|

- 积分
- 0
- 威望
- 0
- 包包
- 0
|

作者:SunitaGoyal, GregoryVanden Heuvel, Peter S.Aronson,作者单位:Departments of Internal Medicine and Cellular and Molecular Physiology, Yale UniversitySchool of Medicine, New Haven, Connecticut 06520-8029; and Department of Anatomy and Cell Biology, Universityof Kansas Medical Center, Kansas City, Kansas 66160-0003
9 ~5 }% M, D J7 H , K( ? i' d( n: N$ x8 v! w
I5 Z1 X1 F- l1 i9 e : G5 G6 J& {3 Q5 ^
4 m& l% i5 ]+ b2 e7 N; `- n , h" q* Q6 I! s4 Y9 |
$ t; M; V7 E5 ?! C' h) d
$ q% t4 S i# ]- b6 {( o
+ U( X6 f+ c% ?9 H" ^6 @) Z
7 n( _7 H; g ]4 f# |
. w' n: A& @. ]7 C8 Z0 D/ U5 w5 T
% S6 W+ L( V: X1 R/ ^7 l3 H( ? w
8 W7 Q) i. G! R3 \ 【摘要】
; i& M( i% I& U) W AlthoughNa /H exchanger isoform 3 (NHE3) mediates mostNa /H exchange in the proximal tubule, studiesof NHE3/NHE2 null mice suggest residual Na -dependentproton secretion (Choi JY, Shah M, Lee MG, Schultheis PJ, Shull GE,Muallem S, and Baum M. J Clin Invest 105:1141-1146, 2000). To characterize additional NHE isoforms thatmight be expressed in the kidney, we identified the partial sequence ofa novel NHE. PCR was used to define the 5'- and 3'-ends, and a cDNAencoding the complete open reading frame was amplified from mousekidney. The predicted protein of 576 amino acids, which we havenamed NHE8, has 30-35% amino acid identity to known mammalianisoforms 50% identity to Drosophilamelanogaster "NHE1," suggesting it is the mammalianortholog of this ancient invertebrate isoform. Northern blot of mousetissues revealed ubiquitous expression. Western blot using anti-NHE8antibodies demonstrated protein expression in apical membranes purifiedfrom rat renal cortex by divalent cation precipitation. In situhybridization revealed that NHE8 message was present in both cortex andmedulla. In the cortex, NHE8 was present in the majority of corticaltubules, consistent with proximal tubule (S1 and S2) localization. Inthe medulla, NHE8 message was most highly expressed in the proximaltubules (S3) of the outer stripe of the outer medulla. Thus NHE8 isexpressed in the proximal tubule, where it may contribute to apicalmembrane ion transport.
, a, \9 z4 U& |' N2 H 【关键词】 sodium/hydrogen exchange proximal tubule
6 Z7 x* }8 H) i% Q& o4 `; k3 @& j- b INTRODUCTION: r) \9 s, q3 h' p/ H7 C/ I( O) A
0 ~& l; t& h4 g
N A /H EXCHANGERS ( NHE S) are a growing family of transmembraneproteins that mediate the electroneutral exchange of Na for H ( 15, 24 ). Thus far, seven mammalianisoforms have been identified (NHE1-7) ( 8, 13, 14, 16, 19, 22, 27 ) that differ in terms of their tissue distribution,membrane localization, inhibitor sensitivity, and physiologicalregulation. Despite these differences, they have structuralsimilarities that define them as a family of proteins. NHE1-7 are660-900 amino acids in length and share a similar primarystructure. Membrane topology predictions suggest that they contain anNH 2 -terminal hydrophobic domain with 10-12transmembrane spans and a COOH-terminal hydrophilic domain with notransmembrane spans. The NH 2 -terminal hydrophobicdomain is most highly conserved (40-70%) and is thought tocontain the putative catalytic core, whereas the COOH-terminalhydrophilic domain is less conserved (10-20%) and is thought tobe important for regulation ( 15, 24 ).( i6 X7 X4 N* ~# O1 j
. P1 Z$ z; P8 V/ U3 x' ?In the mammalian kidney, NHE activity contributes to the maintenance ofacid-base balance, volume regulation, and blood pressure control. Theapical plasma membrane isoform NHE3 has a critical role in this regard.NHE3 is responsible for 50-60% of proximal reabsorption ofbicarbonate and fluid ( 20, 25 ). As would be expected,NHE3-null mice have relative hypotension, metabolic acidosis, and renalsalt wasting ( 10, 11, 20 ). Although NHE3 mediates most ofthe Na -dependent bicarbonate reabsorption in the proximaltubule, whether other NHE isoforms contribute to this process isuncertain. Earlier studies by our group using in vivo microperfusion ofcortical proximal tubules in NHE3 null mice showed no remainingcomponent of EIPA-inhibitable transtubular bicarbonate absorption( 26 ). More recently, in vitro microperfusion studies ofthe proximal tubule with measurements of intracellular pH have revealeda large component of EIPA-inhibitable Na -dependent acidextrusion (~40%) across the apical membrane that persists in NHE3 orNHE3/NHE2 null mice ( 4 ). Thus this study suggested thepossible presence of an NHE isoform other than NHE3 or NHE2 thatcontributes to apical membrane Na /H exchangein the proximal tubule.( Z0 Z% }* S4 u2 K1 B% L& X: F& S
5 ~' r5 H2 `" [$ u. V* J- K
Given the possibility of additional NHE isoforms that may play a rolein renal physiology, we attempted to identify novel NHE isoformsexpressed in the kidney. We report here the identification and cloningof a novel NHE isoform, NHE8, that is expressed in the kidney and is acandidate to mediate apical membrane ion transport in the proximal tubule.
/ f6 z) |2 |+ D% W* l* o
- ^1 l' e5 Q# G% ^MATERIALS AND METHODS* [. Q. }* a# J, t- b
2 y$ ?7 ^: C; d1 FcDNA Cloning of NHE8
2 i( l; Q$ L! X8 w5 F& d. a9 B& l
With the use of the rabbit NHE3 sequence as a query, aTBLASTN search of the GenBank nonredundant database identified ahuman mRNA that appeared to encode a novel NHE (gi no. 4589521, subsequently updated as gi no. 20521701). However, the gi no.4589521 sequence appeared to be incomplete. Specifically, the firstamino acid aligned with amino acids 150-200, whereas the stopcodon aligned with amino acids 550-600 of known isoforms. PCRusing gene-specific primers amplified the predicted 415 nucleotideproduct from a human kidney cDNA library, as well as mouse kidney cDNAlibrary, confirming its expression in native renal tissue.3 M- G) ~. Q i! @* k3 M# n
$ u; w. x! _. A4 TTo ascertain the full-length mouse sequence, we utilized a combinationof nested PCR, 5'-rapid amplification of cDNA end (RACE) and 3'-RACE.First, primers directed against vector sequences and gene-specificsites were used to perform nested PCR using a mouse kidney cDNA library(Clontech) as a template. This yielded 541 nucleotides of additionalupstream sequence. However, the 5'-end of the coding sequence was stillincomplete on the basis of alignment to other NHE isoforms, so 5'-RACEwas performed. Total RNA was extracted from the kidneys of Black Swissmice (TriZol), mRNA was purified from total RNA (Qiagen oligotexbeads), and 5'-RACE was performed (Clontech Marathon cDNA AmplificationKit, catalog no. K1802-1). This revealed an additional 73 nucleotides of sequence, which extended the open reading frame upstreamby two nucleotides to include a methionine in a favorable context fortranslation initiation ( 9 ). This methionine was in aposition analogous to the initiation methionines of other mammalianNHEs and thus likely represents the translational start site. We then 500 nucleotide product, which consisted of119 coding nucleotides followed by a stop codon, a 388 nucleotide 3'-untranslated region (UTR), and a poly-A tail. The stop codon alignedwith the stop codon in the single, long open reading frame of theaforementioned human mRNA in the database (gi no. 4589521).
2 S3 D, o1 A% g k3 i0 g; x( [, e5 j
$ S3 }3 c$ F, [% e# oThe sequence of the complete open reading frame was amplified frommouse cDNA by using primers directed against the 5'-UTR (GAACTCTGTAGTCTCGGAAGCTCGCAGGATAG) and the 3'-UTR(CAAGAGAAGCAGGAAGGAGGCTGGTAACTGCC). Sequencing of this solitary PCRproduct revealed 100% identity to the nested PCR and RACE products and96% identity to the corresponding sequence of the human mRNA. Thisnovel mouse NHE cDNA sequence has been deposited in Genbank as NHE8(GenBank accession no. AF-482993).6 K l& Y( F' h: s2 h3 P% ~
& O8 A& X6 P8 P1 \" d0 p# hNorthern Blot Analysis' K7 o$ z" \) u, S+ r; Z# v9 r
+ l8 A! O0 Z# M0 k7 J
A mouse multiple tissue Northern blot (Clontech) was probed witha 32 P-labeled PCR-generated cDNA clone spanning nucleotides3-1069 of the mouse NHE8 coding region, which shares only 30%sequence identity to known NHE isoforms. The Northern blot wasprehybridized in Church-Gilbert solution containing 40% formamide and100 µg/ml denatured salmon sperm DNA for 24 h at 42°C. Theblot was hybridized for 24 h at 42°C in the same solutioncontaining 2 × 10 6 counts · min 1 · ml 1 of either the 32 P-random prime-labeled NHE8 probe or asimilarly labeled -actin probe as an RNA loading control. Afterhybridization, high-stringency washes were performed by washing with0.1× SSC, 0.5% SDS, for 30 min at 65°C.
7 o) ]# t- }5 d6 l! G& n& Q' }
9 q: r% v5 ^. Z0 M' q. G% p6 UPreparation of Fusion Protein Antibodies* `, B* N# y: p. U
F4 R& z5 O. d* A) [+ ZTo generate polyclonal antibodies specific for NHE8, amaltose-binding fusion protein that contained the COOH-terminal 89 amino acids of human NHE8 (MBP-hNHE8_t89) was constructed. These 89 COOH-terminal amino acids share with NHE1-7 and thus were likely to provide isoform-specificantibodies. The human sequence was used as a template becauseat the time of antibody preparation, the COOH end of the mouse sequencewas unknown. The mouse and human cDNA sequences were subsequently foundto be 93% identical in this region.
" t6 h: H' z0 B8 z8 S2 J* f3 C7 I, S$ R( r2 b |; Z0 U# G
In brief, primers with engineered restriction sites ( Eco RIand Xba I) were used to amplify a PCR product from the humankidney cDNA library (Clontech). The resultant PCR product, whichcontained the terminal 267 coding nucleotides stop codon ofNHE8, was cloned into the Eco RI/ Xba I sites of thepMal-C2 vector (New England Biolabs). The resulting pMal-C2/NHE8vector was transfected into Top10F' (Invitrogen) competent cells, andthe MBP/hNHE8_t89 fusion protein was expressed and purified accordingto manufacturer recommendations (New England Biolabs).. ?/ s9 f5 T1 a) Y; e( o7 u5 |
. x# F9 U6 W9 {- t' oRabbits were immunized with the MBP-hNHE8_t89 by Pocono Rabbit Farm(Canadensis, PA). Antisera were negatively purified by passage throughan MBP lysate-affinity column. Sepharose G fast-flow beads withimmobilized lysate of cells expressing MBP were prepared permanufacturer's recommendations (Amersham). The negatively purifiedantisera were then dialyzed in PBS-glycerol, concentrated bycentrifugation through Centricon-30 filters (Amicon), and stored at 20°C., z3 H/ I2 T; n( `9 x m
& J( D9 ?1 t- w1 b7 U" S% b
Transient Expression of NHE8 in COS-7 Cells
) e2 C# C; Y% D" Z" V
* ?8 u$ }* p5 mRabbit NHE1, rat NHE2, rabbit NHE3, and rat NHE4 cDNAs had beenpreviously subcloned into pBluescript KS( ) ( 17 ). Foreukaryotic expression, both NHE1 and NHE3 cDNAs were each subclonedinto the Eco RI/ Xho I sites of pcDNA3. NHE2 cDNAwas subcloned into the Not I/ Xho I sites of pcDNA3,and NHE4 cDNA was subcloned into the Xho I/ Bam HIsites of pcDNA3. The mouse NHE8 PCRproduct containing the complete open reading frame was initiallyinserted into pcR2.1TOPO (Invitrogen) and then subsequently subclonedinto the Eco RI site of pCDNA3.1, and orientation wasconfirmed by sequencing.
J. I A$ ]9 k' L5 s! Q
; A+ j+ `8 S8 `COS-7 cells were grown in DMEM/high-glucose medium with 10% FCS, 50 units/ml penicillin, and 50 mg/ml streptomycin at 37°C in 5%CO 2 -95% air. Cells were transfected with cDNAs by use of LipofectAMINE 2000 per manufacturer's protocol (Invitrogen). Two hours after transfection, transfection complexes were removed and freshmedium ± 50 ng/ml tunicamycin were added. Cells were assayed forprotein expression by Western blot analysis ~36 h posttransfection.1 \2 t$ T( X0 g+ r$ N5 r0 Y
+ n9 E( l) y X- P2 e' t
Isolation of Rat Brush-Border Membranes. N& \) }1 H; v: D1 _/ Q M2 y
# {6 E7 P s9 Q
Renal brush-border membranes (BBMs) were isolated from rat renalcortex by magnesium aggregation and differential centrifugation asdescribed previously ( 2 ). Specific activity of the apical membrane marker -glutamyl transpeptidase was assayed as described ( 21 ), and average enrichment was 10-12. Proteinconcentration was assayed by the method of Lowry. Membranes were storedat 70°C.
* l) o( S5 v$ C: V: O
( i8 U' X) q7 c. X0 V0 yIn Situ Hybridization
2 y, Q% n- a; T+ e5 @% @4 k3 a2 R- D7 r# G+ Q
Riboprobe generation. The terminal 269 coding nucleotides of mouse NHE8 were amplified byusing primers sense GCAAGACTGAGAAGATGGGTAATGC and antisense GAACAACTCCTGCTCATCATCCTC. This PCR product was first cloned into pcR2.1TOPO and then cut out and subcloned into the Eco RIsite of pBluescript SK( ). In situ hybridization was performed by using 33 P-labeled riboprobes as described previously( 23 ). Antisense or sense riboprobes were transcribed froma linearized pBluescript plasmid by using [ - 33 P]UTPand T3 or T7 RNA polymerases, respectively. Adult mouse kidneys werefixed in 4% paraformaldehyde and embedded in paraffin. Then,5-µm-thick sections were cut and mounted on Vectabond-coated slides.Sections were deparaffinized with xylene and rehydrated with gradedethanols, hybridized overnight with radiolabeled antisense or senseriboprobes, and then washed as described previously. Sections weredipped in Ilford K5D emulsion, exposed in the dark at 4°C for 21 days, and developed with Kodak D-19. Slides were counterstained withhematoxylin and eosin. Bright-field and dark-field microscopy wasperformed with a Leica M420 microscope and a Leica DMR microscope, andimages were obtained by using an Optronics Magnafire digital camera.
8 ~8 S2 W0 ^8 [# S# W7 J
* \0 }5 y' g$ Z6 E. ASDS-PAGE and Immunoblotting& V6 }9 A' L# \% N+ t/ y9 @& R( Q
. J! b' B5 y/ C% K8 A
Aliquots of cells or kidney membranes were solubilized in samplebuffer, and the proteins were separated by SDS-PAGE using 7.5%polyacrylamide gels. For immunoblotting, proteins were transferred topolyvinylidene difluoride (Immobilon-P, Millipore) at 500 mA for 5 h at 4°C with a Transphor transfer electrophoresis unit (HoeferScientific Instruments, San Francisco, CA) and stained with Ponceau Sin 0.5% trichloroacetic acid. For immunoblotting studies,polyvinylidene difluoride membranes were incubated first in Blotto (5%nonfat dry milk in PBS and 1% Tween, pH 7.4) for 1 h to blocknonspecific binding of the antibody, followed by overnight incubationwith the primary antibody. All primary antibodies were used at a1:1,000 dilution. These antibodies included mouse anti-NHE1 (4E9)( 18 ), rabbit anti-NHE2 (Chemicon), mouse anti-NHE3 (3H3,provided by Dr. D. Biemesderfer, Yale University), mouse anti-NHE4(11H11) ( 17 ) and rabbit anti-NHE8. The membranes were thenwashed in Blotto and incubated for 1 h with the appropriate secondary antibody (horseradish peroxidase-conjugated IgG; Zymed Laboratories, San Francisco, CA) diluted 1:2,000 in Blotto. Membranes were then washed with Blotto several times followed by a final wash inPBS. Bound antibody was detected with the ECL chemiluminescence system(Amersham) according to the manufacturer's protocol. |) F" [: v/ Z
/ A/ I4 M* X m z4 i0 N7 ARESULTS
/ d: z3 Q2 S; o3 v! Q( {
3 X; k0 Y j, q. {2 G2 ^As described in MATERIALS AND METHODS, adatabase search identified a partial length cDNA encoding a novel NHEisoform, and RACE PCR was used to obtain the complete coding sequencefrom mouse kidney cDNA. As shown in Fig. 1, the sequence encodes a predictedprotein of 576 amino acids, which we have named NHE8. Adatabase search has also identified the human ortholog, labeled asKIAA0939 protein, which has 96% amino acid identity to mouse NHE8(Fig. 1 ). Both of these predicted NHE8 proteins have four potential N -glycosylation sites as well as a PKC-epsilonphosphorylation site. Putative SH2, SH3, ERK, and PSD95-Dlg-zonaoccludens-1 (PDZ) type III binding domains were also identified (Fig. 1 ).
D9 |3 G( p' u& Q! Y9 @: I2 s* ]$ a
Fig. 1. Predicted amino acid sequence of mouseNa /H exchanger isoform 8 (NHE8) aligned withits human ortholog, KIAA0939 protein, using the ClustalWmultiple sequence alignment program ( www.ebi.uk/clustalw/ ). Theproteins are 96% identical at the amino acid level. With the use ofProsite ( http://us.expasy.org/prosite/ ) and Scansite( http://scansite.mit.edu/ ) programs, both proteins are predicted tohave four potential N -glycosylation sites (G), a PKC-epsilonphosphorylation site (PKC), an SH2-binding domain (SH2), an SH3-bindingdomain (SH3), an ERK-binding domain (ERK1 binding), and a type IIIPSD95-Dlg-zona occludens-1 binding region (PDZ). *, identical aminoacid residues; :, conserved amino acid substitution;., semiconservedamino acid substitution.
# d; }: E* H7 M0 i7 X3 e" `: n1 U+ E1 ?4 B
Shown in Fig. 2, NHE8 shares 25-29%overall amino acid identity to mammalian NHE1-7 but, surprisingly,has greatest identity with Drosophilamelanogaster "NHE1" (54% identity) and a related geneproduct in Anopheles gambiae (58%). Thus NHE8most likely represents the mammalian ortholog of this invertebrate NHEisoform, allowing for evolutionary distance.
6 O# o' P4 }7 j/ a+ R7 {. ?% i# @4 D
0 l6 [# K# x! `6 U: m s, ^Fig. 2. Percent amino acid identity of one NHE isoform relativeto the other isoforms utilizing ClustalW multiple sequence alignmentscore. Rn, Rattus norvegicus; Mm, Mus musculus;Hs, Homo sapiens; Dm, Drosophila melanogaster;Ag, Anopheles gambiae. GenBank gi numbers for the isoformsinclude Mm NHE1, 2498048; Rn NHE2, 1346658; Rn NHE3, 6981562; Rn NHE4,127814; Rn NHE5, 4323549; Hs NHE6, 5454070; Hs NHE7, 14211919; Dm"NHE1," 19920438; and Ag NHE, 21291481.
" N, z, \, m6 j6 ~! Q* C
' X' Q0 j) h% m& O7 g4 x1 ` nHydropathy plot analysis (Fig. 3 )predicts that NHE8 has an ~450 amino acid NH 2 -terminalhydrophobic domain with 10-12 transmembrane domains followed by aCOOH-terminal hydrophilic tail. This pattern is similar to that seenwith mammalian NHE1-7, as modeled by NHE3, except that NHE8 has ashorter COOH-terminal hydrophilic tail (~100 compared with200-350 amino acids). Interestingly, the more closely related D. melanogaster "NHE1" also has a relatively short hydrophilic tail domain (Fig. 3 ).; \% l" {. R% {* _& I" T
4 M4 }4 C& b1 b0 OFig. 3. Kyte-Doolittle hydropathy analysis of mouse NHE8( A ), D. melanogaster NHE1 ( B ), and ratNHE3 ( C ) was performed utilizing MacVector software.Sequences are aligned in the figure according to domain similarity.
8 @2 K5 p9 W1 A& I e+ G6 c: ?% r, p6 P( @
The expression of NHE8 in mouse tissues was evaluated by Northern blotanalysis (Fig. 4 ). Mouse NHE8 isubiquitously expressed, with the highest levels in the kidney as wellas testis, skeletal muscle, and liver. The predominant transcript inmost organs is 4.2 kb in length, with a 2.2-kb transcript also detectedin the organs with highest levels of expression. However, in testis the predominant transcript is slightly larger at 4.4 kb.6 @ ?; X% N+ N+ b8 C
4 F9 G6 `" u' x, G! {Fig. 4. A : Northern blot analysis of NHE8 expressionin mouse tissues. B : actin control." L: ~' f7 |; k; K/ `
2 ~, G7 ?3 e8 c w( I
To study the expression of NHE8 protein, a rabbit polyclonal antibodywas developed against the COOH-terminal hydrophilic tail of human NHE8.To verify the isoform specificity of the antibody, it was used to probeWestern blots prepared from COS-7 cells transfected with NHE1, NHE2,NHE3, NHE4, and NHE8 cDNAs. As shown in Fig. 5 A, the anti-NHE8predominantly labeled a protein of an apparent molecular mass of 85 kDain cells transfected with NHE8 but not in cells transfected with theother four NHE isoforms confirming NHE8-isoform specificity.Expression of NHE1, NHE2, NHE3, and NHE4 was confirmed by use ofspecific antibodies directed against each isoform (Fig. 5 B ).
: o0 x# l9 \7 ^; Z) x3 l/ m* y0 @0 z( C |
Fig. 5. Immunoblot to verify specificity of NHE8 antibody. A :NHE8 antibody labels a protein in COS-7 cells transfected with NHE8 butnot in COS-7 cells transfected with NHE1, NHE2, NHE3, or NHE4. B : blotting controls to verify NHE1, NHE2, NHE3, or NHE4protein expression in the correspondingly transfected COS-7 cells.
" s" ~" H; {/ q& E& c8 a
( L* f* h' \3 K) q- V% HThe major form of NHE8 detected in transfected COS-7 cells has anapparent molecular mass of 85 kDa, significantly larger than itspredicted 64-kDa molecular mass. We suspected this discrepancy was dueto glycosylation, because protein sequence analysis identified fourpotential N -glycosylation sites at Asn8, Asn15, Asn181, or Asn485 (Fig. 1 ). To investigate this possibility, we treatedNHE8-transfected COS-7 cells with tunicamycin to prevent N -glycosylation of newly synthesized proteins. Tunicamycintreatment collapsed the 85- and 60-kDa NHE8 bands to a lower 52-kDaband, confirming N -glycosylation (Fig. 6 ). In contrast, tunicamycin failed toinduce a shift in apparent molecular mass of NHE3, confirming previousfindings that NHE3 is not glycosylated ( 5 ). The migrationof unglycosylated NHE8 with an apparent molecular mass less than itspredicted molecular mass is consistent with the behavior of other NHEproteins subjected to SDS-PAGE ( 17 ).9 j& V7 P, a" o; `) h, y
8 l! g2 {1 F8 x$ w! ~6 h' WFig. 6. Immunoblot to demonstrate that NHE8 is N -glycosylated. Lanes 1 and 2 :NHE3-transfected COS-7 cells treated with and without tunicamycin andprobed for NHE3. Lanes 3 and 4 : NHE8-transfectedCOS-7 cells treated with and without tunicamycin and probed for NHE8.) p! }2 M+ { p9 a
6 R8 ]- i: u$ s* G7 ~0 l+ pTo determine whether NHE8 protein is expressed in native rat kidney, weused the anti-NHE8 antibody to probe an immunoblot prepared fromisolated BBM. As illustrated in Fig. 7 A, the predominant BBMprotein labeled by the antibody had an apparent molecular mass of ~85kDa, identical to that labeled in solubilized COS-7 cells transfectedwith NHE8 cDNA (COS-7/NHE8).; M- g2 ~4 @2 l3 {& y
8 T& G) f) N1 d5 o
Fig. 7. Immunoblots to demonstrate that NHE8 protein is expressedin rat kidney and copurifies with cortical brush-border membranes(BBMs). A : COS-7 cells transfected with NHE8 (COS-7/NHE8)run in parallel with rat kidney BBMs and probed for NHE8. B :100 µg of rat kidney cortical whole homogenate as well as 100 µg ofBBMs purified from the whole homogenate were run in parallel and probedfor NHE8 ( lanes 1 and 2 ) and for NHE3( lanes 3 and 4 ), which is known to localize toBBM.
7 T! `/ h3 C5 @& L
4 \) n, I# T$ ~1 n1 ?" XTo confirm that NHE8 is an apical membrane protein, the abundance ofNHE8 was compared in equal aliquots (100 µg protein) of rat renalcortical whole homogenate and purified BBMs that were isolated bydivalent cation precipitation and differential centrifugation. As shownin Fig. 7 B, the enrichment of NHE8 in BBMs compared with thestarting homogenate was similar to that observed for NHE3, indicatingthat NHE8 is either a brush-border protein as is NHE3 ( 1, 3 ) or resides in a membrane compartment that copurifies with BBMs.
% }, M" a0 P4 G2 ]
7 q5 B) Z9 k' ?! I% m* WUnfortunately, the anti-NHE8 antibody did not work well forimmunocytochemistry, so we utilized in situ hybridization to determine the cellular localization of NHE8. A short riboprobe directed againstthe terminal 269 nucleotides of NHE8 was generated and used to probemouse kidney sections. This region was chosen because it has the leastsequence similarity to other NHE isoforms and thus was unlikely tocross-hybridize with known isoforms. Hybridization of NHE8 antisenseriboprobes to sagittal sections of adult kidney (Fig. 8 A ) showed that the message isexpressed most intensely in a region corresponding to the outer stripeof the outer medulla. In addition to the strong signal in the outerstripe, a signal of moderate intensity is present diffusely throughoutthe cortex (Fig. 8 B ). No NHE8 expression is evident in theinner stripe or the inner medulla. Figure 8 C shows NHE8expression in the majority of tubules in the outer stripe as well as inthe tubules surrounding the juxtamedullary glomeruli. This pattern ofexpression in the majority of tubules surrounding glomeruli stronglysuggests expression in proximal tubules. No message is present withinthe glomeruli. Higher magnification of the outer stripe(Fig. 8 D ) shows silver grains correspondingto NHE8 message expression present within tubules possessing a brushborder (arrows), confirming expression in proximal tubules.Hybridizations performed with the control probe (sense) revealed nosignificant hybridization signal (not shown). Thus NHE8 is highlyexpressed in the proximal tubules in the outer stripe of the outermedulla, with significant but lower expression in the proximal tubulesin the cortex.
9 U, ~& \/ G( y4 F2 b
0 X. }6 i! G' c5 MFig. 8. Insitu hybridization of NHE8 riboprobe on adult mouse kidney sections. A : bright-field ( left ) and dark-field( right ) images of a saggital mouse kidney section showingNHE8 signal in a region corresponding to the outer stripe of the outermedulla. Magnification, ×6.3. B : bright-field( left ) and dark-field ( right ) imagesshowing brightest signal in the outer stripe as well as a diffuse NHE8signal in the cortex. Magnification, ×23.3. C, cortex; OS, outerstripe of the outer medulla; IS, inner stripe of the outer medulla; IM,inner medulla. C : dark-field image showing tubularlocalization of NHE8 in the outer stripe of the outer medulla (OS OM)and cortex (c). g, Glomeruli; IS OM, inner stripe of the outer medulla.Magnification, ×35. D : higher magnification (×927) of theouter stripe of the outer medulla showing NHE8 localization in proximaltubules identified by the presence of a brush border (arrow). PT,proximal tubule; CD, collecting duct.
* P; o; N. v) v! t0 G J# J1 @
( |0 C H8 y7 SDISCUSSION- K! F7 H" C3 ]+ k8 I! D# f
' W" c; ~3 q JNHE8 is the newest member of a growing family of mammalianNa /H exchangers. Sequence analysis suggeststhat NHE8 is the mammalian ortholog of an ancient invertebrate isoformof unknown function. Northern blot demonstrates that NHE8 isubiquitously expressed in multiple mouse tissues. In the kidney, NHE8copurifies with BBMs isolated from renal cortex, suggesting apicalmembrane localization. In situ hybridization demonstrates NHE8 messagein the proximal tubule. Given these results, NHE8 is a candidate tomediate apical membrane transport in the proximal tubule.
9 s# F- }( A3 x% C. @3 C/ k3 k" g4 I
Although we have not yet been successful in functionally expressingNHE8, recent studies suggest possible roles for NHE8 in proximaltubular transport physiology. For example, one possibility is that NHE8is an EIPA-sensitive Na /H exchanger andaccounts for the EIPA-inhibitable Na -dependent acidextrusion that takes place across the apical membrane of proximaltubule cells in NHE3/NHE2 null mice ( 4 ). Another possibility is that NHE8 is an EIPA-resistantNa /H exchanger and helps mediate theappreciable rate of bicarbonate absorption that persists and isresistant to inhibition by EIPA, bafilomycin, or SCH-28080 in theproximal tubule of NHE3 null mice ( 26 ). Alternatively, itis possible that the primary function of NHE8 is to mediate an iontransport process other than Na /H exchange.For example, Na /NH 4 + exchange has beendescribed to take place across the apical membrane of proximal tubulecells ( 7, 12 ), and it is possible that this transportactivity is mediated by NHE8 rather than NHE3. Finally, because NHEisoforms are known to exist as stable dimers ( 6 ), it ispossible that NHE8 associates with NHE3 and modulates its transportfunction. Further studies are presently under way to investigate these possibilities.( X8 }8 D! F0 n& Y3 q
4 c0 `% |( h' r) V8 x9 W3 Q/ N1 S0 sACKNOWLEDGEMENTS
% ~( r, `9 W! }/ |: \6 c9 Y n
$ q f6 w s. J j& a; y& a& UThis work was supported by a Research Fellowship from theNational Kidney Foundation (S. Goyal) and by National Institute ofDiabetes and Digestive and Kidney Diseases Grants DK-33793 (P. S. Aronson) and DK-53877 (G. Vanden Heuvel).
% P! V5 {! \# U3 k/ P1 U# T 【参考文献】0 G" r, g V: F6 y" u- O
1. Amemiya, M,Yamaji Y,Cano A,Moe OW,andAlpern RJ. Acid incubation increases NHE-3 mRNA abundance in OKP cells. Am J Physiol Cell Physiol 269:C126-C133,1995 .+ y8 H3 S0 T' c& r l
/ }$ X$ \' g* A) R) n6 ]) g, h, D9 w. M# e1 j) N# o, Q
3 P, m$ x. f1 W& Y6 }1 @$ f2. Aronson, PS. Energy-dependence of phlorizin binding to isolated renal microvillus membranes. Evidence concerning the mechanism of coupling between the electrochemical Na gradient the sugar transport. J Membr Biol 42:81-98,1978 .! v Y" w$ Y9 Y1 q
. u. G* o5 `. V# `6 G2 F4 {5 ^! v5 a! h, X6 H0 d
" W! d5 O* G2 F3 y7 g3. Biemesderfer, D,Pizzonia J,Abu-Alfa A,Exner M,Reilly R,Igarashi P,andAronson PS. NHE3: a Na /H exchanger isoform of renal brush border. Am J Physiol Renal Fluid Electrolyte Physiol 265:F736-F742,1993 .7 S7 w; W& Y$ c( r0 n) V
1 a& g% _7 h8 c; P! _
6 ^ ^8 [+ P& v0 B% }% c! \
* h/ Y! P- f. l6 ?& K3 Q- c) f4. Choi, JY,Shah M,Lee MG,Schultheis PJ,Shull GE,Muallem S,andBaum M. Novel amiloride-sensitive sodium-dependent proton secretion in the mouse proximal convoluted tubule. J Clin Invest 105:1141-1146,2000 .# e3 O% G2 S0 x7 J+ m, H- |
3 X* e; y3 R% ~, T4 n; n! L Q7 S$ Y
: Z: K5 {+ m: u. g5 X5 L' [4 x- Q( \. X7 o6 z
5. Counillon, L,Pouyssegur J,andReithmeier RA. The Na /H exchanger NHE-1 possesses N - and O -linked glycosylation restricted to the first N-terminal extracellular domain. Biochemistry 33:10463-10469,1994 .' [( A/ ~! B4 a4 m0 F
1 f6 c+ V/ d1 R$ J
" w) \) Z2 r$ |$ t! @" H
* `3 O, m2 Y2 v, p- }6 O& m6 [
6. Fafournoux, P,Noel J,andPouyssegur J. Evidence that Na /H exchanger isoforms NHE1 and NHE3 exist as stable dimers in membranes with a high degree of specificity for homodimers. J Biol Chem 269:2589-2596,1994 .
8 E: q7 M+ \& E# m$ K0 g2 b4 W. X
' ]: f- a" s" R7 F
. D8 V1 M% q- L, V
: G& P- F$ g: K: |7. Kinsella, JL,andAronson PS. Interaction of NH 4 and Li with the renal microvillus membrane Na -H exchanger. Am J Physiol Cell Physiol 241:C220-C226,1981 .
4 w0 s) f& M+ k Z- m6 P' c& f
" u" [$ Y/ X1 M0 j7 Z }! a% N* M7 @7 ]1 d& V/ _( T
W, c8 y* f7 X( y7 k
8. Klanke, CA,Su YR,Callen DF,Wang Z,Meneton P,Baird N,Kandasamy RA,Orlowski J,Otterud BE,Leppert M,Shull GE,andMenon AG. Molecular cloning and physical and genetic mapping of a novel human Na /H exchanger (NHE5/SLC9A5) to chromosome 16q221. Genomics 25:615-622,1995 .5 I" r- s# b# l, b& m( f, P; ~
+ D; M1 T% t/ K! H1 D/ f/ P! t! G) q# y( X8 x9 y, t
% }2 U2 R6 c( I$ H. c E/ @; |, P f9. Kozak, M. Interpreting cDNA sequences: some insights from studies on translation. Mamm Genome 7:563-574,1996 .
1 i5 L4 W; B" j0 b, ?' R, Z& \
& T; }: k/ [5 ~# v% E& V$ e9 b
; ~* c- m% q# f/ ~- @& @: r/ T3 O7 v5 `; M
10. Ledoussal, C,Lorenz JN,Nieman ML,Soleimani M,Schultheis PJ,andShull GE. Renal salt wasting in mice lacking NHE3 Na /H exchanger but not in mice lacking NHE2. Am J Physiol Renal Physiol 281:F718-F727,2001 .
: x$ s& l6 u( f( f& b7 d
* n2 f9 P% c$ {
; ^- q! M" W( \, I2 d' q8 c+ m4 {. X: ^6 I$ y
11. Lorenz, JN,Schultheis PJ,Traynor T,Shull GE,andSchnermann J. Micropuncture analysis of single-nephron function in NHE3-deficient mice. Am J Physiol Renal Physiol 277:F447-F453,1999 .
3 v' a1 q( P" V. w( C
# _# h% n- g9 J2 M- M; _# Y( ~
0 b3 ]# H/ V' ^9 ?
- j; p! {, Y" ]9 U, d/ y& |12. Nagami, GT. Luminal secretion of ammonia in the mouse proximal tubule perfused in vitro. J Clin Invest 81:159-164,1988 .$ |1 g: V# P- f# L8 u9 Q
" O* H2 E* `- O$ J/ g4 l+ X0 j. g- e2 l1 C; X. J( ~
- {, H( I0 ]# j13. Numata, M,andOrlowski J. Molecular cloning and characterization of a novel (Na ,K )/H exchanger localized to the trans-Golgi network. J Biol Chem 276:17387-17394,2001 .
/ h( Z9 O% f+ I4 e: S T: \3 B% K/ O: Y7 X! i* ?! ]$ R+ K7 D }! N, T
- k1 m: D8 y) x$ s- n5 A* }* T- G& u$ x3 H, E0 @
14. Numata, M,Petrecca K,Lake N,andOrlowski J. Identification of a mitochondrial Na /H exchanger. J Biol Chem 273:6951-6959,1998 ./ h5 E/ Z& E4 g1 p8 \" ]
" U/ W1 J- z/ D! T5 B0 F5 p1 V
1 \4 r+ i% D5 l- {. ^4 M& o
, o/ G5 I5 Q M# Y" v, v
15. Orlowski, J,andGrinstein S. Na /H exchangers of mammalian cells. J Biol Chem 272:22373-22376,1997 .
I a3 o# u( y3 w+ ^$ F3 i r$ d3 ^- R2 j H- @6 P
. P6 y( o% O* t* w
, C( d$ E8 s9 H% I+ n: q16. Orlowski, J,Kandasamy RA,andShull GE. Molecular cloning of putative members of the Na/H exchanger gene family. cDNA cloning, deduced amino acid sequence, and mRNA tissue expression of the rat Na/H exchanger NHE-1 and two structurally related proteins. J Biol Chem 267:9331-9339,1992 .
: R( |* r% m4 K, ~* P) R |
# ^9 W0 t8 C- p# ]/ w3 q! A% [ \! l! S7 [ O" d7 ~( V
; I) N7 s8 U$ V6 n$ A: |8 k. C) X7 P
17. Pizzonia, JH,Biemesderfer D,Abu-Alfa AK,Wu MS,Exner M,Isenring P,Igarashi P,andAronson PS. Immunochemical characterization of Na /H exchanger isoform NHE4. Am J Physiol Renal Physiol 275:F510-F517,1998 .
5 h* `! I* D! [) Q5 z* |2 \5 y; S' f$ c) N6 C% c3 K5 H
9 l k+ f, B# f' ?1 o6 R# S
6 t8 O0 h1 H' x18. Rutherford, PA,Pizzonia JH,Biemesderfer D,Abu-Alfa A,Reilly R,andAronson PS. Expression of Na -H exchanger isoforms NHE1 and NHE3 in kidney and blood cells of rabbit and rat. Exp Nephrol 5:490-497,1997 .' Q, r; M& D# C. r2 U- G
- |- g9 W, I h" @2 ~8 N
: o ]% U9 L7 N% R# H2 Y! ?0 ~+ L1 w6 o3 V0 m
19. Sardet, C,Franchi A,andPouyssegur J. Molecular cloning, primary structure, and expression of the human growth factor-activatable Na /H antiporter. Cell 56:271-280,1989 .& n& y2 f7 M+ h; Y! J
* d7 G+ Q8 K0 `$ g/ Q) s/ e7 c1 J3 ?# ~/ J8 c: Q
/ P8 ^5 _: K* V# T3 W- O) C20. Schultheis, PJ,Clarke LL,Meneton P,Miller ML,Soleimani M,Gawenis LR,Riddle TM,Duffy JJ,Doetschman T,Wang T,Giebisch G,Aronson PS,Lorenz JN,andShull GE. Renal and intestinal absorptive defects in mice lacking the NHE3 Na /H exchanger. Nat Genet 19:282-285,1998 .
' c, n+ B* |( S1 ?9 | m7 v# J8 \% B; a1 _+ e1 a
. t5 m& h8 h6 J: N. q& b) ]3 K5 ]; ^5 [9 Y
21. Szasz, G. A kinetic photometric method for serum gamma-glutamyl transpeptidase. Clin Chem 15:124-136,1969 .# _( I, K2 c$ Q @$ p
$ g& ~. o3 Z4 h" ]" t+ j, A" K; k7 O
- b) C" ~3 W; f0 G1 f* N3 k# i0 G+ \' e
22. Tse, CM,Brant SR,Walker MS,Pouyssegur J,andDonowitz M. Cloning and sequencing of a rabbit cDNA encoding an intestinal and kidney-specific Na /H exchanger isoform (NHE-3). J Biol Chem 267:9340-9346,1992 .5 ^2 K( q6 S+ w0 M: H" W6 Q0 F
. }2 a3 }2 M% P) y: J
o. ?7 [) L6 ~2 Y; F# y
. b6 Z$ x1 v) _3 a
23. Vanden Heuvel, GB,Bodmer R,McConnell KR,Nagami GT,andIgarashi P. Expression of a cut-related homeobox gene in developing and polycystic mouse kidney. Kidney Int 50:453-461,1996 .2 ~ F* z' t7 G6 P1 [$ K) x, I
x, w) m" _& h6 @
/ ~) h8 O6 ~" R, i" Z1 G: B- N4 q
24. Wakabayashi, S,Shigekawa M,andPouyssegur J. Molecular physiology of vertebrate Na /H exchangers. Physiol Rev 77:51-74,1997 .
5 I) Y7 H/ x0 |7 }$ }+ P3 N g! G) t( F( m! R6 o
* W4 N1 d# ]3 j* o8 [1 n% I# p- v" x* t6 A
25. Wang, T,Hropot M,Aronson PS,andGiebisch G. Role of NHE isoforms in mediating bicarbonate reabsorption along the nephron. Am J Physiol Renal Physiol 281:F1117-F1122,2001 .( }6 R+ W; J8 s! c6 a2 o8 h
- b W+ k! B* T3 m7 ^! t8 |
' B: g4 m- w* x$ t; p* t u0 ]6 C. F1 ~$ o- @9 q( E
26. Wang, T,Yang CL,Abbiati T,Schultheis PJ,Shull GE,Giebisch G,andAronson PS. Mechanism of proximal tubule bicarbonate absorption in NHE3 null mice. Am J Physiol Renal Physiol 277:F298-F302,1999 .( A, V2 I) m8 K* u/ H% [9 a
G& k! ?; T' Y, v5 I: g7 d! g9 d& [. W1 B3 i
; D2 v; F2 S& V( `5 \" F* y. s! d27. Wang, Z,Orlowski J,andShull GE. Primary structure and functional expression of a novel gastrointestinal isoform of the rat Na/H exchanger. J Biol Chem 268:11925-11928,1993 . |
|