|

- 积分
- 0
- 威望
- 0
- 包包
- 0
|

作者:Michelle L. Gumz, Michael P. Popp, Charles S. Wingo, Brian D. Cain作者单位:1 Department of Biochemistry and Molecular Biologyand Interdisciplinary Center for BiotechnologyResearch, University of Florida, and Department ofVeteran Affairs Medical Center, Gainesville, Florida 32610-0245
* N* M& X4 \1 {# ^* a9 V. ~# J" e7 g & Z1 ?6 L5 E( h4 B, b, P
# n) h, \9 j! r( S0 Y4 r* A2 ~
! o. Q& Q: }; ^5 }5 k1 I
6 V' w# m- z: j! y3 p' X& P7 O
5 T; z# V S$ t1 ]* o
: H s* v4 e2 L) f7 }
M: L# e+ H' x. I1 Z# D
. H" r8 B; d( r- M( E6 L4 _$ E9 O
# h, F1 }4 t; g! k3 {2 H1 {
2 T* G& Y9 f! q3 z2 H
9 k2 w1 V! }% D0 L: ~9 I- b
1 G% F4 a+ A4 D4 ]( z/ |; @ 【摘要】# b# V+ u5 z: y) i7 W
The mineralocorticoid aldosterone is a major regulator of Na and acid-base balance and control of blood pressure. Although the long-termeffects of aldosterone have been extensively studied, the earlyaldosterone-responsive genes remain largely unknown. Using DNA arraytechnology, we have characterized changes in gene expression after 1 h ofexposure to aldosterone in a mouse inner medullary collecting duct cell line,mIMCD-3. Results from three independent microarray experiments revealed thatthe expression of many transcripts was affected by aldosterone treatment.Northern blot analysis confirmed the upregulation of four distinct transcriptsidentified by the microarray analysis, namely, the serum and glucose-regulatedkinase sgk, connective tissue growth factor, period homolog, andpreproendothelin. Immunoblot analysis for preproendothelin demonstratedincreased protein expression. Following the levels of the four transcripts over time showed that each had a unique pattern of expression, suggesting thatthe cellular response to aldosterone is complex. The results presented hererepresent a novel list of early aldosterone-responsive transcripts and providenew avenues for elucidating the mechanism of acute aldosterone action in thekidney. / T' `9 w+ U; }/ @6 l
【关键词】 kidney sgk period homolog connective tissue growth factor endothelin
5 G' E* I H! o, w4 _: C0 J THE MINERALOCORTICOID ALDOSTERONE is released by the cells of the adrenal zona glomerulosa in response to stimulation of the renaljuxtaglomerular apparatus or changes in Na or K concentrations. Aldosterone acts directly to increase Na absorption in tight epithelia, including the renal collecting duct. IncreasedNa reabsorption expands blood volume, thereby leading to anincrease in central venous filling pressure, cardiac output, and systemic arterial blood pressure ( 21 ).In this capacity, aldosterone plays a critical role in regulating bloodpressure. To date, all cases of inherited hypertension result from abnormalregulation of aldosterone or its downstream effects( 4, 31 ).* D* ]% a; X( f. a/ ]
4 c/ m/ Z) ~6 j0 T) S) z) _0 P
Known molecular targets of aldosterone action include the basolateral Na -K -ATPase and the apical epithelial sodium channel(ENaC), both of which are critical for Na absorption. Aldosterone has both short- and long-term effects on these ion transporters. Thetranscriptional effects of aldosterone on ENaC and the Na -K -ATPase occur after 4 h; these late effects ofaldosterone on ion transport are well characterized( 34 ). The more immediate transcriptional effects of aldosterone have not been fully investigated, butcertain candidate genes have been identified. For example, aldosterone inducesthe expression of the serum and glucocorticoid-regulated kinase ( sgk )as soon as 30 min after hormone treatment( 19, 27 ). sgk has beenlinked to increases in both the number and the activity of ENaC( 5 ). Expression of sgk in Xenopus laevis oocytes results in a threefold increase in thenumber of functional ENaCs at the cell surface( 2 ). sgk -mediatedphosphorylation of the ubiquitin ligase Nedd4 leads to inhibition of ENaCsubunit degradation and therefore an increase in ENaC activity( 7, 27 ). Aside from sgk,there is limited information on early aldosterone-responsive genes. Serialanalysis of gene expression technology has recently been used to identify 34aldosterone-induced transcripts and 29 aldosterone-repressed transcripts in amouse kidney cortical collecting duct cell line after 4 h of aldosterone treatment ( 24 ). However, theacute transcriptional effects of aldosterone should occur in a much shortertime frame.
4 \9 R3 Q( T- r2 x, G7 ?7 J- V7 V" w& l/ K6 t: ^
Studies with primary cultures derived from the inner medullary collectingduct (IMCD) have suggested that this is a target epithelium for the action ofaldosterone and may be an important terminal site of Na absorptionand acid secretion in the collecting duct( 28, 29, 35 ). There is a dramaticincrease in Na transport in cultured IMCD cells in response toaldosterone ( 12, 13 ). However, the factors thatmediate the acute effects of aldosterone largely remain to be defined.
1 n4 i; G# P+ o. p0 B5 h( h8 {* A6 N, B! a3 [
Previous studies that have examined the early aldosterone-responsive genesused nonmammalian cell lines or considered responses several hours afterexposure to the hormone ( 24, 30 ). Here, we report the useof microarray technology to analyze a mouse kidney IMCD cell line (mIMCD3) foracute aldosterone regulation after 1 h of exposure to the hormone. Numerous,previously unreported aldosterone-regulated transcripts have been identified using this method, and the regulation of selected genes has been verifiedusing traditional biochemical approaches. These findings represent a novellist of early aldosterone-regulated transcripts.
# R4 g, C) `( E) g5 w+ e _, v/ t! B! ^: c5 m# O. b
MATERIALS AND METHODS( a2 i, `% E$ n# f7 w/ F
* Q: @+ x: n, r2 PTissue culture. mIMCD3 cells between passages 15 and 25 were used for all experiments. Cells were grown in a T-75 flask (Corning) in DMEM-F-12 media plus 10% FBS (Invitrogen) before being plated oncollagen-coated Costar Transwell-COL inserts (Fisher) in DMEM-F-12 plus 10鸖. Cells were grown 1 day past confluency. Twenty-four hours beforetreatment with aldosterone, the media were changed to phenol red-freeDMEM-F-12 (Invitrogen) plus 10% charcoal/dextran-stripped FBS (Biosource).Cells grown for this length of time on Transwell-COL inserts typically exhibit a transepithelial resistance of 703.3 ± 24.7 /cm 2 (Xia S.-L., personal communication). Cells were treated for varying lengths oftime with vehicle (ethanol) or aldosterone (Sigma) at concentrations rangingfrom 10 - 10 to 10 - 6 M. Inhibitor studies were performed using 1 µM mifepristone (RU-486) and/or 1µM spironolactone (Sigma). For the microarray experiment, cells weretreated for 1 h with vehicle or 10 - 6 Maldosterone.% z$ w9 z! }( o$ J- l
2 w1 w& Z: o9 }$ | g- b
RNA isolation. Total RNA was isolated using TRIzol reagent (Invitrogen) essentially according to the manufacturer's instructions with thefollowing modifications. Cells were lysed directly on the Transwell-COLinserts for 5 min using 1 ml of TRIzol reagent/insert. The organic and aqueousphases were separated by centrifugation at 3,200 g for 20 min. RNAwas precipitated from the aqueous layer by addition of 3 ml of isopropanol. The solution was allowed to sit at room temperature for 15 min, and then theRNA was pelleted by centrifugation at 3,200 g for 15 min. The RNApellet was washed in 6 ml of 75% ethanol and resuspended in 100 µl diethylpyrocarbonate-treated water.5 T% A3 p4 ?9 E5 K/ V$ R' P! M
/ O4 k2 `7 H9 D9 [4 [% CRT-PCR. Two micrograms of total RNA were used in a reverse transcriptase (Superscript II, Invitrogen) reaction primed with randomdecamers (Ambion). Of the RT reaction, 25% was used as a template in thesubsequent PCR reaction. Primers MG24 and MG25(GCAGATCAGCCTTCAGTTCGTGCGG/CATGCATGGAGTCTAGAAGCTT) were designed based on thepublished mouse mineralocorticoid receptor (MR; AW910225 ) to amplify a 238-bpproduct. Primers MG81 and MG82(GTGCTCTCCCACACCCCCTGCAGC/CTGGCCCCCGTCACTGTGGACAGC) were designed to thepublished sequence of the -subunit of the ENaC (ENaC-; AF112185 )to amplify a 505-bp product. Primers MG83 and MG84(CTGGAAATCACCAAGGCCCACACG/CAGGAACTGCCCGTGCACGTGCTC) were designed to thepublished sequence of 11 -hydroxysteroid dehydrogenase type 2(11 HSD2; NM_008289 ) to amplify a 480-bp product. PCR was performed using Taq PCR Master Mix plus Q solution (Qiagen) and the following cyclingparameters: 94°C x 5-min presoak; 25 cycles of 94°C x 30s, 62.5°C (ENaC- ) or 61.8°C (11 HSD2) or 56.6°C (MR) x 30 s, 72°C x 1 min; and 72°C x 10-min finalextension. Products were purified from a 1% agarose gel and either cloned intothe TA cloning vector (pCR2.1, Invitrogen) or sent directly for sequence analysis. Probes for connective tissue growth factor (CTGF), period homolog, sgk, and endothelin were prepared in the manner described above( Table 1 ). Primer sets were asfollows: s gk MG34/35 CCTCCAACCCTCACGCCAAAC/CTTCCAGGAGGTGCCTTGCCG;CTGF KF3/4 CCCCTGTCCGAATCCAGGCTC/GCGCACGTCCATGCTGCATAG; period homolog MG52/53CACGCGTCCGGCGGAGCTTCTGGG/GGCAATGGAGCTGCTGGGTGGGGA; and preproendothelinMG54/54 GTTCGTGACTTTCCAAGGAGCTCC/CTCAGCTTTCAACTTTGCAACACG./ }! e8 ~1 `; {" _
5 b- j; ~9 v6 u E* B
Table 1. Probe generation and comparison of fold-induction values
8 l) \! }4 } Q \0 W2 K6 v+ V- }# ?' r
Affymetrix GeneChip. The murine genome array U74Av2 was purchased from Affymetrix through the Interdisciplinary Center for Biotechnology Research at the University of Florida. Using total RNA from aldosterone- orvehicle-treated cells, first- and second-strand syntheses were performed usingInvitrogen reagents according to the protocol provided in the AffymetrixGeneChip Expression Analysis Manual. In vitro transcription reactionswere then carried out using the BioArray High Yield RNA Transcript Labeling Kit (ENZO). Biotin-labeled CTP and UTP were included in the reaction cocktail.Fragmentation of the cRNA, hybridization, staining, and scanning of themicroarray were performed according to the GeneChip Expression AnalysisManual provided by Affymetrix. Three independent microarray experimentswere performed.
/ ], L& t( y; y/ D+ f* {7 G$ g$ T6 N9 n) z" l; T9 `% J3 g
Affymetrix GeneChip Expression Analysis. Analysis of intensity data was performed using Microarray Suite Version 4 (MAS4; Affymetrix). Globalscaling was applied to all arrays such that the mean intensity of each arraywas equivalent. In global scaling, the raw signal value of each probe cell ismultiplied by a scaling factor. The scaling factor is determined by firstcalculating the mean intensity of each array that is equivalent to the mean raw signal value, minus background, of probe cells, excluding the highest andlowest 2% of values. The mean intensity is multiplied by the scaling factor toequal the target intensity. The target value of all chips was 2,500. Thescaled signal from each probe cell was used to generate a quantitativehybridization signal for each gene with MAS4. MAS4 was also used to perform comparison expression analyses to examine the intensity data between twodifferent arrays. Initially, a comparison expression analysis was performedfor two samples, untreated and treated, where the untreated cells served asthe baseline. MAS4 algorithms, which use both qualitative and quantitativemetrics, produced a list of differentially expressed genes. The list wasfurther filtered to include only genes whose expression was altered at leasttwofold. The experiment was repeated two additional times in independent RNAsamples isolated from untreated and treated cells. The scaled signal valuesfrom all six hybridization experiments have been deposited in the GeneExpression Omnibus database( http://www.ncbi.nlm.nih.gov/geo/ ).The accession numbers are GSM6603, GSM6604, GSM6605, GSM6606, GSM6607, and GSM6623. The data series is represented by the accession number GSE434.& I$ Z$ ]2 @ z% R/ a+ S8 ]
! g. r7 @6 F A( A! N
Northern blot analysis. Northern blot analysis was done according to the method of Davis et al.( 6 ). The generation of 32 P-labeled probes was performed using the Redi Prime II randomlabeling kit (Amersham) and 25 ng of template DNA. Blots were washed at65°C three times for 15 min in wash solution (20 mM Na 2 HPO 4, 1% SDS, pH 7.2). After the washes, blots wereexposed to Kodak Biomax MS film for an appropriate length of time. A probe forthe mRNA of GAPDH was used to control for loading.6 p5 ]9 Y1 B- f$ B
1 w- l- i* W& f) P1 ~Real-time RT-PCR. Reactions were performed using Taq ManOne-Step RT-PCR Master Mix Reagents (Applied Biosystems) according to themanufacturer's instructions. Cycling parameters were as follows: 48°C x 30 min, 95°C x 10-min presoak; 45 cycles of 95°C x 15 s, 60°C x 1 min. Primers and Taq Man probes weregenerated via Assays-by-Design (Applied Biosystems). The sequences of theprimers and probes were as follows: sgk forward CGCCAAGTCCCTCTCAACAA, sgk reverse TTGGCGTGAGGGTTGGA, sgk probe 6FAMTCAACCTGGGTCCGTC MGBNFQ; preproendothelin forward TGCCACCTGGACATCATCTG, preproendothelin reverse CTCCCAGTCCATACGGTACGA, preproendothelin probe 6FAMAACACTCCCGAGCGC MGBFNQ; period homolog forward CCAGGTGTCGTGATTAAATTAGTCA, period homolog reverse GGGCTTTTGAGGTCTGGATAAA, period homolog probe6FAMTCAGAGACAGGCGTCCT MGBFNQ. As a negative control, Taq Man RodentGAPDH Control Reagents were used to perform real-time RT-PCR for GAPDH.Reactions were carried out in a DNA Engine Opticon 2 Continuous FluorescenceDetector, and data were analyzed using Opticon Monitor 2 software (MJResearch).# f) |3 [; {1 [ `+ t
" N7 I( p" ?; r" B% K$ S: |( e: M4 x
Western blot analysis. mIMCD3 cells were treated as described above with aldosterone or vehicle for 6 h. Cells were trypsinized andcollected in PBS. After 5 min of centrifugation at 150 g, cells wereresuspended in 1 ml cell lysis buffer (50 mM Tris, pH 7.8, 150 mM NaCl, 1%Nonidet P-40). One hundred fifty micrograms of total cellular protein were runon an 18% Tris-glycine SDS-PAGE gel. Proteins were electrically blotted ontonitrocellulose in transfer buffer [25 mM Tris-base, 192 mM glycine, 20%(vol/vol) methanol, pH 8.3]. Blocking was performed in 5% nonfat milk (Bio-Rad) in TBS plus 0.1% Tween at room temperature for 1 h. To detectendothelin, either a rabbit polyclonal antibody (AB3280, Chemicon) or a mousemonoclonal antibody was used (E0771, Sigma), both at a dilution of 1:1,000.The primary antibody incubation was done in 5% nonfat milk in TBS plus 0.1%Tween overnight at 4°C. Secondary antibody incubation was performed using a 1:5,000 dilution of horseradish peroxidase-linked donkey anti-rabbit orsheep anti-mouse immunoglobulin for 1 h at room temperature in 5% nonfat milkin TBS plus 0.1% Tween. After the secondary antibody incubation, blots werewashed three times for 15 min in TBS plus 0.1% Tween (Sigma).Chemiluminescence was used to detect antibody binding via the enhancedchemiluminescence system (Amersham).
0 g* M2 A' n+ R: }2 K0 _0 R# K7 d, M. E
Statistical analysis. Values are means ± SE. A two-way ANOVA was performed on the real-time PCR data to compare fluorescence intensity at each time point with control. The Dunnett test for errorprotection was used with a confidence interval of 95%. A one-way ANOVA wasperformed on the fold-change data for the inhibitor study to compare eachcondition with control. The least significant difference test for errorprotection was used with a confidence interval of 90%. A one-way ANOVA withthe Dunnett test for error protection and a confidence interval of 95% wasused to evaluate the Western blot analysis fold-change data.: b4 u) j5 ?1 b( }3 o' {$ T+ S
% L% P$ L) R% a. f# c, C$ ~ L
RESULTS
* A) ~ s4 H) g! D# b' N, a
: T( C6 F8 c" s y: A' FTo demonstrate that the mIMCD3 cell line had retained properties reflectingcollecting duct cells, the presence of the ENaC- was investigated as arepresentative collecting duct-specific transcript( 17 ). RT-PCR was performed toamplify a 505-bp fragment of ENaC- ( Fig. 1 ). The resulting productwas gel purified and sequenced; the product was identical to the published ENaC- sequence. The presence of this transcript indicated that mIMCD3cells were indeed representative of the collecting duct.& r& l1 v. G1 Z7 r7 F- d
4 ?% p/ E1 ^# ?) E3 J% B1 u. F7 W" G
Fig. 1. Characterization of mouse inner medullary collecting duct (mIMCD3) cells.Primers were designed according to published sequences to amplify fragments ofepithelial Na channel (ENaC)-, 11 -hydroxysteroiddehydrogenase type 2 (11 HSD2), and mineralocorticoid receptor (MR) frommIMCD3 cells. RT-PCR products were separated on a 1% agarose gel andvisualized with ethidium bromide. /-, Presence or absence of RT andtemplate. In the absence of an RNA template, an equal volume of H 2 Owas used.4 T5 g0 l( Y; c4 {8 j) Z
, u2 G; w) E3 U
Next, the aldosterone responsiveness of mIMCD3 cells was assessed. RT-PCRwas performed to amplify 480- and 238-bp fragments of 11 HSD2 and the MR,respectively ( Fig. 1 ).11 HSD2 and the MR represent transcripts specific toaldosterone-responsive cells. The resulting products were gel purified, andtheir sequences were determined. Both sequences were identical to thepublished sequence of the transcript in question. Another marker ofaldosterone responsiveness is induction of a known aldosterone-responsive transcript, sgk. As a preliminary indication of whether aldosterone regulates sgk in this cell line, cells were treated for 1 h with10 - 6 M aldosterone or vehicle (ethanol), total RNA was isolated, and Northern blot analysis was performed( Fig. 2 ). Densitometry analysisof the results revealed an approximate fivefold increase in sgk expression over that in control cells ( Table 1 ), a value comparableto levels observed in other studies ( 19, 27 ). In summary, mIMCD3 cellswere found to be representative of the collecting duct and also to bealdosterone responsive. These cells were therefore selected to study the acutetranscriptional effects of aldosterone.
3 A" L& `1 R. {2 a1 q4 u7 Z# T4 [) D4 h
Fig. 2. Upregulation of serum and glucose-regulated kinase ( sgk ) byaldosterone. Total RNA was isolated from mIMCD3 cells treated with vehicle or10 - 6 M aldosterone (Aldo) for 1 h. Shown at the top is an ethidium bromide-stained 1% agarose gel containing the RNAsamples in which 28S and 18S ribosomal RNA bands are indicated. Northern blotanalysis was performed using cDNA probes for sgk ( middle )and GAPDH ( bottom ).
) r1 Q$ ]! d. M8 F" p/ Y! {+ b
" q$ ?7 l6 G( oMicroarray analysis. To prepare RNA samples for microarray analysis, mIMCD3 cells were treated for 1 h with vehicle or 10 - 6 M aldosterone. Northern blot analysis for sgk was conducted to confirm the hormone response before the samples were used in the microarray experiments. Three independently prepared sets ofcontrol and treated RNA samples were used to generate targets forhybridization of the Affymetrix murine U74Av2 array, an oligonucleotide arraythat contains probe sets representing 12,000 mouse genes. The expression ofnumerous genes was affected by aldosterone treatment in mIMCD3 cells. Thosetranscripts that increased or decreased in the same manner in response toaldosterone in at least two of the three hybridization experiments are listedin Tables 2 and 3, respectively. Numerous expressed sequence tags (ESTs) appeared in the lists of both up- anddownregulated transcripts, shown in Tables 2 and 3, respectively. Subsequently,the online Affymetrix analysis tool NetAffx( www.Affymetrix.com )has now identified many of these ESTs; sgk was among the recentlyannotated ESTs.
6 I- `, |; [9 {, v. h O& [& o' P4 K+ W
Table 2. Transcripts downregulated by aldosterone
( w& e3 q, x6 b$ h7 p. `
1 `2 M: {& ]" H# |" {9 \8 LTable 3. Transcripts upregulated by aldosterone* l S ~( W/ Y/ G4 N1 C
# h T! y" ?9 d2 S% T9 o4 iAnalysis of aldosterone-responsive mRNAs. As expected, sgk was upregulated in all three expression analysis experiments. Several other transcripts were consistently upregulated in the expressionanalysis experiments. These include CTGF, period homolog, andpreproendothelin. These three transcripts, along with sgk, wereselected as a representative group of upregulated transcripts. Northern blotanalyses were performed to confirm the regulation effects indicated by theinitial data analysis of the microarray experiments. cDNA probes wereconstructed by RT-PCR for each of the four transcripts. sgk, CTGF,period homolog, and preproendothelin all showed clear evidence of increased mRNA in response to acute exposure to aldosterone. Northern blot analyses andreal-time PCR data suggested greater induction than those calculated from themicroarray data ( Table 1 ). No significant changes in expression of GAPDH mRNA, used as a loading controlthroughout this study, were observed. Of the four transcripts tested, periodhomolog underwent the greatest induction according to the microarray data, theNorthern blot data, and the real-time PCR data. The period homolog transcriptwas induced more than sevenfold in mIMCD3 cells exposed to aldosterone for 1h, as measured by Northern blot analysis and real-time PCR.
4 L/ q$ B5 c% ]0 o
7 @5 _4 |. @+ a3 ~! ^7 K8 STo examine the effects of a range of aldosterone concentrations, mIMCD3cells were treated with increasing amounts of the hormone for 1 h( Fig. 3 ). The most dramaticincrease in expression for all transcripts tested was observed after treatmentwith 10 - 6 M aldosterone. Although theconcentration of the hormone in these in vitro experiments was greater thanthe physiological concentration of aldosterone, the actual effective intracellular concentration was probably much lower. Recent studies haveindicated that steroid hormones may not diffuse across cell membranes asfreely as was once thought( 23 ).8 F' P0 t* q" q+ [' p
% N; C" Z O( h2 x
Fig. 3. Dose-response to aldosterone. mIMCD3 cells were treated for 1 h withvehicle or increasing concentrations of aldosterone (from10 - 10 to 10 - 6 M). The28S and 18S ribosomal RNA bands are indicated. Northern blot analysis of RNAsamples was performed using probes for the transcripts indicated. CTGF,connective tissue growth factor.
4 G* W) c0 |: \4 m' ?' h% L# V$ Q( [/ `) \# o. k$ f7 \% P
The next experiments examined the levels of expression of sgk, CTGF, period homolog, and preproendothelin as a function of time. Northernblot analysis results revealed that all four messages show a clear increase inexpression after 1 h ( Fig. 4 ). sgk mRNA decreased over the next 12 h and then showed a sharpincrease beyond 24 h. A similar pattern was observed for CTGF message. Incontrast, period homolog expression slightly decreased at 6 h and thenremained relatively low for the duration of the experiment. PreproendothelinmRNA showed a biphasic response similar to sgk and CTGF, but withdifferent timing. The recovery of preproendothelin mRNA was evident at 12 hand continued to increase. To control for a feeding effect, cells were treatedwith vehicle alone over these same time points. Northern blot analysis ofthese samples did not show any significant changes in expression of any of thefour transcripts tested (data not shown).$ t$ c) e* _" r/ K# _" t
1 |: s4 a' g* |8 WFig. 4. Time course of responses to aldosterone. mIMCD3 cells were treated with10 - 6 M aldosterone for the time periods indicated.The 28S and 18S ribosomal RNA bands are indicated. Northern blot analysis ofRNA samples from vehicle or aldosterone-treated cells was conducted usingprobes for the transcripts indicated.- B$ \8 Z. k U' W8 Y5 n0 |! e4 y
0 M; ^0 k8 @6 O9 n" u/ O( {
To further validate, in a quantitative manner, the time-course Northernblot analysis results, real-time PCR was performed using the same RNA samplesas a template ( Fig. 5 ).Expression patterns similar to those seen in the Northern blot analysis wereobserved for all transcripts tested. sg k showed a sharp fivefoldincrease at 1 h, which decreased to threefold at 6 h. The level of sgk transcript continued to climb from 12 to 48 h, hitting a peak ofapproximately sevenfold at the final time point. Period homolog peaked at 1 hwith an increase of greater than sevenfold. Period homolog levels then dropped and stayed between three- and fourfold for the remainder of the experiment.Preproendothelin showed a gradual increase from threefold at 1 h to a peak ofgreater than sixfold at 12 h. Preproendothelin levels remained high for theduration of the experiment. GAPDH showed no significant changes in expression over time.& v, n& _, ?# p0 i5 s5 b/ Z4 w8 V
' F( V3 J- s4 P; F; E" PFig. 5. Real-time PCR analysis of time course. RNA samples from duplicate timecourse experiments were used as template in duplicate real-time RT-PCRreactions. Time of aldosterone treatment is indicated. Stippled bars, sgk; vertically striped bars, period homolog; checkered bars,preproendothelin; diagonally hatched bars, GAPDH. Values are means ±SE; n = 4. *Significantly different from control, P
H$ s- e. l& R! w2 U* M& n3 B: P) d& e1 b& v
The effects of aldosterone can be mediated through the MR as well as theglucocorticoid receptor (GR). The effects of GR and MR often overlap, and thetwo receptors can heterodimerize to drive transcription of some genes( 3, 8 ). It has previously beenshown in primary cultures of IMCD cells that either MR or GR can activateelectrogenic Na transport( 12 ). Specific inhibitors ofboth receptors were used alone or in combination to determine the contributionof each to the aldosterone-mediated changes in gene expression( Fig. 6 ). Densitometry analysis of repeated Northern blot data demonstrated similar patterns of expression forall messages tested. MR and GR inhibitors, used alone or in combination,dropped expression to levels that were not significantly different fromcontrol. Use of GR- or MR-specific inhibitors suggested, then, that bothreceptors contribute to the aldosterone-mediated effects on gene expression inmIMCD3 cells. This is not a surprising result, given that MR and GR are knownto heterodimerize with each other.
2 \8 p8 \ g' m# D, J' k' Q! x$ g) X. I# B8 O
Fig. 6. Effect of mineralocorticoid and glucocorticoid receptor inhibitors. mIMCD3cells were treated for 1 h with vehicle, 10 - 6 Maldosterone (A), aldosterone plus 10 - 6 Mmifepristone (A M), aldosterone plus 10 - 6 Mspironolactone (A S), or aldosterone plus mifepristone and spironolactone(A M S). Densitometry was performed on repeated Northern blot analysis data.All values were normalized against GAPDH mRNA levels. Stippled bars, sgk; diagonally striped bars, CTGF; vertically striped bars, periodhomolog; checkered bars, preproendothelin. Values are means ± SE; n = 3. *Significantly different from control, P+ j6 H3 t' q' }! I
, X- g% h8 j* _. g3 `; l& O# qInduction of preproendothelin. To correlate protein expression with the changes in mRNA levels, a cell lysate was prepared from aldosterone-or vehicle-treated cells after 6 h of hormone exposure. Western blot analysiswas conducted using a monoclonal antibody raised against endothelin-1. Arepresentative blot is pictured in Fig.7 A. In addition, an anti-endothelin-1 polyclonal antibodywas used (data not shown). Both antibodies recognized the same band at 23kDa, which is the expected size of unprocessed preproendothelin. As determinedby densitometry, preproendothelin protein levels were increased more thanfivefold in aldosterone-treated cells compared with control cells in fourindependent experiments ( Fig.7 B ). Equal loading of samples was visualized on aduplicate gel stained with Coomassie brilliant blue (data not shown).3 F9 F+ K5 z0 @: S* f% P3 O4 k
6 e1 o1 i) } k6 r- L4 ]
Fig. 7. Increased preproendothelin protein expression in aldosterone-treated cells. A : mIMCD3 cells were treated for 6 h with vehicle or10 - 61 M aldosterone. Western blot analysis wasperformed on cell lysates using a monoclonal antibody raised againstendothelin. Equal loading was visualized on a duplicate gel stained withCoomassie brilliant blue. B : densitometry analysis was performed onrepeated Western blot analysis data. Values are means ± SE; n = 4. *Significantly different from control, P
1 u$ T% S. j- c* t! r, ]5 p- a* A+ g0 m2 d% k9 K" @, d
DISCUSSION
$ U: s8 {# o9 ~" X8 H! t9 \% Z4 E1 [2 ^4 C
The late effects of aldosterone on ion channels and transporters such asENaC and the Na -K -ATPase have been well characterized, but the genes that are immediately affected by aldosterone are not as wellknown. We have used oligonucleotide array technology to examine the effects ofaldosterone on gene expression after 1 h in a mouse IMCD cell line. Notsurprisingly, the results of three hybridization experiments suggested thatthe expression of numerous genes changed in aldosterone-treated cells compared with control cells. Northern blot analysis directly confirmed the upregulationof sgk, CTGF, period homolog, and preproendothelin transcripts. Timecourse studies showed a biphasic response of sgk and preproendothelinmRNAs to aldosterone treatment, indicating that aldosterone signaling iscomplex in mIMCD3 cells, with a long-term component in addition to the acute response. The use of MR- and GR-specific inhibitors indicated that bothreceptors contribute to the aldosterone-mediated regulation of the transcriptstested. Western blot analysis demonstrated that the increases inpreproendothelin mRNA levels also resulted in increased levels of proteinexpression.5 T) G) T ?1 b4 Z
% c( ]8 m8 B1 z' G# Y0 l1 N+ UThe human genes for sgk ( 36 ), CTGF( 26 ), period homolog( 33 ) and preproendothelin( 14 ) have been reported. Acutetranscriptional regulation suggested that each gene should be directly under the control of a hormone receptor, so the human gene promoters were examinedfor sterol-response elements (SREs) using the TRANSFAC program( 10 ). Apparent SRE sequenceswere found in all four promoters. These sites matched the consensus sequence ATCACCCCAC ( 16 ), with athreshold value of at least 80%. Whether these SREs mediate the acute effectsof aldosterone in IMCD3 cells remains to be seen.
$ C& T# ? @, D8 D2 y( h* A
* H6 j9 t# b; Q2 h. tThese findings represent a novel list of aldosterone-regulated transcripts.The physiological significance of these studies must be viewed at two levels.The first level is composed of the immediate mediators of aldosterone action.Endothelin and CTGF have emerged from the present study as two candidates that may underlie the mechanism of the known physiological actions of aldosterone;these actions are the enhancement of renal net acid excretion with theattendant metabolic alkalosis and the effects of aldosterone on cardiac andrenal fibrosis.
, c7 t8 ~* s! U, |; Q. d: X& K# h# N5 V8 ?9 ^- G5 c
The second level is only made possible with the use of oligonucleotide array technology, which enables us to examine the global, genomic effects ofaldosterone. Although caution must be exercised because these effects reflectchanges at the mRNA level, several of the transcripts listed in Tables 2 and 3 have well-known functionsand, in many cases, are part of well-established signaling pathways. Threeindependent methods, i.e., microarray analysis, Northern blot analysis, andreal-time PCR, were used to validate the aldosterone responsiveness of sgk, period homolog, and preproendothelin. Induction of CTGF wasverified by two of these methods. The consistent aldosterone-mediated response of these transcripts lends validity to the remaining transcripts on the lists.The aldosterone-induced and -repressed transcripts contain several kinases,transcription factors, and signaling proteins. It is becoming apparent thatthese molecules must play a vital role in mediating aldosterone action byregulating existing transporters or causing changes in the expression of transporters. n7 s3 M9 U* l# k3 I$ x
3 v% [0 f. O/ ]5 k* ]9 WTo our knowledge, these results represent the first investigation intoaldosterone regulation as early as 1 h after treatment using microarraytechnology. Previous studies( 24 ) examined the effect ofaldosterone at 4 h, at which time the most immediate effects of aldosteronehave likely already occurred. There are far-reaching implications of thesegenes being regulated by a mineralocorticoid. Recently, a role for sgk in Na absorption was proposed. When coexpressed withENaC, sgk is able to stimulate Na current( 22 ). In addition, sgk activity has been shown to lead to translocation of ENaC subunitsto the apical membrane ( 18 ).CTGF functions in several renal diseases( 38 ). Increased expression ofCTGF was observed in diabetic nephropathy and glomerulonephritis( 15 ). Period homolog regulatescircadian rhythms, and at least one other circadian rhythm gene, Per 2, alsoappeared in the list of upregulated transcripts. Expression of period homologin the kidney has been observed previously, and a circadian pattern ofexpression in the suprachiasmatic nucleus was also seen( 32 ). ^; |/ f4 I) B5 p' k9 r
3 E7 e; ?0 i5 ?# j0 N
Preproendothelin undergoes significant posttranslational processing withenzymatic hydrolysis by two enzymes before the production of the active form,a 21-amino acid peptide ( 1 ).Endothelin-1 is a peptide hormone secreted by vascular endothelial cells andis the most potent vasoconstrictor known. In the mature animal, endothelin-1has other effects aside from vasoconstriction. Most notably, endothelin-1 hasbeen shown to affect both Na transport( 9 ) and H secretion( 37 ) in the collecting duct. In addition, evidence supports the role of endothelin-1 in the pathogenesis ofrenal interstitial fibrosis, K depletion, and diabetic nephropathy( 11 ). Aldosterone is a knownstimulator of H secretion( 20 ). The finding thatpreproendothelin is one of the early genes stimulated by aldosterone suggestsan important role for this hormone as a mediator of aldosterone action. Givenaldosterone's known effect on cardiac fibrosis ( 25 ) and our observation thataldosterone also stimulates CTGF, a more coordinated action of aldosterone mayemerge from these studies. Further investigation into the relationship among aldosterone, CTGF, and endothelin-1 must be made to elucidate the mechanismsgoverning each of their roles in cardiovascular disease.
; x! d/ w) `- [ O2 r
+ X. {( D+ F7 J3 z! f' {! v3 zThe expression of several additional transcripts was affected byaldosterone as described by the microarray data, and these effects remain tobe confirmed and studied. The identity of these genes indicates that thealdosterone-signaling pathways are more complex than previously thought.Subsequent investigation into the functions of these early-response genes,together with the results presented here, will provide greater insight intothe signaling pathways initiated by aldosterone and will further clarify ourknowledge of the critical role aldosterone plays in regulating ion homeostasisand cardiovascular disease.
8 B# h* v# g: L! x) i8 O7 H2 b1 |0 @6 h( F7 [5 p Y g9 M
DISCLOSURES
2 K0 A4 i3 u4 q
% R1 C& Q1 k8 D* A6 |3 M7 f" k3 \ s0 aThis work was supported by Public Health Service Grant RO1-54721 (to B. D.Cain), Department of Veteran Affairs Merit Review Award 0001 (to C. S. Wingo),and National Institute of Diabetes and Digestive and Kidney Diseases TrainingGrant DK-07518 (to M. L. Gumz.).
! L& q) A3 R& w+ ^+ }) _2 }, I: J: k) y# o0 d8 I! Q
ACKNOWLEDGMENTS
& L4 c- C' d) R! X2 o I5 q5 v. [' t% `
We thank Dr. Rena Bahjat for assistance with statistical analysis programs.
% e5 `5 L" `5 Y 【参考文献】7 M9 L; z( U1 b- @. }, v
Agapitov AV andHaynes WG. Role of endothelin in cardiovascular disease. JRenin Angiotensin Aldosterone Syst 3:1-15, 2002.# q- U3 m8 ]. A& v& q
' P/ P4 d! _ m! m( g5 k \: [. G( C5 r$ T
8 |$ P6 N9 u1 b A# o# W. RAlvarez de la Rosa D, Zhang P, Naray-Fejes-Toth A, Fejes-Toth G, andCanessa CM. The serum and glucocorticoid kinase sgk increases theabundance of epithelial sodium channels in the plasma membrane of Xenopus oocytes. J Biol Chem 274: 37834-37839,1999.
V9 Q5 C6 `! q9 V* y
9 ^: p* Q+ d5 y6 @& [( ?2 Z, C6 `; x! w- `5 N3 S
3 _* y4 z3 h# W) o3 ?Arriza JL,Weinberger C, Cerelli G, Glaser TM, Handelin BL, Housman DE, and Evans RM. Cloning of human mineralocorticoid receptor complementary DNA: structural andfunctional kinship with the glucocorticoid receptor. Science 237:268-275, 1987.
' \. R, ?& D5 f# G" L4 T1 ?& s+ U/ o" h" ~% ~4 A
+ W6 ^% ]! n$ K8 S- |+ w
8 q7 b0 a7 w5 D5 ZBooth RE,Johnson JP, and Stockand JD. Aldosterone. Adv PhysiolEduc 26:8-20, 2002.
/ l6 D0 l. s% r) D' V1 `* [$ C3 C1 t/ q
5 h0 _4 j7 V5 b8 }2 J& E. l
% H0 b5 y8 M9 N. ~6 w, B7 z% ^# B9 bChen SY,Bhargava A, Mastroberardino L, Meijer OC, Wang J, Buse P, Firestone GL, VerreyF, and Pearce D. Epithelial sodium channel regulated byaldosterone-induced protein sgk. Proc Natl Acad SciUSA 96:2514-2519, 1999.
% g2 k9 L2 B$ P6 b# j- p
+ d8 u7 T" y+ K/ b! o, U" F
- r {6 u( g! T; z2 y) L
- [3 q; z. s: {# oDavis LG, KuehlWM, and Battey JF. Basic Methods in MolecularBiology (2nd ed.). Norwalk, CT: Appleton and Lange,1994.
% N' n9 t+ t4 z# y4 E2 F& C( S' X
# M/ A3 c( `$ a! h
& l* P$ l" b# N- u" {5 e5 | }
1 q' r. Q' y% o. L9 W) LDebonneville C,Flores SY, Kamynina E, Plant PJ, Tauxe C, Thomas MA, Munster C, Chraibi A,Pratt JH, Horisberger JD, Pearce D, Loffing J, and Staub O. Phosphorylation of Nedd4-2 by Sgk1 regulates epithelial Na channel cell surface expression. EMBO J 20: 7052-7059,2001.) Z* i6 a- _5 ?+ K
, @4 | k3 A0 j: r. m& M* _! [+ K% ?# [5 u9 V+ c
: z: x2 s) j8 ?6 |( `4 A& EFarman N andRafestin-Oblin ME. Multiple aspects of mineralocorticoid selectivity. Am J Physiol Renal Physiol 280:F181-F192, 2001. t/ t3 f) D2 N3 T# l, t! ~
% k" @' M6 I0 f8 S
$ J" Z, n0 b% N0 d8 a& l
1 O5 J3 J! f. X, r" H! G# u/ u/ UGallego MS andLing BN. Regulation of amiloride-sensitive Na channels byendothelin-1 in distal nephron cells. Am J Physiol Renal FluidElectrolyte Physiol 271:F451-F460, 1996.
' }0 z7 s/ ]/ M z
8 _) j+ G! R. C- S3 `: A I# k9 {. a0 u. Y, [9 Y
: w- U1 l" Y& J Z! z
Heinemeyer T,Wingender E, Reuter I, Hermjakob H, Kel AE, Kel OV, Ignatieva EV, Ananko EA,Podkolodnaya OA, Kolpakov FA, Podkolodny NL, and Kolchanov NA. Databaseson transcriptional regulation: TRANSFAC, TRRD and COMPEL. NucleicAcids Res 26:362-367, 1998.$ x' ]* n5 ~8 s' {& a) A+ V$ v0 Z
! a% l, A6 K: k4 o, Y, Q
6 a3 c1 c! b$ R3 x
: y5 i! H& c9 V) }/ i: lHocher B, LunA, Priem F, Neumayer HH, and Raschack M. Renal endothelin system indiabetes: comparison of angiotensin-converting enzyme inhibition andendothelin-A antagonism. J Cardiovasc Pharmacol 31: S492-S495,1998.
: K- i0 q) `7 u2 V
( }; Q0 V5 ?, R2 \% \6 `* T# p4 Z q; Q( c
9 R5 Z; f3 U) X6 c( uHusted RF,Laplace JR, and Stokes JB. Enhancement of electrogenic Na transport across rat inner medullary collecting duct by glucocorticoid and bymineralocorticoid hormones. J Clin Invest 86: 498-506,1990.) I. i: Q% s8 g, M
9 T6 c/ [3 c, F K9 q% h) i* E; { ?: ~, p, i8 }
: J0 W4 R- C7 u) j" GHusted RF andStokes JB. Separate regulation of Na and anion transport byIMCD: location, aldosterone, hypertonicity, TGF- 1, and cAMP. Am J Physiol Renal Fluid Electrolyte Physiol 271: F433-F439,1996.* U5 b: s! d5 x3 p( N
, Z, z: o: d0 o& K4 f; }
& o2 z' l$ u; C6 Y, ~
# m( {# f6 S6 \: S
Inoue A,Yanagisawa M, Takuwa Y, Mitsui Y, Kobayashi M, and Masaki T. The humanpreproendothelin-1 gene. Complete nucleotide sequence and regulation ofexpression. J Biol Chem 264:14954-14959, 1989.
0 i1 u$ I M/ v" U8 Z
- _ {( o' ~- c1 D" R o: m i/ i* v2 P9 r
5 T" t w) j ]Ito Y, Aten J,Bende RJ, Oemar BS, Rabelink TJ, Weening JJ, and Goldschmeding R. Expression of connective tissue growth factor in human renal fibrosis. Kidney Int 53:853-861, 1998.
3 F" M# `, Z& T0 C' q( B+ L; a X
. w" @. d5 E/ e" }2 o- F# J
2 \* ?/ a0 m# q d1 A7 R4 x, ~4 T
Kim JB, SpottsGD, Halvorsen YD, Shih HM, Ellenberger T, Towle HC, and Spiegelman BM. Dual DNA binding specificity of ADD1/SREBP1 controlled by a single amino acidin the basic helix-loop-helix domain. Mol Cell Biol 15: 2582-2588,1995.
, x- r& S7 y) ?& w# E1 I- }0 X9 H2 ]% s, f
0 k) a9 v; c3 P9 U2 O8 T* o, v6 D5 h( S; v2 s$ s4 u' E4 v/ Y
Loffing J,Pietri L, Aregger F, Bloch-Faure M, Ziegler U, Meneton P, Rossier BC, andKaissling B. Differential subcellular localization of ENaC subunits inmouse kidney in response to high- and low-Na diets. Am J PhysiolRenal Physiol 279:F252-F258, 2000.8 \' N/ h' ~) n5 Q4 n O' V7 s* @& Q
, p" ?: [, ~+ V* Y$ z
1 ]% e, i9 U K
5 \1 C& Z4 L. O' ILoffing J,Zecevic M, Feraille E, Kaissling B, Asher C, Rossier BC, Firestone GL, PearceD, and Verrey F. Aldosterone induces rapid apical translocation of ENaC inearly portion of renal collecting system: possible role of SGK. AmJ Physiol Renal Physiol 280:F675-F682, 2001.
& g6 I t ^5 k1 T* Y1 y! x" [9 b1 g) M" c9 y' c9 ?
9 R6 E: }2 y; z( A# H1 y7 P) v, G
7 A/ ?+ B7 ]: D2 DNaray-Fejes-Toth A, Canessa C, Cleaveland ES, Aldrich G, andFejes-Toth G. sgk is an aldosterone-induced kinase in the renal collectingduct. Effects on epithelial Na channels. J BiolChem 274:16973-16978, 1999.
1 K( r! Y" V5 w7 |8 |) a
0 p2 |( g; y$ x) N
) u; n6 x4 a" |. i# B8 [7 x: y1 D7 s
! c8 n+ L9 i1 x% i- A8 UOberleithner H,Steigner W, Silbernagl S, Vogel U, Gstraunthaler G, and Pfaller W. Madin-Darby canine kidney cells. III. Aldosterone stimulates an apicalH /K pump. Pflügers Arch 416: 540-547,1990.6 p* @3 h. b2 T+ v- s
9 N* K0 e& w, `/ I8 e) D# r# L: K5 O5 l0 H( z
- F4 z5 G" K; y& U6 m+ A2 g7 dPan YJ andYoung DB. Experimental aldosterone hypertension in the dog. Hypertension 4:279-287, 1982.
8 Q6 i; Q- @, T! `. L" ~! G$ }4 s x! y' y( W0 N" e2 I
' ?1 T0 `: _5 |2 m6 \. X
) w( D5 p* d" o. K4 x! o; xPearce D,Verrey F, Chen SY, Mastroberardino L, Meijer OC, Wang J, and Bhargava A. Role of SGK in mineralocorticoid-regulated sodium transport. KidneyInt 57:1283-1289, 2000.
+ ?8 s+ n( x5 D( W9 g$ i# O7 L) X. f
3 W# z. c; o- X
O/ y$ X6 t3 f4 lPietras RJ,Nemere I, and Szego CM. Steroid hormone receptors in target cellmembranes. Endocrine 14:417-427, 2001.
+ R: U G8 Y8 o6 a
# Y6 G- c6 a$ J- R7 t1 W" A( }6 _0 k
# c5 {! z% N/ _" w- _
' Q: P5 [, \& q2 D, hRobert-Nicoud M, Flahaut M, Elalouf JM, Nicod M, Salinas M, Bens M,Doucet A, Wincker P, Artiguenave F, Horisberger JD, Vandewalle A, Rossier BC,and Firsov D. Transcriptome of a mouse kidney cortical collecting ductcell line: effects of aldosterone and vasopressin. Proc Natl AcadSci USA 98:2712-2716, 2001.
' }, H! }$ q+ I' R) _2 K. ~: b" J4 p+ X
& d: e: @1 `+ Z$ `
7 t. E' J# _% ?* {( Y: b4 V
Rossi GP,Cavallin M, Nussdorfer GG, and Pessina AC. The endothelin-aldosterone axisand cardiovascular diseases. J Cardiovasc Pharmacol 38, Suppl 2:S49-S52, 2001./ v R* }/ k, }# c
6 Q( S" j( e( g2 Y4 f4 L; f9 n
8 f4 i& F1 I) j1 e
* @, V$ ?" }9 J% V Z. M- KRyseck RP,Macdonald-Bravo H, Mattei MG, and Bravo R. Structure, mapping, andexpression of fisp-12, a growth factor-inducible gene encoding a secretedcysteine-rich protein. Cell Growth Differ 2: 225-233,1991.* }6 J" K6 ~9 ?# L
2 r" M( s V8 H7 N7 o: S+ {' C
7 o+ t; V: T, O# k8 c: [
- r& \& K( e2 Z4 [Shigaev A,Asher C, Latter H, Garty H, and Reuveny E. Regulation of sgk byaldosterone and its effects on the epithelial Na channel. Am J Physiol Renal Physiol 278:F613-F619, 2000.
" O. O# z+ J" U$ ^# @, U
* q. T# i* J4 f$ P, `, h. z) g5 T; {* `5 J- G
% z1 F3 `8 r; Z/ `2 |1 \Sonnenberg H,Cheema-Dhadli S, Goldstein MB, Stinebaugh BJ, Wilson DR, and Halperin ML. Ammonia addition into the medullary collecting duct of the rat. Kidney Int 19:281-287, 1981.
' _( w2 p3 V9 L/ t' {$ |
* F3 i/ Y! p* K$ x0 W
& B5 E! }4 v! [* L$ g
: P0 J: ?% u D0 g6 \Sonnenberg H and Chong C. Comparison of micropuncture of microcatheterization inpapillary collecting duct. Am J Physiol Renal Fluid ElectrolytePhysiol 239:F95-F105, 1980.; T% n5 ^* d: ?
. H w) j) P5 f: K9 N
0 v( f1 C+ t/ P% w E$ j, R
: Y$ O, {2 V8 A' j$ k! U, FSpindler B,Mastroberardino L, Custer M, and Verrey F. Characterization of earlyaldosterone-induced RNAs identified in A6 kidney epithelia. Pflügers Arch 434:323-331, 1997.
. K& n/ v" @' C1 Q, t$ I% ]+ O+ z. w. V. W4 a
3 s H! U- ^% A5 p- `" T
& x, h& ~ @/ a" u& d. n/ L" EStockand JD. New ideas about aldosterone signaling inepithelia. Am J Physiol Renal Physiol 282: F559-F576,2002.( Y( M. I% W1 r) m9 r+ ?( ~
6 l# n1 I! a8 O1 ^7 g
/ a5 r# t/ u5 J! Y
+ L2 d D. N3 _! XSun ZS,Albrecht U, Zhuchenko O, Bailey J, Eichele G, and Lee CC. RIGUI, aputative mammalian ortholog of the Drosophila period gene. Cell 90:1003-1011, 1997.
! B) i: u) x# Z8 N
0 x5 E/ ?" w4 t6 N6 q# c; n; C3 t% V) O- W1 G% R
6 o8 h5 Z: f {9 }: C
Taruscio D,Zoraqi GK, Falchi M, Iosi F, Paradisi S, Di Fiore B, Lavia P, and Falbo V. The human per1 gene: genomic organization and promoter analysis of the firsthuman orthologue of the Drosophila period gene. Gene 253:161-170, 2000.4 O9 D) b8 n2 |$ V: e6 y
" L* O, `( m+ r! U3 }' p: Y8 f: S: u3 `! E
5 h$ Z7 I+ T6 N- R/ B) C5 |$ ~) ^0 D
Verrey F,Pearce D, Pfeiffer R, Spindler B, Mastroberardino L, Summa V, and ZecevicM. Pleiotropic action of aldosterone in epithelia mediated bytranscription and posttranscription mechanisms. KidneyInt 57:1277-1282, 2000.
* v$ F! }! f( L; N/ p1 y9 Y" J* g+ e) d$ p+ k. e& I$ W
- O" ^& ]8 C1 C/ ~1 q3 }
6 a7 U- N0 }6 {Volk KA,Sigmund RD, Snyder PM, McDonald FJ, Welsh MJ, and Stokes JB. rENaC is thepredominant Na channel in the apical membrane of the rat renalinner medullary collecting duct. J Clin Invest 96: 2748-2757,1995.8 X3 U0 V& ~% a( r
, Q* Y" ^9 |+ u' a# h
R3 N E6 d, T+ i0 F1 V
( M( A$ F, `2 C- |! v& JWaldegger S,Erdel M, Nagl UO, Barth P, Raber G, Steuer S, Utermann G, Paulmichl M, andLang F. Genomic organization and chromosomal localization of the human SGKprotein kinase gene. Genomics 51: 299-302,1998.; y: B0 Y' L' t) @# i
+ Z0 r0 a# {! D& R1 s4 u4 w# g
# c% p8 ~' R* F8 V( I! S# \
; |! o, c n8 p) i5 z! M: DWesson DE andDolson GM. Endothelin-1 increases rat distal tubule acidification in vivo. Am J Physiol Renal Physiol 273:F586-F594, 1997.
$ |, D9 j' `7 v5 R9 y# z5 E+ C, q' W, H- u8 R1 @$ ?/ M+ J7 Z
' |8 I" d6 n5 g& k
4 |$ {3 S+ T/ `+ U# ?0 Z6 t
Yokoi H,Mukoyama M, Sugawara A, Mori K, Nagae T, Makino H, Suganami T, Yahata K,Fujinaga Y, Tanaka I, and Nakao K. Role of connective tissue growth factorin fibronectin expression and tubulointerstitial fibrosis. Am JPhysiol Renal Physiol 282:F933-F942, 2002. |
|