- 积分
- 0
- 威望
- 0
- 包包
- 0
|
作者:Øyvind B. Vågnes, Frank H. Hansen, Rolf E. F. Christiansen, Camilla Gjerstad, and Bjarne M. Iversen作者单位:Renal Research Group, Institute of Medicine, University of Bergen, N-5021 Bergen, Norway # q+ f: ^9 l! ? Y0 L: H$ ~
6 g+ g6 I, ]: R) y( Z' ^& V I' B0 ~6 G: [* S5 Q- M1 ?
, m3 o. F8 g% o/ U& x. R8 |' o4 I, M 5 |1 g o/ ?7 Z
# d$ L4 Z1 B1 l. Y7 R
/ w% ?' ]. {+ S q/ E' f/ { & _9 U: P6 G( E) P
4 _8 {, b& x, t* P" y
: z$ Z8 T& Y4 d. w ( B f& l+ v2 z R6 \" G
- E0 Q( G* t9 s1 P- X6 G, o 4 t5 r+ l4 k2 Z [% F" k
【摘要】4 y5 g$ N7 L: n2 r/ b% ?
Experiments were performed to get insight into the role of AVP receptor V 1a regulation with age, i.e., during development and maintenance of high blood pressure. Previous studies showed an increased gene expression and renal vascular response to AVP in young spontaneously hypertensive rats (SHR). The age regulation of the V 1a receptor was examined in preglomerular vessels from 5-, 10-, 20-, and 70-wk-old SHR using normotensive Wistar-Kyoto rats (WKY) as controls. Real-time PCR and ligand binding were used for analysis of receptor expression, and the change in cytosolic calcium concentration during stimulation of isolated preglomerular vessels with AVP was studied. Studies showed an increase of the V 1a receptor protein and mRNA from 5-and 10-wk-old SHR compared with vessels from 20- and 70-wk-old SHR. In 5-wk-old SHR receptor density was 84 ± 13 fmol/mg protein, and 38 ± 11 fmol/mg protein in 70-wk-old SHR ( P < 0.05). mRNA in the 5- and 70-wk-old SHR was 15,854 ± 629 and 3,181 ± 224 V 1a mRNA/108 18S ribosomal RNA, respectively ( P < 0.001). Values from WKY at all ages were similar to 20- and 70-wk-old SHR. During stimulation with AVP, the change in cytosolic calcium in vessels from 5-wk-old SHR increased 234 ± 59 nM, whereas the increase was 89 ± 9 nM in 70-wk-old SHR ( P = 0.03). These results indicate that the V 1a receptor is increased at protein and mRNA level during development of hypertension in SHR but is normalized when hypertension is established. * O. Q* _' _% h" ]! x: h' B% z
【关键词】 hypertension calcium signaling renal circulation
3 ]; p$ n7 q5 n! r! P1 C! d ARGININE VASOPRESSIN (AVP) is a nonapeptidic hormone exerting various biological effects in the central nervous tissue and in peripheral organs. These effects include vascular constriction and tone, water retention, baroreceptor modulation, regulation of liver gluconeogenesis, platelet aggregation and adrenocorticotropin release, and central nervous tissue neurotransmittor ( 25, 42 ). AVP signaling is mediated through three types of G protein-coupled receptors, V 1a, V 1b, and V 2. V 1a is localized to vascular smooth muscle cells, hepatocytes, and in the brain ( 35, 38 ). V 1b receptors are found exclusively in the brain and stimulate the release of adrenocorticotropin ( 1 ). Renal epithelial V 2 receptors are involved in regulation of water reabsorption through activation of aquaporins in the collecting ducts of the kidneys ( 5, 36, 38 ). The three AVP receptors differ with regard to signal transduction. V 1a and V 1b signaling is mediated through phosphatidylinositol hydrolysis with increased cytosolic calcium concentration ([Ca 2 ] i )as the effector. The V 2 signal transduction is mediated through adenylate cyclase with increased cytosolic cAMP and the aquaporins as the effector in the collecting ducts.
/ b# i- h9 d! a% n
. Z+ s: v/ `2 D' `- [. `8 x+ oPrevious studies showed that AVP may be a contributor in the pathogenesis of hypertension in the spontaneously hypertensive rat (SHR) ( 4, 33 ) and in DOCA salt hypertension ( 13 ). The AVP contribution in genetic hypertension seems to be mediated through the V 1a receptors. Intrarenal administration of V 1a agonist produces vasoconstriction, salt and water retention, and hypertension ( 12 ). Blocking this receptor with a V 1a -specific antagonist delays the hypertensive development in SHR ( 4, 33 ). Water retention through V 2 stimulation does not contribute in this process, and treatment with V 2 antagonist has been shown to enhance the hypertensive development ( 33 ).
( a% n) ?! v- o3 C, V' w' r: n
; J0 v/ _* |. u6 [/ \Young SHR has an increased renal vascular sensitivity to vasoconstrictor agents ( 8, 15 ). The increased vasoconstrictive response to ANG II in young SHR seems to be due to a defective G protein activation in the cAMP pathway in the kidney. Due to this, there is a defective buffering activity of dopamine and prostaglandin to the renal vasoconstrictive effect of ANG II in SHR ( 7, 9 ). In contrast, the exaggerated renal vascular response to AVP is independent of prostaglandins ( 15 ). In a previous publication, we found that ANG II stimulation of smooth muscle cells isolated from preglomerular resistance vessels from SHR and Wistar-Kyoto (WKY) rats produces an equal rise in [Ca 2 ] i ( 23 ). In contrast, stimulation with AVP induced an almost doubled increase in [Ca 2 ] i in young SHR compared with age-matched WKY ( 23 ). This points toward different mechanisms for the increased renal vascular response to ANG II and AVP in SHR. We found an increased expression of the V 1a receptor in young SHR compared with age-matched WKY, whereas AT 1 receptor density is similar ( 6, 46 ). This is probably the reason for the exaggerated renal vascular response to AVP in young SHR. In 40-wk-old SHR, the vascular AVP response becomes equal to that of age-matched WKY ( 10 ).
. X- y8 T8 k4 h2 B1 i% y, `7 X! }0 L! [1 F+ e; R( M3 a0 ?
In the present study, we wanted to test the hypothesis that increased V 1a response may play a role during development of hypertension. The receptor density was examined when the blood pressure rises and in the later stage of hypertension when the blood pressure is stabilized. The isolated cells were submitted to [ 3 H]AVP binding assays and real-time PCR to investigate the V 1a expression and to fura 2 fluorescence to study [Ca 2 ] i after AVP stimulation.! @+ A9 `! U6 ~7 V6 ~
# f6 Y" _ K0 B6 |% q/ D l
MATERIALS AND METHODS
' z0 \6 C: t$ N' C. R$ o. o7 k9 W4 _4 T/ p: f
Animals. Male SHR (Mol) and WKY (Mol) rats were obtained from the Møllegaard colony in Denmark (now Taconic M&B). Animals at 5, 10, 20, and 70 wk of age were studied, and the experiments were performed in a total number of 66 WKY and 66 SHR. Body weight varied between 160 and 180 g in the youngest group and 450 to 580 g in the oldest animals. Three animals were kept in each cage and were fed ordinary rat chow containing 0.25% sodium, 0.66% potassium, 0.71% calcium, and 14.7% crude protein and had free access to tap water. The experiments were performed with the approval of the Norwegian State Board for Biological Experiments with Living Animals.
- Y H# B! |9 q" N" S! L" h, a8 l' T h% f* s
Hemodynamic measurements. Animals were anesthetized by intraperitoneal injection of pentobarbital sodium (65 mg/kg body wt). A polyethylene catheter was inserted into the left femoral artery for measurement of arterial blood pressure using a Hewlett-Packard pressure transducer connected to a Gould TA 4000 recorder. Renal blood flow (RBF) was recorded by a 2-mm flow probe on the left renal artery connected to a transit time flowmeter (Transonic) and a Gould recorder.7 Q; g' V2 E7 x1 Z6 L; e
( q& g. i% Z3 _ l) m5 {Isolation of preglomerular resistance vessels for ligand binding and real-time PCR. After anesthesia, a midline abdominal incision was made, and the abdominal aorta was cannulated below the renal arteries. The aorta was ligated above the renal arteries, the left renal vein was cut, and the kidneys were perfused with ice-cold PBS and thereafter with magnetic iron oxide resuspended in PBS (1% wt/vol). The kidneys were excised and placed in ice-cold PBS. All subsequent steps of vessel isolation were performed on ice. Kidneys were decapsulated, and the cortex was isolated by dissection. Cortical tissue was minced with a razor blade and homogenized in a glass homogenizer with a loose-fit pestle (Kontes). Iron oxide-containing vessels were removed from the homogenate with a magnet, and the magnetic tissue was passed through 21- and 23-gauge needles and then filtered through a 125-µm mesh sieve. For RNA purification, vessels were passed through 25-gauge needles to get rid of tubular tissue. Microvessels recovered on the top of the sieve were resuspended in PBS, and iron oxide-containing vessels were extracted with a magnet, resuspended in collagenase-PBS (55 U/ml), and incubated for 30 min at 37° C. Vessels were isolated with a magnet, resuspended in ice-cold PBS, and passed through a 23-gauge needle. The tissues were resuspended in PBS and shaken to detach iron oxide from tissue. Iron oxide was removed with a magnet, and the cells were sonicated and centrifuged at 10,000 g for 30 min. Protein concentration in the recovered cell pellet was determined by a colorimetric method ( 3 ). Vessel isolation for real-time V 1a mRNA quantification was performed as described above. (To avoid RNase degradation of the mRNA, the isolation was stopped before the collagenase treatment.)
" o0 x- h7 V: J/ m5 |) ?/ y2 t" E2 H/ k7 E: k. m. U2 ?( R
[ 3 H]AVP binding assay. Ligand binding was done in all groups. All reactions were performed in duplicate. Isolated microvessels (50 µg) were incubated in 250-µl incubation medium {50 mM Tris·HCl (pH 7.4), 5 mM MgCl 2, 0.3% bovine serum albumin and [ 3 H]AVP]} at room temperature for 90 min. Bound and unbound ligand was then separated by centrifugation in a sucrose gradient; 0.2 ml of the incubated samples was layered over 0.2 ml assay-binding buffer containing 20% succrose in 0.5 polyethylene microcentrifuge tubes. The tubes were centrifuged in a fixed angle rotor at 5,000 g for 30 min at 0-4° C. The tubes were then rapidly frozen in dry ice and the bound ligand-containing tips were cut with a guillotine. The isolated fractions were then assayed in a Packard Tri Carb 4550 scintillation counter.
) t' N6 A3 a% t; ~" @+ ^" ~. l9 ]( O4 `& N/ A$ H
The protein concentration, binding conditions, and time to attain equilibrium binding of [ 3 H]AVP to isolated segments of rat afferent arterioles were determined in preliminary experiments. Specific binding of [ 3 H]AVP (5 nM) was linear with increasing amounts of protein added up to 50-100 µg protein. Incubations were performed at room temperature and in the presence of aprotinin (700 U/ml) to minimize potential degradation by peptidases. Specific binding of [ 3 H]AVP (5 nM) to 50 µg protein took 30-45 min to reach equilibrium at 25° C.- r' u' a* N( m0 [$ Q" X B7 X
?( `! B$ G9 p8 pEquilibrium saturation binding experiments were performed with increasing concentrations of [ 3 H]AVP between 0.125 and 4.0 nM. Specific binding was calculated as total binding minus nonspecific binding measured in the presence of 2.5 µM unlabeled AVP. The maximum specific binding (B max ) and dissociation constant ( K d ) were calculated by using the Ligand software program (Biosoft). Each group of experiments consisted of at least three determinations each using fresh tissue preparations.
9 V* N/ y( x4 Y$ U" u3 \+ x! W+ g4 n. H1 {+ ~8 o6 V
Real-time PCR. Quantitation of V 1a mRNA was done by real-time PCR in all groups except 20-wk-old WKY. All amplifications were done at the same time. First-strand cDNA was synthesized from isolated total RNA using a First-Strand cDNA Synthesis Kit (Amersham Biosciences) and primed by pd(N) 6 primers. Primers for amplification of V 1a were selected for a 114-bp fragment containing the splicing site of the two V 1a exons. The forward primer was 5'-atgtggtcagtctgggatga-3'. The reverse primer was 5'-catgtatatccacgggttgc-3'. The Taq man probe was 5'-caatcacggcgttgctggct-3', marked with FAM and 3' TAMRA. The amplified V 1a cDNA was normalized against amplified 18S ribosomal RNA to compensate for any changes due to RNA degradation, reverse transcriptase efficiency, or amplification success. The primers were made for a 68-bp fragment. The forward primer was 5'-agtccctgccctttgtacaca-3'. The reverse primer was 5'-gatccgagggcctcactaaac-3'. The Taq man probe was 5'-cgcccgtcgctactaccgattgg-3', marked with 5' Yakima Yellow and 3' TAMRA.
4 g2 ^' @8 g* @& v9 F. Z
3 x; z- S) w2 m1 i9 R1 {The amounts of V 1a and 18S were quantified using a standard curve for known quantities of V 1a or 18S DNA. The V 1a standard curve was made by amplifying a 1,125-bp region of the V 1a cDNA with the primers ccgtggtggcctctaaccac (forward) and ctgtctttcggctcatgcta (reverse). For the 18S standard curve, a 396-bp region of the rat 18S RNA cDNA was amplified using primers ttcagccaccgagattgagc (forward) and cgcaggttcacctacggaaa (reverse). The amplification products were then cloned into pBAD TOPO TA vectors and transfected into TOP 10 Escherichia coli cells (Invitrogen). Plasmids containing the cloned material were then purified from bacterial cultures using a Qiagen Plasmid Purification Midi kit. The purified plasmids were diluted to concentrations appropriate for the standard curve: 10 10,10 8, 10 7, 10 6, and 10 5 molecules/µl for 18 S, and 10 6, 10 5, 10 4, and 10 3 molecules/µl for V 1a. The primer and probe constructions were done using Primer Express software from Applied Biosystems. The quantification was done on an ABI PRISM 7900 HT Sequence Detection System (Applied Biosystems) and with a qPCR Core Kit (Eurogentec). The primer concentrations were optimized before use in quantification. Forward primers for both V 1a and 18S were used in a final concentration of 0.3 µM. Reverse primers for both V 1a and 18S were used in a final concentration of 0.9 µM. For each sample, 1 µg of total RNA in 15 µl was used for the cDNA synthesis. In each amplification reaction, 1 µl of cDNA solution was used as a template. All amplifications of both V 1a and 18S RNA were done using three parallel amplification reactions under standard ABI conditions using 19 µl of reaction volumes.
3 }: t2 w1 n+ `0 {% O
# ?5 r" v. {4 C8 q& } D[Ca 2 ] i measurements. [Ca 2 ] i measurements were done in 5- and 70-wk-old WKY and SHR. The animals were anesthetized (50-70 mg/kg pentobarbital sodium), and the left kidney was perfused in vivo with 1.5 ml agarose solution (2% Seaprep agarose in RPMI, 37° C) after being washed with 5-10 ml warmed RPMI. The kidney was chilled (4° C for 10 min) after excision for the agar to solidify. Cortical slices of 100 µm were incubated for 30-60 min at 37° C in Ca 2 -free RPMI with collagenase IV, dispase II, and trypsin inhibitor to dissociate the microvessels from the renal tissue ( 29 ). Trypsin inhibitor was used to counteract V 1a cleavage from clostripain contamination of the collagenase IV ( 30, 40 ). The vessels were adhered to a microscope perfusion chamber and loaded in 5 µmol/l fura 2-acetoxymethyl ester (45 min) at room temperature.
8 G& u% i6 ?8 t5 l0 \+ N2 j+ G* `
) G" U1 D9 z. `* v[Ca 2 ] i was measured on isolated preglomerular vessels in a perfusion chamber using a small window of the optical field of x 40 oil-immersion fluorescence objective of an inverted microscope (Olympus IX-70). The vessels were excited alternately with lights of 340- and 380-nm wavelengths from a dual-excitation wavelength system (Delta-Ram) from Photon Technologies International (PTI) with dual-monochronometers and a chopper (PTI). After signals were passed through a barrier filter (510 nm), fluorescence was detected by a photomultiplier tube. Signal intensity was stored and processed using Felix 1.21 software (PTI) on a PC. Calibration of free calcium concentration was based on the ratio of 340/380 nm ( 20 ). The calibration of [Ca 2 ] i was based on the signal ratio at 340/380 nm and known concentration of calcium ( 23 ).
9 V3 \; p, _3 R8 P" w& i! h9 ~& u1 z& [. y
The microscope chamber was gravity fed (2 ml/min) through a perfusion inline heater (Warner TC344-B), which maintained the temperature in the chamber at 36-37° C. The solution switching between AVP and medium was done with a Valvebank8 II (AutoMate Scientific). [Ca 2 ] i response was recorded when stimulating with 10 -7 M AVP from six to nine animals for each data point.
4 Q' t& C4 A. S! S3 y: U6 x5 [3 o, ?, z, F) c" b* Y
Chemicals. All chemicals used in this experiment were from Sigma, except fura-2 AM, which came from Molecular Probes. The RPMI media contained (in g/l) l7.65 NaCl, 0.40 KCl, 0.203 MgCl 2, 0.20 NaH 2 PO 4, 1.34 HEPES, 1.0 glucose, 0.11 Na Pyruvat, 0.35 CaHCO 3, 0.22 CaCl 2, RPMI vitamins (Sigma R7256), and aminoacids (Sigma R7131).
" s4 H3 ?7 w3 a, S: D( b, f' L! G4 ~6 B7 W
Statistics. Data were presented as means ± SE. Sets of data were tested by ANOVA. P values of
z+ X6 A! i6 Z; x0 M. U' {0 y2 I! O$ U6 W0 S, X" R) ^
RESULTS, V7 K0 t1 v" V7 I
, J \; m( m4 t+ V. [The mean arterial blood pressure (MAP) increased from 120 ± 3 in 5-wk-old SHR to 184 ± 9 mmHg in 20-wk-old SHR ( P
5 _; o8 e2 x% r7 h A0 v, ^
/ Q4 j \3 G' X2 P$ c# R3 u4 @Fig. 1. Blood pressure in 5-, 10-, 20-, and 70-wk-old Wistar-Kyoto (WKY) and spontaneously hypertensive rats (SHR). Values are means ± SE. * P $ `$ Q( w4 k" N7 m$ d e& x3 F; b
. A. \8 ^( f( V6 zRBF was 5.6 ± 0.2 in 5-wk-old SHR and 5.5 ± 0.3 ml·min -1 ·g tissue -1 in 5-wk-old WKY ( P 0.9). It increased to 8.2 ± 0.3 in 10-wk-old SHR ( P
0 |7 ]3 W& k! q! m% Q% p; Q' L, g5 q' s) O% l( A
Age-related regulation of V 1a receptors was studied in WKY and SHR. The AVP/V 1a dissociation constant ( K d ) was identical in all groups.5 m; a1 }+ j# z. @4 i0 A3 n5 u4 ]) V
8 G) P5 [, Y* g3 W t
In 5- and 10-wk-old animals, receptor density was higher in SHR compared with age-matched WKY. Five- and 10-wk-old SHR had a significantly higher V 1a receptor density than WKY of all age groups ( P
* t) r5 n/ f9 H1 Q0 `3 r" E( P( C
/ u2 |- G5 q0 Q) b3 KFig. 2. V 1a receptor density in WKY and SHR of 5, 10, 20, and 70 wk, measured by ligand binding. 50- And 10-wk-old SHR significantly higher than WKY of all ages ( P
6 U* X# s# g1 s! B- X
( A0 m O5 l6 GThe number of V 1a mRNA showed similar pattern of results as was seen in the ligand binding studies with significantly increased numbers of V 1a mRNA in 5- and 10-wk-old SHR compared with age-matched WKY rats ( P 0 [" G3 \! t* ~3 z% l# J1 {
% P. G! ^: `8 w: |Fig. 3. Amount of V 1a mRNA in WKY (5, 10, and 70 wk old) and SHR (5, 10, 20, and 70 wk old) measured by real-time PCR. Values are means ± SE. * SHR significantly higher than all WKY age groups and 20- and 70-wk-old SHR ( P
3 J7 t7 O, B; ?$ c9 n, F: X G- n- _8 v* \& b
Studies on the change in [Ca 2 ] i during stimulation with AVP were performed on 5- and 70-wk-old animals. Figure 4 shows three typical responses in isolated preglomerular vessels after stimulation with AVP in all four groups. The baseline in [Ca 2 ] i was not significantly different, and the [Ca 2 ] i response showed a sharp initial peak followed by a stable plateau that was maintained until the agonist was removed. The initial peak response was significantly higher in 5-wk-old SHR compared with old SHR as well as young and old WKY ( Fig. 5 ). The increase was 234 ± 59 nM Ca 2 i in young SHR, whereas it was 89 ± 9 nM Ca 2 i in 70-wk-old SHR ( P = 0.03). The [Ca 2 ] i increase was higher in 5-wk-old SHR than in 5-wk-old WKY (115 ± 10 nM) and 70-wk-old WKY (82 ± 14 nM; P + A; y5 x# K; Q1 `" e0 F- t
{( x+ x4 W5 s/ G7 J5 |$ q( `Fig. 4. Three representative cytosolic calcium concentration ([Ca 2 ] i ) responses after stimulation of smooth muscle cells from preglomerular resistance vessels with AVP in 5- and 70-wk-old WKY and SHR.
+ n# o2 t$ q! C/ ^' e+ D; }8 ]5 r
Fig. 5. Change in [Ca 2 ] i after AVP stimulation of smooth muscle cells from preglomerular resistance vessels isolated from 5- and 70-wk-old WKY and SHR. Values are means ± SE. Responses from 5-wk-old SHR significantly higher than 5- and 70-wk-old WKY ( P
0 c; ^9 A/ j% |3 G! g2 ?4 O1 _# _5 W" f6 n" R4 m, x
DISCUSSION
' Y& H, m4 l3 [4 F5 L! c0 F
, H/ M4 p) A Z: j9 D" @The main new observation that emerges from the present study is that mRNA and receptor proteins for the V 1a receptor are increased until the age of 10 wk in SHR. At higher ages, the receptor is present in the same amount as in WKY rats where the density of the V 1a receptor stays stable throughout life. A new finding is also the decrease in V 1a mRNA after 10 wk of age in SHR. A striking observation in the present study is the parallel change in V 1a mRNA and receptor proteins in SHR throughout life. A new finding is also that the exaggerated intracellular calcium response after stimulation with AVP found in 5-wk-old SHR is normalized in 70-wk-old SHR. In WKY rats, the magnitude of the intracellular calcium response was similar in both young and old animals.
* d" x) Y, v; Q+ W" g9 I
: ^& E; L) o3 _7 X( R1 NThe result in the present paper confirms previous studies showing an increased V 1a expression at mRNA and receptor protein level in renal preglomerular resistance vessels of young SHR compared with age-matched WKY. The functional consequence of increased receptor density has been demonstrated by an enhanced vasoconstriction in the renal vessels after injection of AVP into the renal artery in 5- to 7-wk-old SHR ( 15 ). Specific antagonists are able to block this response. In addition, exaggerated intracellular calcium signaling has been shown in isolated smooth muscle cells from preglomerular vessels in young SHR, a response that can be inhibited by a specific antagonist ( 23 ). Observations from older animals are few. In an earlier study, we found that infusion of AVP reduced RBF more in young SHR than in 40-wk-old SHR, whereas there was no difference between young and old WKY ( 10 ). Gene expression has not been examined in old animals before and, collectively, our data represent the first comprehensive study where the gene expression and receptor protein for V 1a are studied throughout life in WKY and SHR and where the results are supported by the functional studies demonstrating responses of intracellular calcium signaling that are strictly dependent on level of V 1a receptor density.
2 Q/ N0 V3 f* w& p/ }- q \/ u$ _
4 `. O& W+ F1 a8 \ ?3 xThe role of the V 1a receptor in preglomerular vessels during development of hypertension is unknown. A striking observation in the present study is the normalization of the receptor level when the blood pressure has stabilized and suggests a relationship between receptor level and blood pressure. This finding explains why long-time treatment with V 1a receptor antagonists in young SHR ameliorates the development of hypertension, while this effect was not seen in older SHR ( 4 ). It has earlier been shown that SHR retains salt and water at 5-6 wk of age and the kidneys of these rats are vasoconstricted. Constriction of the afferent arterioles seems to persists at least 10-12 wk of age ( 24 ), whereas the afferent arteriolar diameter increases with age during adaptation to nephron loss in older SHR ( 24 ). The total RBF is usually similar in both WKY and SHR as shown in the present study. It is, however, well known that the renal vasculature is highly responsive to both ANG II and AVP and the enhanced vasoreactivity that is higher in SHR than in WKY may depend on several mechanisms such as excitation-contraction coupling related to receptor types, but receptor densities may also be of major importance. Structural changes in the vessels may play a larger role in the vascular reactivity in old compared with young animals ( 17 ). In our previous work, we demonstrated similar vasoreactivity in 40-wk-old WKY and SHR during injection of AVP into the renal artery ( 10 ). This finding was unexpected as the structural differences are obvious in these two strains at this age. The normalized vasoreactivity to AVP in 40-wk-old SHR may be explained by decreased density of the V 1a receptor in these animals. Normalization of the V 1a density between the age of 10 and 20 wk is supported by Gao et al. ( 18 ). These authors found the V 1a receptor to be equally expressed in 16-wk-old SHR and WKY using Western blotting, a finding that supports the data from the present study where decreased density of V 1a receptor in SHR seems to take place between 10 and 20 wk of age.
1 p1 n0 ~3 ^. e' V0 e1 G8 L, c. K: A+ Y. V5 h6 @! F# N9 g
Previous work showed that two-thirds of the vasoconstrictive response of AVP is due to IP 3 -mediated Ca 2 store mobilization and one-third is due to Ca 2 influx through L-type calcium channels ( 14 ). This is similar for both SHR and normotensive WKY and argues against a defect in the V 1a signal transduction. It is therefore reasonable to suggest that the increased calcium response in young SHR is due to the increased density of V 1a receptors. The increased calcium response in young SHR has been demonstrated before, although the shape of the curve in the present study is different from what we showed earlier ( 23 ). This might be due to temperature differences as the present study was performed at 37° C while earlier work was done at 4° C. Temperature dependence of the calcium response has been shown before, although the reason is not clear ( 44 ). In support of the receptor-dependent response is also the finding of normalized intracellular response in 70-wk-old SHR, where the receptor level was found to be similar as in WKY. The difference in calcium increase was seen only in the initial peak while we were not able to see any difference in the maintained plateau activation in neither the young nor the old animals. The maintained plateau response is mainly dependent on calcium entry mechanisms; one may speculate that entry mechanisms are not changed with age in SHR and may not be different from WKY. It should, however, be added that mechanisms other than receptor density could play a role. Growth factors are known to increase with age, and Bouillier et al. ( 2 ) found an increased ANG II-induced Ca 2 response after pretreatment of smooth muscle cells with transforming growth factor- 1. This increase was related to tyrosine kinase and not to increased receptor density.* _$ h2 t9 G+ B% c4 d
* c6 V1 J. w" X' f& ZSequencing the V 1a gene of rat and sheep displayed the V 1a promoter to have a structure typical of housekeeping genes with the lack of both TATA and CCAAT boxes and a high GC contents ( 28, 31 ). The density of the receptor is, however, tightly regulated to specific tissue types and organs. The renal and hepatic V 1a receptor density in Sprague-Dawley rats is also found to be developmentally regulated ( 36 ). The reason why the V 1a receptor density is changed with age is not known. We recently showed the hepatic and renal V 1a receptors to be regulated by the systemic AVP hormone concentration, with high AVP concentrations eliciting V 1a decreased receptor density and low concentrations of AVP eliciting V 1a an increase in numbers of receptor (unpublished observations). This is common for G protein-coupled receptors. In Sprague-Dawley rats, AVP-mediated vasoconstriction in peripheral nerve blood vessels is shown to have an age-related decline ( 26 ). Aging Sprague-Dawley rats had a significantly higher systemic AVP concentration compared with young animals ( 26 ). The decreased vasoresponsiveness in aged Sprague-Dawley rats could therefor be due to the raised AVP concentration. Risvanis et al. ( 41 ) found a reduced density of hepatic V 1a receptors in DOCA salt-hypertensive rats compared with salt- and water-controlled rats. The mRNA level was unchanged compared with the control animals. The changes in hepatic V 1a receptors were associated by an increased plasma vasopressin concentration. This regulation may be at the protein level, probably by internalization due to the increased receptor stimulation. Renal tubular tissue from old female Wag/Rij rats is shown to have a reduced cAMP response compared with adult animals after AVP stimulation. The V 2 receptor density is age dependent decreased even though the plasma AVP concentration is unchanged ( 27 ). Plasma AVP is difficult to measure due to the fact that only minor treatment may stress the animals to raise the hormonal level. Studies presenting plasma AVP concentrations are therefore contradictory. Hosoya et al. ( 22 ) found the plasma AVP concentration in young WKY and SHR to be almost equal, 1.5 ± 0.09 and 1.0 ± 0.08 pg/ml SHR and WKY, respectively. In 12-wk-old rats, the SHR plasma AVP concentration was increased compared with age-matched WKY, 21.3 ± 8.8 and 2.8 ± 0.2 pg/ml in SHR and WKY, respectively. This is different from Ghaemmaghami et al. ( 19 ), who found an equal plasma AVP concentration in adult SHR and WKY. The increased V 1a density in young SHR therefore seems to be unrelated to the level of plasma AVP. One may speculate that events taken place during pregnancy could explain the increased density of V 1a in early life of SHR. It has, for example, been shown that hypoxia in the uterus is linked to increase in receptor numbers of endothelin receptors that induce pulmonary hypertension in adulthood ( 21, 39, 43 ). The fact that the V 1a receptor density is increased in SHR at a very young age and before the establishment of hypertension makes it possible that this receptor increase might be due to in utero conditions.. i2 p+ ?5 v6 v8 F* T. { y1 y- ?
$ D( i( @% R5 Z5 x
In addition to regulation of receptor protein through transcription and translation, G protein-coupled receptors can also be regulated at the protein level by receptor desensitization and internalization. The stimulated receptor is desensitized through PKC phosphorylation and uncoupling from G proteins by the intracellular protein -arrestin ( 16, 47 ). This protein will also target the receptor to clathrin-coated pits. Internalized receptors will either be recycled or degraded ( 16, 34 ). Our results show V 1a mRNA and protein to be regulated in the same manner in both young and old rats. This is in accordance with the results from our previous study with water-loaded and dehydrated animals (unpublished observations). Other studies with dehydrated rats showed the same pattern of regulation for both V 1a and V 2 receptor regulation ( 37, 45 ). The regulation seems do be done at the mRNA level. This could be done through direct transcription regulations and mRNA stability. Both cyclosporin A treatment and glucocorticoids are known to increase V 1a density ( 11, 32 ) with an increase in both V 1a receptor protein and mRNA numbers. The mRNA increase in both of these occasions is shown to be due to an increased mRNA stabilization and not increased transcription.
- r8 u! X: e4 l
. V/ G/ }: Q; kIn conclusion, the present study shows that receptor protein and mRNA for the V 1a receptor are increased until the age of 10 wk in SHR, but later on the levels of receptor are normalized. Intracellular calcium signaling is strictly dependent on receptor level. The density of V 1a receptors is increased during development of increased blood pressure and normalized when hypertension is established, and these findings suggest a link between development of hypertension and numbers of V 1a receptors in SHR.
: ` Z$ X# ]' n2 E' q3 z 【参考文献】
* \, m; G6 h: h+ `7 f, r& I Aguilera G, Pham Q, and Rabadan-Diehl C. Regulation of pituitary vasopressin receptors during chronic stress: relationship to corticotroph responsiveness. J Neuroendocrinol 6: 299-304, 1994.
1 v' c3 x$ ^# T# {$ T* o- M; d0 a6 u1 \
8 y) O* f Q8 B. ^2 j3 v" K0 P1 T/ l
; V$ w+ p3 j! E3 n1 QBouillier H, Samain E, Miserey S, Perret C, Renaud JF, Safar M, and Dagher G. Transforming growth factor- 1 modulates angiotensin II-induced calcium release in vascular smooth muscle cells from spontaneously hypertensive rats. J Hypertens 18: 733-742, 2000.! B0 [% E+ i/ `. C8 q7 x0 C
( a0 B; d* e+ P! E
' X: Q+ M f9 t: \& {% `
% N* g4 _* m; Z2 ]# K0 YBradford MM. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 72: 248-254, 1976.
+ B8 d% r7 u3 `( H m) ^8 c1 a/ J0 h/ Q& R3 {; v2 l
# N$ T- i5 H" t0 }
/ J. P; Y6 z9 u" CBurrell LM, Phillips PA, Risvanis J, Aldred KL, Hutchins AM, and Johnston CI. Attenuation of genetic hypertension after short-term vasopressin V 1A receptor antagonism. Hypertension 26: 828-834, 1995.
: X8 d' M1 z9 `6 t. x) y; O1 c0 x, [+ m* l
1 S: L4 A8 o/ N$ l1 b( q2 `( _0 I' m
0 C" E& Y% {% }# O& `) [1 m5 C
Butlen D, Guillon G, Rajerison RM, Jard S, Sawyer WH, and Manning M. Structural requirements for activation of vasopressin-sensitive adenylate cyclase, hormone binding, and antidiuretic actions: effects of highly potent analogues and competitive inhibitors. Mol Pharmacol 14: 1006-1017, 1978.
7 _) M, i7 E' U9 Y
: P' C: C8 M! B" |# T4 ^" g5 F: `9 m) R, m$ r1 q
; X0 l( o; U7 ?Chatziantoniou C and Arendshorst WJ. Angiotensin receptor sites in renal vasculature of rats developing genetic hypertension. Am J Physiol Renal Fluid Electrolyte Physiol 265: F853-F862, 1993.9 ^1 M% S. F2 }- v, u+ I
8 p! M8 r3 v2 Q$ D7 K
0 p- w2 W" U, z- B) G& ]5 N) X! b! v- S( j1 n/ y
Chatziantoniou C and Arendshorst WJ. Impaired ability of prostaglandins to buffer renal vasoconstriction in genetically hypertensive rats. Am J Physiol Renal Fluid Electrolyte Physiol 263: F573-F580, 1992.9 f+ u: y2 h( K2 ?
m8 b: E8 D: T" `
1 O G$ a: k$ F+ F; v
5 y5 N% o! Y" X& P p& DChatziantoniou C, Daniels FH, and Arendshorst WJ. Exaggerated renal vascular reactivity to angiotensin and thromboxane in young genetically hypertensive rats. Am J Physiol Renal Fluid Electrolyte Physiol 259: F372-F382, 1990.
9 z0 c6 v) s$ \* Q L; M$ t& a5 x3 C. I' V
% h$ o1 ~$ z1 M6 l) D3 B
2 z$ d" N( L+ Y) E8 [Chatziantoniou C, Ruan X, and Arendshorst WJ. Defective G protein activation of the cAMP pathway in rat kidney during genetic hypertension. Proc Natl Acad Sci USA 92: 2924-2928, 1995.7 {4 A5 w! D2 k' p
C% I" N* o8 l' G: U; ]5 k
5 E' y" z1 C/ T( X7 g
, r8 [8 |) b: [& L4 R x
Christiansen RE, Roald AB, Gjerstad C, Tenstad O, and Iversen BM. Renal hemodynamics in young and old spontaneously hypertensive rats during intrarenal infusion of arginine vasopressin. Kidney Blood Press Res 24: 176-184, 2001.
3 f- U3 T4 O" C s
% t3 z% o3 L( v! k+ r0 C* E3 R9 [' g. M# g* e% h& E5 F5 G/ @7 {
1 x2 l8 x, D; s/ b& B) BCottet-Maire F, Avdonin PV, Roulet E, Buetler TM, Mermod N, and Ruegg UT. Upregulation of vasopressin V 1A receptor mRNA and protein in vascular smooth muscle cells following cyclosporin A treatment. Br J Pharmacol 132: 909-917, 2001.. L, c/ ? K5 t: ~- ^
1 u, d; n, ^0 j4 w0 a& A m
+ B! p( J$ \. C/ T7 I6 a, {2 ~( R1 t
* G# t* i( a* u- c. LCowley AW Jr, Szczepanska-Sadowska E, Stepniakowski K, and Mattson D. Chronic intravenous administration of V 1 arginine vasopressin agonist results in sustained hypertension. Am J Physiol Heart Circ Physiol 267: H751-H756, 1994.
. u7 I$ V( V* }2 @8 T5 S
3 D% M. U6 \, y4 f* R" d+ e- f( s* _; L5 E
8 A+ `/ B4 }: p xCrofton JT, Share L, Shade RE, Lee-Kwon WJ, Manning M, and Sawyer WH. The importance of vasopressin in the development and maintenance of DOC-salt hypertension in the rat. Hypertension 1: 31-38, 1979.1 \ i8 D7 z! n% g5 U
3 j. \) E0 V% ]- d9 Q7 v3 X& D9 j; }2 u( n& v. C
) l# C7 {" f! D+ K; L& a5 h* TFeng JJ and Arendshorst WJ. Calcium signaling mechanisms in renal vascular responses to vasopressin in genetic hypertension. Hypertension 30: 1223-1231, 1997.
! G. h0 C- F5 \! f0 f8 H2 f& V0 n( Y1 N$ r
# c% P" X2 d7 G! B5 l2 l1 O, o0 j: \' q, J) y6 c9 I
Feng JJ and Arendshorst WJ. Enhanced renal vasoconstriction induced by vasopressin in SHR is mediated by V 1 receptors. Am J Physiol Renal Fluid Electrolyte Physiol 271: F304-F313, 1996.
! r5 b0 ^; P W) h/ @2 c- b8 V
, q! z( O& D4 m3 X4 d/ I \ L; r; A/ E- r+ ^& ~( ^
% U$ C5 U( \5 r
Ferguson SS, Downey WE III, Colapietro AM, Barak LS, Menard L, and Caron MG. Role of -arrestin in mediating agonist-promoted G protein-coupled receptor internalization. Science 271: 363-366, 1996.; X2 H4 x6 P( D! F8 ~" F) A
0 z$ H$ x& U- z$ l P) H0 w+ d' B/ H" A x% }% L7 f- z U
r2 @( e" J6 Z' Q2 p4 R0 ]Folkow B. Early structural changes in hypertension: pathophysiology and clinical consequences. J Cardiovasc Pharmacol 22, Suppl 1: S1-S6, 1993.
( ^+ [; K2 \* \% Y) |7 Q. E" L$ H& ?, {
( w: y( E& Q4 i
2 }$ ^. X' t; E l" [, t
$ c& z. W7 q! ^- x3 N& ^4 oGao L, Zhu C, and Jackson EK. 2 -Adrenoceptors potentiate angiotensin II- and vasopressin-induced renal vasoconstriction in spontaneously hypertensive rats. J Pharmacol Exp Ther 305: 581-586, 2003.8 Z# Q% J% A% K7 l* F' n, P* F
0 m% |# L' U; I' R
+ P4 ]. X6 r9 s& {& B G- P, K D$ v- X0 e) E, h3 h% }
Ghaemmaghami F, Allevard AM, Fareh J, Geelen G, and Gharib C. Effects of acute exercise and prolonged exercise training on blood pressure, vasopressin and plasma renin activity in spontaneously hypertensive rats. Eur J Appl Physiol 62: 198-203, 1991.
0 Z' a5 j, |. q, o0 ^" j7 n
$ `, g/ C( e( a3 `0 n E8 T# \! I3 b% z- ^! J8 w, L/ {
3 w- M, x* _$ n, q' ^
Grynkiewicz G, Poenie M, and Tsien RY. A new generation of Ca 2 indicators with greatly improved fluorescence properties. J Biol Chem 260: 3440-3450, 1985.
& M0 E' ^# f# c; S9 ]9 _# v8 `$ @/ n* m; f( [' g; \
4 S) ~! r$ f) m) e) v4 a6 v
4 ]- i8 O; w! t2 D( KHampl V and Herget J. Perinatal hypoxia increases hypoxic pulmonary vasoconstriction in adult rats recovering from chronic exposure to hypoxia. Am Rev Respir Dis 142: 619-624, 1990.
0 n5 B7 [' T0 x3 I+ M4 O' x- X& W* i; A/ U2 W/ B3 B8 @
. d$ U# m3 R- E; g' L! Q8 |, ?, O
% _7 E5 V6 D7 r, t3 a, wHosoya M, Ogura T, Watanabe H, Ota Z, and Kageyama Z. Autoradiographic localization and age-related changes in vasopressin receptors in spontaneously hypertensive rats. Nephron 72: 281-287, 1996./ R5 N% }# N# P) D2 g7 a/ E5 S
' B5 }$ h4 e. J
/ m# D: B, m0 ], f, p) a8 }6 J
1 y0 P5 s; k3 ~1 E9 P8 R; l/ U% ~( _* uIversen BM and Arendshorst WJ. Exaggerated Ca 2 signaling in preglomerular arteriolar smooth muscle cells of genetically hypertensive rats. Am J Physiol Renal Physiol 276: F260-F270, 1999.- T& z( [ M. @! p" l9 h8 x+ Z
8 N4 c5 s5 I3 Z8 ^ |8 D5 d
# |4 q& B- ^; c/ c7 F" J. i
7 W' F3 _ ~! `# bIversen BM, Kvam FI, Morkrid L, Sekse I, and Ofstad J. Effect of cyclooxygenase inhibition on renal blood flow autoregulation in SHR. Am J Physiol Renal Fluid Electrolyte Physiol 263: F534-F539, 1992., z6 l3 A k3 X+ w8 A) [
, d5 Q' r+ f9 g9 _0 N9 A" |
% q y3 N2 P4 v( i; r+ N2 A# _
5 ~: L/ H) v4 o( EJohnston CI. Vasopressin in circulatory control and hypertension. J Hypertens 3: 557-569, 1985.$ _ ?* T7 t9 g! O, Q
2 m n9 H0 Y0 j& \5 c
+ V. I( J3 Y% @8 ^, H
( Z$ {& O1 d" R% {9 J" N. `
Kihara M, Shioyama M, Okuda K, and Takahashi M. The impact of aging on vasa nervorum, nerve blood flow and vasopressin responsiveness. Can J Neurol Sci 29: 164-168, 2002.% l& X8 q' b v
/ b, [# Q/ | J4 }. J: p
. u$ z2 L- h/ A' m+ e3 x' {; h( v. k! X4 o1 i$ S6 h8 O" {
Klingler C, Preisser L, Barrault MB, Lluel P, Horgen L, Teillet L, Ancellin N, and Corman B. Vasopressin V 2 receptor mRNA expression and cAMP accumulation in aging rat kidney. Am J Physiol Regul Integr Comp Physiol 272: R1775-R1782, 1997.
% a6 z2 H% E. x$ k8 i
9 \+ J! A; Y6 Q, g6 y7 L2 v' B
( c/ \$ W4 r, g
% Y. F" \8 u! @Koukoulas I, Webb GC, Bottema CD, Gill C, Johnston CI, and Aldred GP. Genomic characterization of the sheep vasopressin V 1a receptor gene and promoter, with assignment to bands q23-24 of sheep chromosome 3 and cattle chromosome 5. Gene 240: 183-192, 1999.
+ }$ A( K9 c) U! c( J- R) d) ]. h8 M# F# }* ?4 ~% C
) h4 p* e; g9 ] ]3 X l
5 Q1 h3 _$ [, R% f+ c) P+ J ]
Loutzenhiser K and Loutzenhiser R. Angiotensin II-induced Ca 2 influx in renal afferent and efferent arterioles: differing roles of voltagegated and store-operated Ca 2 entry. Circ Res 87: 551-557, 2000.( o2 a# L- n; z+ D% m( E1 L( I
* \* R K( |- m% }1 y5 j
3 Z% W9 f. s a Z Z: I/ m6 _
! b; s) m2 F7 e! W- g, p5 C |6 KMorel A, O'Carroll AM, Brownstein MJ, and Lolait SJ. Molecular cloning and expression of a rat V 1a arginine vasopressin receptor. Nature 356: 523-526, 1992.& B' j1 K4 g- i; s
( q9 p" s# L( C/ v' I% ~+ ~! y2 }+ p; g3 K$ [. S. A7 g- b I
, w1 j$ ?! F# i' x) G
Murasawa S, Matsubara H, Kijima K, Maruyama K, Mori Y, and Inada M. Structure of the rat V 1a vasopressin receptor gene and characterization of its promoter region and complete cDNA sequence of the 3'-end. J Biol Chem 270: 20042-20050, 1995.
- K# z) ^. `, M/ w' G% h& x+ y% a$ t- o
; l* b7 @" _; s8 u7 @" r
7 d" R# u( L% W3 s* {: f
Murasawa S, Matsubara H, Kizima K, Maruyama K, Mori Y, and Inada M. Glucocorticoids regulate V 1a vasopressin receptor expression by increasing mRNA stability in vascular smooth muscle cells. Hypertension 26: 665-669, 1995.& J. o( [/ q( \1 C' z
4 O! @ x; V* ~# I% ]6 G% \ \
2 Q& J# K8 x/ ~" u' l& v0 N& }! c e; k8 I
Naitoh M, Burrell LM, Risvanis J, Aldred KL, Rockell MD, Johnston CI, and Phillips PA. Modulation of genetic hypertension by short-term AVP V 1A or V 2 receptor antagonism in young SHR. Am J Physiol Renal Physiol 272: F229-F234, 1997.7 d1 b0 [& m8 c7 g! d
" [% q0 {6 c! ]* j/ s& u7 u; H" n$ {* _* K) R8 T1 `
# ?. G- L, Z7 [' ]1 dOakley RH, Laporte SA, Holt JA, Barak LS, and Caron MG. Association of -arrestin with G protein-coupled receptors during clathrin-mediated endocytosis dictates the profile of receptor resensitization. J Biol Chem 274: 32248-32257, 1999.& ` {! J3 I$ T$ Z1 v" \ Y
7 N. V: G$ l- `- u) [0 L
% J& d/ x1 F) S+ s8 n. e! N
5 P8 a$ u+ f2 [$ j; h( y# Z IOstrowski NL, Lolait SJ, and Young WS III. Cellular localization of vasopressin V 1a receptor messenger ribonucleic acid in adult male rat brain, pineal, and brain vasculature. Endocrinology 135: 1511-1528, 1994.) J( u8 Q" C; f
; n+ }5 A1 |8 L- Y" A0 }. D9 u W$ I- J
+ D$ g- N1 m- @4 T! A+ COstrowski NL, Young WS, Knepper MA, and Lolait SJ. Expression of vasopressin V 1a and V 2 receptor messenger ribonucleic acid in the liver and kidney of embryonic, developing, and adult rats. Endocrinology 133: 1849-1859, 1993.: q5 t! S' L/ D/ n# S1 m& A
9 ~. y2 {, z$ W% _
* l7 L7 b2 k4 x. F! C2 |) k
9 [' X* k0 ^' U. w9 ^0 jPark F, Koike G, and Cowley AW Jr. Regional time-dependent changes in vasopressin V 2 receptor expression in the rat kidney during water restriction. Am J Physiol Renal Physiol 274: F906-F913, 1998.& D1 F( f$ E0 v. |, V$ Q4 Q, U; V
& B6 ~, e' ?0 C: E) X2 w( R$ i# Q
1 b& j+ `7 h c/ v& ^5 j. W. y1 l1 z2 x3 H- H' z0 H [3 c
Park F, Mattson DL, Skelton MM, and Cowley AW Jr. Localization of the vasopressin V 1a and V 2 receptors within the renal cortical and medullary circulation. Am J Physiol Regul Integr Comp Physiol 273: R243-R251, 1997.
. m( N6 n. f, D( E% p! t7 h9 K8 Q& f
; Y: M9 y( t, u4 L* U) I5 B5 r+ X$ n. o
Perreault T and Coceani F. Endothelin in the perinatal circulation. Can J Physiol Pharmacol 81: 644-653, 2003.& n5 ]( W, v+ A( s m
. l' W2 o1 b+ C" n7 i" Y! ^" ]! T# Q* m3 m+ T
& a3 H8 g$ Z* f: {: K5 U- h( l
Phalipou S, Cotte N, Carnazzi E, Seyer R, Mahe E, Jard S, Barberis C, and Mouillac B. Mapping peptide-binding domains of the human V 1a vasopressin receptor with a photoactivatable linear peptide antagonist. J Biol Chem 272: 26536-26544, 1997.! o: u! ]. t$ ^3 L* h2 F. A, n
) W: J+ ?2 N1 j# ~. ~$ a
4 t' M/ S9 ]( _; R2 z( o
# r1 u( ] l# k" a1 ~
Risvanis J, Johnston CI, Phillips PA, and Burrell LM. Vasopressin V 1a and V 2 receptor mRNA in deoxycorticosterone acetate-salt hypertension in the rat. Clin Sci (Colch) 94: 517-523, 1998.
M7 i G4 D( W1 I$ }& L* U8 T4 H6 `4 E. C- n! ]. j- g/ ?+ p
7 m: d1 F' f6 n/ J3 }" K' I
\) b: W) y* y( ESampey DB, Burrell LM, and Widdop RE. Vasopressin V 2 receptor enhances gain of baroreflex in conscious spontaneously hypertensive rats. Am J Physiol Regul Integr Comp Physiol 276: R872-R879, 1999.
: W! S3 e% P p5 J5 L' ?$ b, w+ ^4 t( l) q1 \
/ W! a! U! s' _) l4 P- D- O; r
. X6 r4 V5 [5 d8 j$ t
Sartori C, Allemann Y, Trueb L, Delabays A, Nicod P, and Scherrer U. Augmented vasoreactivity in adult life associated with perinatal vascular insult. Lancet 353: 2205-2207, 1999.
' L9 c. ^" B: @, c# @0 }& U2 f+ M/ q1 G% J7 t" N- Z. {3 Y# E
% m" ^# H# x+ p, u. H( U. T
: S. j O$ A3 F! C( j$ ^; P% `- h
Shuttleworth TJ and Thompson JL. Effect of temperature on receptor-activated changes in [Ca 2 ] i and their determination using fluorescent probes. J Biol Chem 266: 1410-1414, 1991.
+ u) V- L0 R3 J4 f& @- t2 f
5 @ }" z. {) w/ p1 q5 _0 I- m& f4 I5 h# s) S6 a
! j. ]/ r" p5 A9 @$ {
Tashima Y, Kohda Y, Nonoguchi H, Ikebe M, Machida K, Star RA, and Tomita K. Intranephron localization and regulation of the V 1a vasopressin receptor during chronic metabolic acidosis and dehydration in rats. Pflügers Arch 442: 652-661, 2001.
' _% B% ~( e0 e, h F8 _5 ^# s( i2 I% c. L
; A7 M- R5 {: T1 o, ]' c$ \
) J# }) ]8 [+ ?5 C# ~2 |* ]Vagnes O, Feng JJ, Iversen BM, and Arendshorst WJ. Upregulation of V 1 receptors in renal resistance vessels of rats developing genetic hypertension. Am J Physiol Renal Physiol 278: F940-F948, 2000.
6 w' H0 R+ J. w) i( v+ u/ H6 } K
# X, ]) n$ j/ N7 E3 S7 ]5 s6 q0 E7 S
* a6 t4 X8 p: b6 i2 PZhang J, Barak LS, Winkler KE, Caron MG, and Ferguson SS. A central role for -arrestins and clathrin-coated vesicle-mediated endocytosis in 2 -adrenergic receptor resensitization. Differential regulation of receptor resensitization in two distinct cell types. J Biol Chem 272: 27005-27014, 1997. |
|