the advantage over Northern blots and other RT-PCR techniques in that it allows pendrin mRNA expression to be quantified over a 5-log range ( 4, 15 ). Using this technique, we observed expression of pendrin inthe proximal tubule and the CCD, as reported by Soleimani et al.( 28 ). However, in mice, pendrin mRNA expression is more than fivefold higher in CNT and CCD than in both proximal tubule and cTAL.
5 `- }6 x( G9 M, _9 j$ U# k: w! p1 t8 M1 k7 V
In conclusion, pendrin is highly expressed in the CNT and the CCD ofmouse kidney. Pendrin is expressed in intercalated cells in a minorityof DCT profiles, likely in the late portion of the DCT. Pendrin proteinand mRNA expression are lower in the other structures of the mousecortex. Expression of pendrin in the apical plasma membrane is greaterin non-A-non-B intercalated cells than in type B intercalated cells.The observed differences in the subcellular distribution of pendrinimmunoreactivity in type B intercalated cells and non-A-non-Bintercalated cells suggest that under the conditions of theseexperiments, non-A-non-B intercalated cells are more actively involvedin pendrin-mediated anion exchange than are type B intercalated cells.However, the presence of pendrin immunoreactivity in the apicalcytoplasmic vesicles in both type B and non-A-non-B intercalated cellssuggests that vesicle trafficking may occur in both cell types toregulate pendrin-mediated anion exchange under different physiological conditions.6 f! ?$ t% p" g* n
# Q3 w* D1 r' n. j% k3 G* ?5 u6 {0 ~- bACKNOWLEDGEMENTS
1 @/ @" d2 j" `1 i8 }$ R/ L; a
$ \6 u! R, N& r# I$ z6 A; `5 KWe thank Mae De la Caldenza and Michael P. Fischer (Department ofMedicine, University of Texas Medical School, Houston, TX) and MelissaA. Lewis, Lauren DeWitt, and Dr. Sharon W. Matthews (University ofFlorida College of Medicine, Electron Microscopy Core Facility,Gainesville, FL) for technical assistance. We thank Dr. Mark Knepperfor helpful suggestions.
+ }1 R2 e: ~9 X# P4 f" x6 g1 c 【参考文献】1 H8 X4 \1 p' g8 d! {6 K5 t
1. Alper, SL,Natale J,Gluck S,Lodish HF,andBrown D. Subtypes of intercalated cells in rat kidney collecting duct defined by antibodies against erythroid band 3 and renal vacuolar H -ATPase. Proc Natl Acad Sci USA 86:5429-5433,1989 .
7 A3 }" q( i" \, a# T" a
: D. |% E# G) ]2 f6 m
. [; L% k+ J! {- y2 J- P1 H4 Z& ]3 q: B2 N, N3 M6 f2 j
2. Bastani, B,Purcell H,Hemken P,Trigg D,andGluck S. Expression and distribution of renal vacuolar proton-translocating adenosine triphosphatase in response to chronic acid and alkali loads in the rat. J Clin Invest 88:126-136,1991 .
7 u1 i' A- X- A) J3 o9 S* V* O4 r( {& `( G5 V1 }/ U% u! g; c
6 f' p+ A4 C3 E* l% q6 T
) j7 T1 a& k! y7 ?0 Q" [6 @
3. Brown, D,Hirsch S,andGluck S. Localization of a proton-pumping ATPase in rat kidney. J Clin Invest 82:2114-2126,1988 .5 `8 T6 h7 |4 r4 e
; y$ Z$ } Q$ C- u w* h$ i
7 S% P+ ]1 {. {0 l6 I/ N+ f
; ?" v5 A" x0 w9 C. x4. Bustin, SA. Absolute quantification of mRNA using real-time reverse transcriptase polymerase reaction assay. J Mol Endocrinol 25:169-193,2000 .
0 g- t) p4 Q6 ?: _6 I% k
% P3 E$ S" D, v# ~
3 t$ f' o; y* O5 _) E: Z' n1 ]/ e8 D/ ]8 v
5. Ciampolillo, F,McCoy DE,Green RB,Karlson KH,Dagenais A,Molday RS,andStanton BA. Cell-specific expression of amiloride-sensitive, Na -conducting ion channels in the kidney. Am J Physiol Cell Physiol 271:C1303-C1315,1996 .) m, g( F8 }' u) z* |5 H/ |
3 O# |3 h" o# C# `$ e5 M o( z4 m' b& h
. Y; f+ {5 ?) I- p5 p L' u6. Drenckhahn, D,Schluter K,Allen DP,andBennett V. Colocalization of band 3 with ankyrin and spectrin at the basal membrane of intercalated cells in the rat kidney. Science 230:1287-1289,1985 .
; ]& a/ ~8 I0 }' _% v9 Z) o |" O! b5 F X7 Y" W
! r" J. ?$ Z- g* S0 ^' Y
1 k& b: |: w* {1 n e2 H$ O7. Elkjaer, ML,Hager H,Ishibashi K,Muallem S,Frokier J,andNielsen S. Laser confocal microscopical and immunoelectron microscopical localization of anion exchanger AE4 in rat kidney (Abstract). J Am Soc Nephrol 12:3A,2001.
6 N5 T2 O5 h" ~" M4 v( R6 ?) t6 u# s7 Q7 d! S& |
' V- U. f1 D5 N2 }: Q/ m1 m/ v3 @: B0 |
8. Emmons, C. Functional characterization of anion exchange in mouse cortical collecting duct (CCD) intercalated cells (ICs) (Abstract). J Am Soc Nephrol 8:5A,1997.. x2 f4 ~6 m* s# J5 M. E7 N
4 x9 ^ l j/ W4 Y8 K3 H3 M4 Z! y3 d# w7 A
: `/ D) ]8 C* ~; z5 f9. Emmons, C. Transport characteristics of the apical anion exchanger of rabbit cortical collecting duct b-cells. Am J Physiol Renal Physiol 276:F635-F643,1999 .* n+ R3 i Q+ s2 ?& n: p# w s
: @5 [, D0 s5 N& _- a+ U1 U
1 X3 s- K. l% u! d8 l5 X$ x- X$ N1 P, U; U
10. Emmons, C,andKurtz I. Functional characterization of three intercalated cell subtypes in the rabbit outer cortical collecting duct. J Clin Invest 93:417-423,1994 .
( j# L( s' f7 W) T) _9 B) P/ `. ]- H; S" K' \; S' Y7 ^
. A! B$ ]/ W% Q: [( S$ g' Z
8 w' h( p6 s; X! \$ ~11. Everett, LA,Glaser B,Beck JC,Idol JR,Buchs A,Heyman M,Adawi F,Hazani E,Nassir E,Baxevanis AD,Sheffield VC,andGreen ED. Pendred syndrome is caused by mutations in a putative sulphate transporter gene (PDS). Nat Genet 17:411-422,1997 .
}2 I! [* F3 B9 M+ [) o
8 |, G" n- ~8 `0 r L+ M4 ^
1 Q9 S* j* I w4 s8 u
/ e& l( |, h0 a- K' b$ W12. Fejes-Toth, G,Chen WR,Rusvai E,Moser T,andNaray-Fejes-Toth A. Differential expression of AE1 in renal HCO 3 − -secreting and -reabsorbing intercalated cells. J Biol Chem 269:16717-26721,1994.3 b% y& S( p/ m# L2 r: M
, l3 h5 D. `5 Y- o3 n' h: j, s
. r7 x W& ~7 D: C- d8 B) Q+ S8 ?. q( q# Z3 J: ^
13. Gluck, S,Kelly S,andAl-Awqati Q. The proton translocating ATPase responsible for urinary acidification. J Biol Chem 257:9230-9233,1982 .1 l: H0 J' G0 I) ]( q
( o: m& S4 o7 f- `3 {# `$ V2 X. ^
/ K: ?) k7 x' z' f: J& y# U
" O }2 ]" _2 R3 r' s O14. Good, DW. Adaptation of HCO 3 − and NH 4 + transport in rat MTAL: effects of chronic metabolic acidosis and Na intake. Am J Physiol Renal Fluid Electrolyte Physiol 258:F1345-F1353,1990 .
5 G2 w- y H2 E, u; Q c/ S2 x+ v% K+ `4 K8 H
) {! W# x" B/ H2 v7 E( Y
% a7 a0 R, N# E% y" q( I' e% N' ^0 C15. Heid, CA,Stevens J,Livak KJ,andWilliams PM. Real time quantitative PCR. Genome Res 6:986-994,1996 .
9 a% n: N0 L z. \0 D* z9 J/ b* V/ m/ p7 Z
# p# }$ p1 S1 G9 \: I/ g% n* d8 S1 p! M; \ l/ D U8 p
16. Kim, J,Kim YH,Cha JH,Tisher CC,andMadsen KM. Intercalated cell subtypes in connecting tubule and cortical collecting duct of rat and mouse. J Am Soc Nephrol 10:1-12,1999 .) T0 | K: u- X# K" {
/ ?# B0 u! A( O6 S9 }# b
4 G; J! Z. _3 X: h, B# s* [' d/ k0 d% f
6 f3 c: R N$ |# F$ x" r17. Kudrycki, KE,andShull GE. Primary structure of the rat kidney band 3 anion exchange protein deduced from a cDNA. J Biol Chem 264:8185-8192,1989 .7 x5 H7 U1 W* l1 Z4 Q* \
2 j U7 g, ]+ S# _3 f: d3 `6 ~$ ^/ x% \
: ~1 a! n. Z& s6 V) q7 e
18. Plotkin, MD,Kaplan MR,Verlander JW,Lee WS,Brown D,Poch E,Gullans SR,andHebert SC. Localization of the thiazide sensitive Na-Cl cotransporter, rTSC1 in the rat kidney. Kidney Int 50:174-183,1996 .
u% n4 {5 d- o* B6 ~. m+ {. C( A
/ a! H6 u: J, e9 B( v( d# j* u) x5 X9 W& d+ Z3 u$ y# {1 c
/ _5 m4 p) v7 W0 J! g5 f+ P19. Royaux, IE,Suzuki K,Mori A,Katoh R,Everett LA,Kohn LD,andGreen ED. Pendrin, the protein encoded by the pendred syndrome gene (PDS), is an apical porter of iodide in the thyroid and is regulated by thyroglobulin in FRTL-5 cells. Endocrinology 141:839-845,2000 .9 \% ^- `/ K4 n, i
) r& p( Q3 v# a. J
/ P; q6 ~0 R+ {& P5 d) ^# n
& Z5 h: {5 p% R* z$ l; D8 b20. Royaux, IE,Wall SM,Karniski LP,Everett LA,Suzuki K,Knepper MA,andGreen ED. Pendrin, encoded by the pendred syndrome gene, resides in the apical region of renal intercalated cells and mediates bicarbonate secretion. Proc Natl Acad Sci USA 98:4221-4226,2001 .3 t. ~' z* d3 y$ Z2 ^
* Z8 D2 M! h( T1 x
9 {- u+ L; X0 [# S" M1 M
& W9 l# P! n. G2 q/ W# A. O# {21. Sabolic, I,Brown D,Gluck SL,andAlper SL. Regulation of AE1 anion exchanger and H -ATPase in rat cortex by acute metabolic acidois and alkalosis. Kidney Int 51:125-137,1997 .7 x& S& T6 l/ W3 n
1 w, i+ w. P4 U* b$ Z+ ~7 l
: `# l+ f w, ~7 l9 ]# q1 f
0 D5 _. u- s( H22. Sands, JM,Terada Y,Bernard LM,andKnepper MA. Aldose reductase activities in microdissected rat renal tubule segments. Am J Physiol Renal Fluid Electrolyte Physiol 256:F563-F569,1989 .
% O* d" D0 j+ `4 U' ?
# F6 }( M! L3 e* I+ Q9 R% t5 [3 z+ B; z
4 e8 J% T& E8 Q' }23. Schuster, VL. Bicarbonate reabsorption and secretion in the cortical and outer medullary collecting tubule. Semin Nephrol 10:139-147,1990 .
( [* u9 X8 u# I3 e+ Q, m4 U
2 P1 Y; P2 {+ [$ ~* t V0 x Z7 \/ S/ s0 k* \
9 N, `4 _! M# u/ d9 c24. Schuster, VL. Function and regulation of collecting duct intercalated cells. Annu Rev Physiol 55:267-288,1993 .8 F }/ z8 S( K. f; G$ q. m- [6 z
9 ], I( C3 @, X$ s" D. ~8 q4 J0 P7 Q& `6 A
+ S" J& P9 M1 q
25. Schuster, VL,Fejes-Toth G,Naray-Fejes-Toth A,andGluck S. Colocalization of H -ATPase and band 3 anion exchanger in rabbit collecting duct intercalated cells. Am J Physiol Renal Fluid Electrolyte Physiol 260:F506-F517,1991 .9 P/ l* m; u7 v5 m5 T/ P
+ R3 Z) n5 z: f4 |' b) t* @" k+ g( ]; u5 S7 b* b! H# N- o
: \* d3 D1 w8 |1 u% q) G1 A9 Z1 \26. Scott, DA,andKarniski LP. Human pendrin expressed in Xenopus laevis oocytes mediates chloride/formate exchange. Am J Physiol Cell Physiol 278:C207-C211,2000 .
5 _: C9 [0 ]4 Z {( U7 U+ ?: f$ I% C) y& M. z( e2 l* F! g8 ], m
+ e; W" D& B* I. c* X
' K. @* [: o0 G& Y D27. Scott, DA,Wang R,Kreman TM,Sheffield VC,andKarniski LP. The pendred syndrome gene encodes a chloride-iodide transport protein. Nat Genet 21:440-443,1999 .2 k! x7 J. k3 `! @0 ~* }
7 L: S4 P7 i$ ^; h. j- d: b
! B% {; e; k% q0 s7 O) X9 ~( I/ W3 A& l# H
28. Soleimani, M,Greeley T,Petrovic S,Wang Z,Amlal H,Kopp P,andBurnham CE. Pendrin: an apical Cl /OH /HCO 3 − exchanger in the kidney cortex. Am J Physiol Renal Physiol 280:F356-F364,2001 .. d) s. P3 p/ J
9 L+ l8 z5 l) n: O) H6 U; F: O! K1 i
9 {0 {4 M! w9 \5 I% d( g$ N. s. H% q! s
29. Star, RA,Burg MB,andKnepper MA. Bicarbonate secretion and chloride absorption by rabbit cortical collecting ducts: role of chloride/bicarbonate exchange. J Clin Invest 76:1123-1130,1985 .
9 d7 u. o9 Y2 B
6 M0 ^3 W' G* z
9 {# V2 o9 C3 z+ n+ u% b
" M9 F) f3 w2 i30. Teng-ummnuay, P,Verlander JW,Yuan W,Tisher CC,andMadsen KM. Identification of distinct subpopulations of intercalated cells in the mouse collecting duct. J Am Soc Nephrol 7:260-274,1996 .' o8 @0 l, p5 C( I' |9 A4 [
; q5 f# P( q9 h" Y* J2 I5 |9 a6 U @! s6 T
( @$ R. u1 X |31. Tsuganezawa, H,Kobayashi K,Iyori M,Araki T,Koizumi A,Watanabe SI,Kaneko A,Fukao T,Monkawa T,Yoshida T,Kim DK,Kanai Y,Endou H,Hayashi M,andSaruta T. A new member of the HCO 3 − transporter superfamily is an apical anion exchanger of beta-intercalated cells in the kidney. J Biol Chem 276:8180-8189,2001 .
7 B' P( H1 q6 w" n* K6 r: N# m3 a% e! p8 Z! v
1 ~% ~$ j, U% K$ b c7 x, Z4 F& u1 Q
i- G) E5 Y) T4 O& a6 g
32. van Adelsberg, JS,Edwards JC,andAl-Awqati Q. The apical Cl/HCO 3 exchanger of b intercalated cells. J Biol Chem 268:11283-11289,1993 .
6 d* v/ V. k; i8 ~; }2 a: l% Q7 _" f/ @( p9 o. F7 ^& O
/ I) _. J) _! E0 J% m* a" _
3 }5 _1 t9 U: T i33. Verlander, JW,Madsen KM,Cannon JK,andTisher CC. Activation of acid-secreting intercalated cells in rabbit collecting duct with ammonium chloride loading. Am J Physiol Renal Fluid Electrolyte Physiol 266:F633-F645,1994 .
8 r6 F, L) _/ q! H6 T$ `9 a* W) i. w2 r H( d! |
" v. i( b% @4 |
4 ^9 K* r l1 U
34. Weibel, ER,andBolender RP. Stereological techniques for electron microscopic morphometry.In: Principles and Techniques of Electron Microscopy, edited by Hayat MA.. New York: Van Nostrand Reinhold, 1973, p. 237-296.9 c' \- H) P( |% Z& t$ ^& I: D
6 w$ h E3 y8 M4 }; v7 k( P: l% Z& i$ a% c/ e+ J
1 _. [) Y( q# e. u$ M35. Weiner, ID,Weill AE,andNew AR. Distribution of Cl /HCO 3 − exchange and intercalated cells in rabbit cortical collecting duct. Am J Physiol Renal Fluid Electrolyte Physiol 267:F952-F964,1994 . |
|