Osmolality and solute composition are strong regulators ofAQP2 expression in re - 《American Journal of Physiology》美国生理学杂志干细胞之家



免疫细胞治疗专区	欢迎关注干细胞微信公众号

12 3 4 5 6 7 8 9 10 ... 25 下一页

返回列表

查看: 546036\|回复: 241	go Osmolality and solute composition are strong regulators ofAQP2 expression in re [复制链接]

轻羽

新手上路

Rank: 1

积分: 0
威望: 0
包包: 0

楼主

发表于 2009-4-21 13:25 |只看该作者 |倒序浏览 |打印

作者：R.Storm, E.Klussmann, A.Geelhaar, W.Rosenthal,  K.Maric作者单位：1 Forschungsinstitut für MolekularePharmakologie, Campus Berlin-Buch, 13125 Berlin; and Freie Universität Berlin, Institut fürPharmakologie, 14195 Berlin, Germany
   1 s# b2 p3 y- ]5 J: Y) d3 t+ E

      ; O: S3 i7 ?4 Q/ G9 S# ]" r
                     * J: ~7 ?7 `# i/ O/ T8 q% T

         ( \/ `8 P- B. _" s



      ' k# o6 |7 l& _" Q' Z


      【摘要】" E* w+ r1 n9 O
   The water permeability of the renalcollecting duct is regulated by the insertion of aquaporin-2 (AQP2)into the apical plasma membrane of epithelial (principal) cells. Usingprimary cultured epithelial cells from the inner medulla of rat kidney(IMCD cells), we show that osmolality and solute composition are potentregulators of AQP2 mRNA and protein synthesis, as well as the classicalcAMP-dependent pathway, but do not affect the argininevasopressin-induced AQP2 shuttle. In the presence of the cAMP analogdibutyryl cAMP (DBcAMP, 500 µM), NaCl and sorbitol, but not urea,evoked a robust increase of AQP2 expression in IMCD cells, with NaClbeing far more potent than sorbitol. cAMP-responsive element-bindingprotein phosphorylation increased with DBcAMP concentrations but wasnot altered by changes in osmolality. In the rat and human AQP2promoter, we identified a putative tonicity-responsive element. Weconclude that, in addition to the arginine vasopressin/cAMP-signalingcascade, a further pathway activated by elevated effective osmolality(tonicity) is crucial for the expression of AQP2 in IMCD cells, and wesuggest that the effect is mediated via the tonicity-responsive element.
      【关键词】 osmolality aquaporin kidney gene regulation toxicityresponsive enhancer
   INTRODUCTION
( ]- U% W5 ?6 p4 A7 e! }
THE WATER CHANNEL aquaporin-2 (AQP2), expressed in epithelial (principal)cells of renal collecting ducts, is required for thevasopressin-dependent concentration of urine ( 7 ). AQP2 abundance increases from the kidney cortex to the inner region of thekidney medulla ( 29 ), as does osmolality. The waterpermeability of the inner medullary collecting duct (IMCD) is rapidlyregulated (within minutes) by the antidiuretic hormone argininevasopressin (AVP), which binds to heptahelical vasopressinV 2 receptors (V 2 R), located mainly in thebasolateral plasma membrane of principal cells. Activation of theV 2 R causes stimulation of adenylyl cyclase via the Gprotein G S, leading to elevation of cAMP. The subsequent activation of protein kinase A (PKA) initiates the translocation ofAQP2-bearing vesicles from the cytosol to the plasma membrane, in whichAQP2 is inserted by an exocytosis-like process (short-term regulation)(D. Lorenz, A. Krylov, V. Hagen, J. Zipper, W. Rosenthal, P. Pohl, andK. Maric, unpublished observations; 30). In addition, the signalingcascade described above governs the expression of AQP2 (long-termregulation) by PKA-mediated phosphorylation of the transcription factorcAMP-responsive element (CRE)-binding protein (CREB) ( 13, 16 ). Given the fact that AQP2 biosynthesis is usually shut offshortly after IMCD cells are established in primary culture( 10 ), most studies on AQP2 long-term regulation have beenperformed using animal models ( 29, 37 ). We recently established primary cultured IMCD cells as a model system ( 17, 18, 21, 22 ). These cells exhibit sustained AQP2 expression whengrown in hyperosmotic medium (600 mosmol/l) in the presence of 500 µMdibutyryl cAMP (DBcAMP). Thus this cell model allows the investigationof isolated aspects of kidney function: the short- and/or long-termregulation of AVP-mediated water reabsorption in IMCD cellsendogenously expressing AQP2.4 W8 R5 M8 V9 u1 |8 O

Several studies have provided evidence for aV 2 R/cAMP-independent regulation of AQP2 expression. In ratsthe downregulation of AQP2 expression by V 2 R antagonisttreatment was reversed by subjecting the animals to thirst( 24 ). In addition, senescent (30-mo-old) rats exhibited asignificantly decreased AQP2 expression and papillary osmolalitycompared with younger (10-mo-old) animals, while papillary cAMPremained unaffected ( 32 ).

Taking advantage of our cell culture system, we investigated the roleof extracellular osmolality and solute composition in the long-termregulation of AQP2. We examined whether these effects are mediated bythe transcription factor CREB or whether other, possiblycAMP-independent, pathways are involved.4 T$ c4 c9 O- ^8 b( N

MATERIALS AND METHODS% Z( G( L+ K9 h; }# h8 _( B7 ]

Cell culture. IMCD primary cultures were prepared as described previously( 21 ). Renal inner medullae of Wistar rats (2-3 moold; both sexes) were the source of primary cultured IMCD cells. Allmedia were based on Dulbecco's modified Eagle's medium (containing110 mmol/l NaCl and 300 mosmol/l) routinely supplemented with 500 µM DBcAMP, 4.5% glucose, and 1% serum substitute Ultroser (Life Technologies, Karlsruhe, Germany) instead of 10% FCS. This basic medium, termed 300N, contained 500 µM DBcAMP (if not indicated otherwise) for the maintenance of AQP2 expression. Media of elevated osmolalities (600 and 900 mosmol/kgH 2 O after equimolaraddition of NaCl and urea) were termed 600N and 900N, respectively, or, if sorbitol was used to elevate osmolality, 600S and 900S. Media elevated to 600 mosmol/kgH 2 O with different concentrationsof NaCl and/or urea were termed 600U 0/300, 600NaCl/U 50/200, and 600NaCl 150/0 [numbers before and after the slashes indicateconcentrations (in mM) of NaCl and urea, respectively, added to 300N].When only NaCl was used to elevate medium osmolality, the amounts ofNaCl added to 300N and the osmolality of the medium are indicated. Thecells were seeded at a density of ~10 5 /cm 2 in600N to select for IMCD cells. At 1 day after seeding, this routineculture medium was replaced by the desired culture medium. Confluentcells were harvested for diverse analysis 6-7 days later. WT-10cells [Madin-Darby canine kidney (MDCK) cells that were stablytransfected with AQP2 construct, driven by cytomegalovirus (CMV)promoter ( 6 )] were cultured without DBcAMP in 300N with 5% FCS and passaged every 4-5 days. At 6 days before membrane preparation, WT-10 cells were split 1:10 and seeded on culture dishesin 300N or 600N.. O4 E9 x. [- Q5 h
0 \0 I% @7 a6 E  I1 g- l9 }& G$ }
Protein preparations and Western blot analysis. All procedures were performed at 4°C. Cells cultured in60-mm-diameter culture dishes were rinsed twice with ice-coldphosphate-buffered saline (PBS), scraped off the culture dishes, andhomogenized in 1.5 ml of ice-cold PBS with a glass-Teflon homogenizer(10 strokes, 750 rpm). For membrane preparations, the homogenates werecentrifuged at 800 g for 5 min to remove nuclei and debris; the supernatant was centrifuged at 200,000 g for 1 h,and the resulting pellet (membrane fraction) was resuspended inice-cold PBS. Samples (15 µg) were subjected to SDS-PAGE (12瑀ylamide in separating gels). Cells grown on 24-well plates (2 cm 2 /well) were rinsed twice with ice-cold PBS and lysed inmodified Laemmli buffer [40 µl/well; 4% (wt/vol), instead of 2%,SDS] by incubation at room temperature for 18 h. The solubilizedmaterial was then sonicated (Sonopuls UW 2070, Bandelin Electronic,Berlin, Germany) for 5 s at 40% power to shear chromosomal DNAand subjected to SDS-PAGE (total homogenate from 1 cm 2 ofconfluent cell monolayer was loaded per lane onto 12%SDS-polyacrylamide gels). Size-separated proteins were transferred tonitrocellulose filters (Optitran, Schleicher & Schuell, Dassel,Germany). Protein transfer and equal loading were verified by Ponceaured staining (not shown).

Filters were blocked for 1 h in blocking buffer [Tris-bufferedsaline Tween (TBST) containing 5% (wt/vol) low-fat drymilk], incubated with the desired primary antibodies, and subsequently washed in TBST (5 times for 8 min each). As primary antibodies, rabbitpolyclonal antiserum against AQP2 ( 20 ), which, in addition to AQP2, also detects the histone H2A1 ( 14 ), was used at adilution of 1:1,500 in blocking buffer for 1 h at roomtemperature, and rabbit polyclonal antiserum against phosphorylatedCREB diluted 1:500 in TBST containing 5% BSA (New England Biolabs,Frankfurt am Main, Germany) was used overnight at 4°C. As secondaryantibodies, peroxidase-coupled goat anti-rabbit F (a/b) fragments (Dianova, Hamburg, Germany) were used (1:2,000 in blockingbuffer, 1 h at room temperature). Blots were washed five times for8 min each in TBST and then incubated for 5 min in Lumi-Light solution(Roche Diagnostics, Mannheim, Germany). Chemiluminescence wasvisualized and band densities were quantified using a Lumi-Imager F1(Roche Diagnostics, Mannheim, Germany). Results (means ± SE) areexpressed as percentage of control signal intensity. Statisticalevaluation was carried out by ANOVA, using GraphPad Prism software(GraphPad Software, San Diego, CA). GraphPad Prism software was alsoused to perform nonlinear regression analysis on the data obtained intime-course experiments.

Northern blot analysis. Total RNA was prepared from IMCD cells grown in 60-mm culture dishesusing TRIzol reagent (GIBCO-BRL, Karlsruhe, Germany). Northern blotanalysis with 15 µg of total RNA was essentially performed asdescribed previously ( 12 ). Hybridization was carried outusing 32 P-labeled rat AQP2 cDNA (labeled according to themanufacturer's instructions; Megaprime DNA Labeling Kit, AmershamPharmacia Biotech, Freiburg, Germany). For standardization of AQP2 mRNAsignals, blots were rehybridized with a 32 P-labeled (44-bp)cDNA fragment specific for rat 18S rRNA (5' ACGAATGCCCCCGGCCGTCCCTCTTAATCATGGCCTCAGT TCCG 3'; terminal transferase end-labeled according to manufacturer's instructions; Boehringer, Mannheim, Germany). Signals were visualized using a STORM 830 PhosphorImager and quantified using Image Quant 5.1 software (Amersham Pharmacia Biotech). For semiquantitative analysis, band densities forAQP2 mRNA were standardized to the corresponding 18S rRNA signals.Standardized signals (means ± SE) are expressed as percentage ofcontrol signal intensity (IMCD cells cultivated in 600N) for each setof experiments. Statistical evaluation was carried out by ANOVA usingGraphPad Prism software.% T( ?. @' l9 j, p5 X

Sequence searches and alignments. DNA sequences for the human and rat AQP2 promoters were obtained byusing the National Center for Biotechnology Information nucleotidesearch. Alignments were performed using GeneTool software (version 1.0, BioTools).

Immunofluorescence studies. Immunofluorescence experiments for the detection of AQP2 in IMCD cellswas essentially performed as previously described ( 21 ). AQP2 was detected by fluorescence microscopy (Leica DMLB microscope with Sensicam 12 Bitled charge-coupled device camera, Bensheim, Germany) using rabbit polyclonal anti-AQP2 antibodies andCy3-conjugated anti-rabbit secondary antibodies (Dianova).
  q) i+ t8 L8 x" @2 i8 N  ]- q
RESULTS
9 l4 p6 D# d; J5 _1 j
AQP2 protein expression is stimulated by DBcAMP. Figure 1 A shows arepresentative AQP2 immunoblot analysis of total homogenates derivedfrom IMCD cells cultured for 6 days in 24-well plates. The analysis oftotal homogenates derived from IMCD cells grown in 24-well plates wasfavored over membrane preparations, because the latter require 10 timesmore cells and, thus, animals. Another advantage to using totalhomogenates is that histone H2A1, a nuclear protein detected therein bythe anti-AQP2 antiserum ( 14 ), can be used as a marker tocompare cell numbers and amounts of protein loaded per lane. Cells weregrown in 600N supplemented with 5 µM, 50 µM, 200 µM, 500 µM(control), 2 mM, and 5 mM DBcAMP, a membrane-permeable cAMP analog. Theresults are summarized in Fig. 1 B. DBcAMP stimulated AQP2expression in a dose-dependent manner; its maximum effect was at 200 and 500 µM. Higher concentrations led to a decrease in AQP2expression, while cell morphology, assessed by transmission microscopy,remained unchanged (not shown). These findings suggest that DBcAMP canaffect AQP2 expression bidirectionally in IMCD cells grown in 600N.DBcAMP at 500 µM, also used in previous studies ( 17, 18, 21, 22 ), yielded maximal AQP2 expression in IMCD cells grown in 600Nand was therefore routinely employed in experiments designed toidentify pathways other than the cAMP-dependent pathway.
/ O0 ?! C) F: o
Fig. 1. Effect of dibutyryl cAMP (DBcAMP) on aquaporin-2 (AQP2)protein levels in inner medullary collecting duct (IMCD) cells. IMCDcells were cultured for 6 days in 24-well plates containing medium inwhich osmolality was elevated to 600 mosmol/kgH 2 O with NaCland urea (600N) supplemented with 5 µM, 50 µM, 200 µM, 500 µM(control), 2 mM, and 5 mM DBcAMP. A : AQP2 [glycosylated (g)and nonglycosylated (ng)] and histone H2A1 detected by immunoblottingwith anti-AQP2 antiserum. Per lane of an SDS-polyacrylamide gel, totalhomogenate (protein) from 1-cm 2 confluent cell monolayerwas loaded. B : densitometric analysis of AQP2 protein levels(glycosylated and nonglycosylated). Values are means ± SE( n = 4). * P

AQP2 protein expression is dependent on elevated osmolality andaltered by solute composition. Increased AQP2 expression in rats is induced by water deprivation,despite chronic administration of V 2 R antagonists( 24, 30 ), possibly as a consequence of increased medullaryosmolality derived from urea and NaCl. We therefore tested whethercAMP-stimulated AQP2 expression is altered by increased mediumosmolality derived from elevated NaCl, urea, or sorbitol concentration.Media supplemented solely with sorbitol were used to distinguish theeffects of elevated osmolality from the effects of NaCl and urea.Figure 2 A shows arepresentative AQP2 immunoblot analysis of total homogenates from IMCDcells cultured in 24-well plates for 6 days in 300N, 600S, 600N(control), 900S, and 900N. The results are summarized in Fig. 2 B. For IMCD cells cultivated in 300N, only weak AQP2 signals were detectable. An elevation of medium osmolality to 600 mosmol/kgH 2 O by the addition of sorbitol (600S) clearlyincreased AQP2 protein expression. Maximal AQP2 expression, however,was achieved when equimolar NaCl and urea were used to elevate medium osmolality to 600 mosmol/kgH 2 O (as in 600N). A furtherelevation of the osmolality to 900 mosmol/kgH 2 O bysorbitol (900S) drastically reduced AQP2 expression, whereas AQP2expression was only slightly reduced when NaCl and urea were employed(900N). These results indicate that osmolality and a specific action ofNaCl and urea determine the level of AQP2 protein expression in IMCDcells.
) s* |' e5 S1 o" h
Fig. 2. Dependence of AQP2 expression on elevated osmolality andsolute composition. IMCD cells were cultured for 6 days in 24-wellplates in the presence of 500 µM DBcAMP in basal medium (300N),medium in which osmolality was elevated to 600 mosmol/kgH 2 Owith sorbitol (600S), 600N (control), medium in which osmolality waselevated to 900 mosmol/kgH 2 O with sorbitol (900S), andmedium in which osmolality was elevated to 900 mosmol/kgH 2 Owith NaCl and urea (900N). A : AQP2 and histone H2A1 detectedby immunoblotting with anti-AQP2 antiserum. Per lane of anSDS-polyacrylamide gel, total homogenate (protein) from1-cm 2 confluent cell monolayer was loaded. B :densitometric analysis of AQP2 protein levels (glycosylated andnonglycosylated). Values are means ± SE ( n = 8).* P
8 ~" x  x& y- Q& S" j
Osmolality changes do not influence AQP2 protein expression inWT-10 cells stably transfected with AQP2. MDCK cells stably expressing human AQP2 under the control of a CMVpromoter (WT-10 cells) ( 6 ) and IMCD cells were exposed to300N and 600N. Figure 3 A showsa representative immunoblot of total membrane preparations derived fromWT-10 and IMCD cells. The results are summarized in Fig. 3 B.The data indicate that the CMV promoter-governed expression of AQP2 inWT-10 cells is not affected by changes in osmolality. In contrast, AQP2expression in IMCD cells increased with increasing osmolality (Fig. 2 ).These findings suggest that the AQP2 gene's natural promoter isrequired for an effect of osmolality on AQP2 expression.% M* @+ U3 ?* ^/ S8 Y1 U
- V0 H4 y( z9 `7 g; I7 |$ ?+ @
Fig. 3. Comparison of the effect of osmolality and solutecomposition on Madin-Darby canine kidney (MDCK1) cells stablyexpressing AQP2 (WT-10 cells) and IMCD cells. WT-10 cells are stablytransfected with AQP2; its expression is controlled by acytomegalovirus (CMV) promoter ( 6 ). Cells were culturedfor 6 days in 300N or 600N (control). A : AQP2 detected byimmunoblotting with anti-AQP2 antiserum in membrane preparations. Perlane of an SDS-polyacrylamide gel, 15 µg of membrane protein wereloaded. B : densitometric analysis of AQP2 protein levels ofWT-10 ( n = 3) and IMCD ( n = 6) cells.Values are means ± SE. * P
) d& o8 K, C9 G5 ?& G  A4 ~
AQP2 mRNA expression is regulated by osmolality and solutecomposition. To investigate whether the above-described changes in AQP2 proteinlevels result from corresponding changes in AQP2 mRNA levels, Northernblot experiments were performed. We used RNA preparations from IMCDcells cultured in 300N, 600S, 600N (control), 900N (Fig. 4 A ), and 900S (Fig. 4 B ). Figure 4 C summarizes AQP2 mRNA signals. Thechanges in the mRNA level correspond closely to the changes in theprotein level. Thus osmolality and solute composition regulate AQP2expression, most likely on the transcriptional level.0 p/ ^, t9 x# m: k- m) z

Fig. 4. Regulation of AQP2 mRNA expression by osmolality andsolute composition in IMCD cells. IMCD cells were cultured for 6 daysin the presence of 500 µM DBcAMP and 300N, 600S, 600N (control), or900N ( A ) and 600N (control) or 900S ( B ). TotalRNA was isolated, and Northern blots (15 µg of total RNA per lane)were performed. AQP2 mRNA was detected with 32 P-labeledAQP2 cDNA. Blots were stripped and reprobed with a 32 P-labeled cDNA fragment specific for 18S rat rRNA fordetection of 18S rRNA. Results are from 2 independent experiments perculture condition. C : densitometric analysis of AQP2 mRNAlevels from 4 independent experiments. Values for AQP2 mRNA signals(means ± SE; n = 4) were standardized tocorresponding 18S rRNA signals. * P
" k  Y' k+ g, U- {
CREB phosphorylation is stimulated by DBcAMP. The promoter region of the AQP2 gene contains a CRE, known to beinvolved in the AVP-induced AQP2 expression ( 13, 25 ). CREB, once phosphorylated at Ser 133 (pCREB) by PKA, bindsto the CRE and, thereby, presumably stimulates AQP2 transcription. Weperformed Western blot experiments to examine whether DBcAMP increasesthe level of pCREB in IMCD cells. Cells were cultured for 6 days in600N supplemented with 5 µM, 50 µM, 500 µM (control), 2 mM, and 5 mM DBcAMP. Figure 5 A shows arepresentative Western blot analysis of total homogenates of IMCD cellsprobed with a specific antiserum against pCREB and the same blot probed for the histone H2A1. The results are summarized in Fig. 5 B.The level of pCREB in IMCD cells increased with DBcAMP concentrations in the culture medium.- f2 ^$ A- @: R" d8 P) r
& q! Q# r5 f, f# O" i1 I# E
Fig. 5. Effect of DBcAMP on phosphorylation of cAMP-responsiveelement-binding protein (CREB) in IMCD cells. IMCD cells were culturedfor 6 days in 24-well plates containing 600N supplemented with 5 µM,50 µM, 200 µM, 500 µM (control), 2 mM, and 5 mM DBcAMP. A,top : Ser 133 -phosphorylated CREB (pCREB) detected byimmunoblotting with anti-pCREB antiserum. Per lane of anSDS-polyacrylamide gel, total homogenate (protein) from1-cm 2 confluent cell monolayer was loaded. A,bottom : histone H2A1 detected by incubation with anti-AQP2antiserum. B : densitometric analysis of pCREB proteinlevels. Values are means ± SE ( n = 4).

DBcAMP-induced CREB phosphorylation is not affected by changes inosmolality and solute composition. We next assessed whether osmolality and solute composition alter theamount of pCREB in IMCD cells grown for 6 days in the presence of 500 µM DBcAMP, thereby regulating the expression of AQP2. Figure 6 A shows a representativeWestern blot analysis of total homogenates of IMCD cells probed with aspecific antiserum against pCREB and the same blot probed for thehistone H2A1. The results are summarized in Fig. 6 B. Nosignificant effects of osmolality or solute composition onphosphorylation of CREB were observed.
) N6 N! V9 r) e7 \- z% ^+ b
Fig. 6. Independence of DBcAMP-induced CREB phosphorylation byalterations in osmolality and solute composition. IMCD cells werecultured for 6 days in 24-well plates containing 300N, 600S, 600N(control), 900S, and 900N in the presence of 500 µM DBcAMP. A,top : pCREB detected by immunoblotting with anti-pCREB antiserum.Per lane of an SDS-polyacrylamide gel, total homogenate (protein) from1-cm 2 confluent cell monolayer was loaded. A,bottom : histone H2A1 detected by incubation with anti-AQP2antiserum. B : densitometric analysis of pCREB proteinlevels. Values are means ± SE ( n = 8). Valueswere not statistically different from controls.
/ \& j! d5 D1 s( n
Kinetics of AQP2 regulation in response to hyper- and hyposmoticchallenge provide evidence for an involvement of a tonicity enhancerelement identified in the AQP2 promoter. To show that the effects of hyper- and hyposmotic challenge on AQP2expression are reversible and to assess the time courses of increaseand decrease in AQP2 expression, we performed the experiments describedbelow. To analyze the time course of upregulation in response to ahyperosmotic challenge, IMCD cells were seeded in 600N that was changed24 h later to 300N (except for controls). Starting 72 h afterthe shift, cells were exposed to 600N for 72, 48, 24, and 6 hbefore lysis. Figure 7 A showsthe densitometric analysis of AQP2 expression levels as measured byWestern blot analysis. Nonlinear regression analysis suggests that theAQP2 expression started to increase with a lag time of ~15 h after exposure to hyperosmolality. The AQP2 expression level of IMCD cellskept for 72 h in 300N (see also Fig. 7 B ) increased in600N within 72 h to ~75% of that of controls (cellscontinuously cultured in 600N, 168-h time point). To analyze the timecourse of AQP2 downregulation in response to hyposmotic challenge,cells were seeded in 600N that was changed to 300N (except forcontrols) for 144, 72, 48, 24, 6, and 3 h before lysis. Figure 7 B shows the densitometric analysis of AQP2 expressionlevels as detected by Western blot analysis. A downregulation of AQP2protein expression in response to hyposmolality was detectable after6 h. Thereafter, AQP2 expression continued to decrease and droppedto baseline levels 72 h after exposure to 300N (Fig. 7 B ).  B- K: ^/ X+ b& y

Fig. 7. Kinetics of AQP2 regulation in response to hyper- andhyposmotic challenge provide evidence for involvement of a tonicityenhancer element identified in the AQP2 promoter. IMCD cells werecultured for a total of 168 h (6 days) in 24-well plates in thepresence of 500 µM DBcAMP. A : cells were seeded in 600N,which was changed 24 h later to 300N to induce a downregulation ofAQP2. Medium osmolality was not changed in the case of controls (cellscontinuously grown in 600N; 168-h time point). Upregulation of AQP2 wasinduced by changing medium to 600N for 72, 48, 24, and 6 h beforecell lysis and Western blot analysis (not shown). AQP2 was detected andquantified as described in Figs. 1, 2, and 8 n 10. Graph was obtainedby performing nonlinear regression analysis [GraphPad Prism; R 2 (unweighted) = 0.9999]. B :cells were seeded in 600N. Downregulation of AQP2 was induced bychanging culture medium to 300N (except controls; 0-h time point) for144, 72, 48, 24, 6, and 3 h before cell lysis (168 h afterseeding) and Western blot analysis (not shown). AQP2 was detected andquantified as described in Figs. 1, 2, and 8. Values from densitometricanalysis of AQP2 protein (glycosylated and nonglycosylated) aremeans ± SE; n = 4. Graph was obtained byperforming nonlinear regression analysis [GraphPad Prism; R 2 (unweighted) = 0.9990]. C :rat and human AQP promoter regions. TonE consensus sequence ( 27, 34 ), as well as TonE elements found in promoters, is shown.Arrowheads, transcription initiation sites.( z* X4 s2 k5 j8 I2 Y7 u  p

Within the promoter of the AQP2 gene we located a regulatory elementthat could potentially mediate the effects of osmolality changes onAQP2 expression. Figure 7 C shows that the rat and human AQP2promoter [National Center for Biotechnology Information accession nos. D87128 ( 33 ) and U30469 ( 13 )] containelements matching the consensus sequence for the tonicity responsiveenhancer (TonE) ( 26, 34 ). The TonE consensus sequence isrecognized by the recently identified transcription factor TonE-bindingprotein (TonEBP) ( 27, 36 ). In agreement with the presentdata, activation 10 h ( 27 ), whereas a hypotonic challengerapidly decreases TonEBP activity ( 27, 38 ).

Hypertonic challenge, and not urea, promotes AQP2 proteinexpression. To discriminate further between the effects of NaCl and urea on AQP2protein expression in IMCD cells, a set of experiments was performedusing media elevated to 600 mosmol/kgH 2 O with different concentrations of either solute. Figure 8 A shows two representative AQP2 immunoblots obtained with total homogenates from IMCD cells cultured for 6 days in the indicated media. The results are summarized in Fig. 8 B. Culture media with a high effective osmolality(tonicity) derived from weakly membrane-permeating solutes as in 600N(NaCl) and 600S (sorbitol) promote AQP2 expression. In contrast,culture media with a high osmolality derived from themembrane-permeating compound urea (600U) yield a very faint AQP2expression, comparable to the AQP2 expression observed in IMCD cellscultured in 300N (Figs. 2 and 3 ). An increase in the NaCl concentrationby just 50 mmol/l (600NaCl/U 50/200) is almost sufficient for maximal stimulation of AQP2 expression. The complete omission of urea (600NaCl)yielded nearly maximal AQP2 protein levels, suggesting that elevationof the NaCl concentration alone is the relevant stimulus. In accordancewith the findings shown in Fig. 6, the level of pCREB was not alteredunder the conditions in the experiments shown here (data not shown).
6 w/ z4 q" N/ B9 }) F/ ]
Fig. 8. Hypertonic challenge, and not urea, promotes AQP2 proteinexpression. IMCD cells were cultured for 6 days in 24-well plates inthe presence of 500 µM DBcAMP in 600N 100/100 (control), 600S, or600U 0/300 ( left ) and 600 NaCl/U 50/200, 600N 100/100(control), or 600NaCl 150/0 ( right ). Numbers in front of andbehind slash indicate added concentrations (to 300N medium) of NaCl andurea (in mM), respectively. A : AQP2 and histone H2A1detected by immunoblotting with anti-AQP2 antiserum. Per lane of anSDS-polyacrylamide gel, total homogenate (protein) from1-cm 2 confluent cell monolayer was loaded. B n 8). * P: B7 {  C5 k( A. H, b  h* g
/ T" \! f, D1 r& I6 S2 y; P$ @0 j, m
AQP2 protein expression depends on elevated extracellular NaCl. The effect of different NaCl concentrations on DBcAMP-dependent AQP2expression was further analyzed (Fig. 9 ).For this purpose, IMCD cells were seeded in 600N and grown for 6 daysin 300N with 10, 20, 35, 50, 100, 150, 200, 250, and 300 mM NaCl. AQP2protein expression of the cells was analyzed by Western blot analysis. A representative set of experiments is shown in Fig. 9 A. Theresults are summarized in Fig. 9 B. The expression of AQP2was increased when up to 150 mM NaCl was added and appeared to decreasewhen higher concentrations of NaCl were used. These findings underline the assumption that NaCl concentration is a key component in mediating hypertonic induction of AQP2 expression.; O; a7 A2 t3 ]8 b  h

Fig. 9. AQP2 protein expression correlates with extracellular NaClconcentrations. IMCD cells were cultured for 6 days in 24-well platescontaining 600N (control) and 300N elevated to indicated osmolalitieswith 0 mM (300N), 10 mM, 20 mM, 35 mM, 50 mM, 100 mM, 150 mM, 200 mM,250 mM, and 300 mM NaCl. A : AQP2 and histone H2A1 detectedby immunoblotting with anti-AQP2 antiserum. Per lane of anSDS-polyacrylamide gel, total homogenate (protein) from1-cm 2 confluent cell monolayer was loaded. B n 12). * P

Osmolality and solute composition do not interfere with theshort-term regulation of AQP2. Immunofluorescence microscopy studies were performed to investigatewhether medium osmolality and solute composition alter theAVP-dependent AQP2 translocation from intracellular stores to theplasma membrane, i.e., the short-term regulation of AQP2. As shown inFig. 10, AQP2 was localizedintracellularly in unstimulated IMCD cells and translocated to theplasma membrane in response to AVP stimulation ( 21 ). TheAQP2 shuttle was observed under all conditions tested. These findingsindicate that osmolality and solute composition do not influence theAVP-induced translocation of AQP2. In addition, they show that IMCDcells are viable under the different conditions tested., n" O8 G: a; `$ X/ ]
: J9 j  g& l6 y; t2 [0 }' ^
Fig. 10. Osmolality and solute composition have no effect onhormone-stimulated trafficking of AQP2 in IMCD cells. Cells werecultured for 6 days in 300N, 600S, 600N (control), 900S, and 900N anddeprived of DBcAMP 18 h before experiments. Top :unstimulated IMCD cells. Bottom : IMCD cells stimulated with100 nM AVP for 30 min before fixation. AQP2 was detected with aspecific anti-AQP2 antiserum. Cy3-conjugated goat anti-rabbitantibodies were used as a secondary antibody.
5 h) {1 U* z- ^) S, n% d! U
DISCUSSION5 m( J" n3 N" z9 s6 c7 G8 z8 K
, M- I4 D; ^9 }
In the present study we show that, in the continuous presence ofDBcAMP (500 µM), the levels of AQP2 mRNA (Fig. 4 C ) andprotein (Fig. 2 B ) in primary cultured IMCD cells arestrongly increased by an increase in osmolality and influenced bysolute composition (NaCl and urea vs. sorbitol). The CMVpromoter-governed AQP2 expression in stably transfected MDCK cells(WT-10 cells) ( 6 ) was not influenced, suggesting that, inIMCD cells, osmolality and solute composition act on AQP2transcription, rather than affect AQP2 mRNA or protein stability(Fig. 3 ). Addition of DBcAMP to the cell culture medium increasedthe phosphorylation of the transcription factor CREB dose dependently,whereas osmolality and solute composition did not influence CREBphosphorylation (Figs. 5 and 6 ). The effects of hypo- and hyperosmoticchallenge on AQP2 expression were reversible (Fig. 7 ). Hyperosmolarityincreased AQP2 expression by one-half within 2 days (Fig. 7 A ), whereas hyposmotic challenge reduced expression byone-half within ~18 h (Fig. 7 B ). The promoters of the ratand human AQP2 gene each contain a binding site for the transcriptionfactor TonEBP (Fig. 7 C ), which may mediate the effects ofosmolality and solute composition on AQP2 expression. A further analysis of the influence of NaCl and/or urea on AQP2 expression revealed that NaCl is a key component in promotion of AQP2 expression, acting in a dose-dependent manner (Figs. 8 and 9 ). Elevated osmolality by urea alone had no promoting effect on AQP2 expression (Fig. 8 ), butthe effect of NaCl appeared to be enhanced when urea was present.* O: ~5 n, M7 t/ u* n5 y) R

In vivo, the high interstitial inner medullary osmolality is mainlyderived from equiosmolar urea and NaCl concentrations. Theconcentrations of NaCl and urea gradually increase from the kidneycortex to the tip of the medulla, thus creating an osmotic gradientrequired for water reabsorption. The osmotic gradient is maintainedeven during diuresis, and its magnitude is increased duringantidiuresis. The concentration of NaCl in the rat renal medulla variesbetween 140 mM in hydrated animals and 400 mM in dehydrated animals( 3 ). Whereas urea concentrations equilibrate between theinterstitium and the interior of the cell, extracellular NaCl isbalanced by intracellular accumulation of organic osmolytes such assorbitol, betaine, glycerophosphocholine, inositol, and taurine( 2 ). These nonperturbing osmolytes have stabilizing effects on protein function and, thus, counteract the denaturing effectof urea ( 39 ). In the renal medulla, the transcription ofseveral genes encoding for proteins involved in the intracellular accumulation of organic osmolytes is induced by hypertonicity ( 11 ). We show that elevated NaCl concentrations are alsorequired for a sustained expression of AQP2 in IMCD cells. The increase in AQP2 expression from kidney cortex to inner medulla( 29 ) suggests that NaCl-derived tonicity also controlsAQP2 expression in vivo.) M7 d* G" S+ K$ L
( }9 w8 E- Q$ ]1 ~5 @; W
It is widely accepted that cAMP is an important factor in theexpression ( 25 ) and trafficking of AQP2 in principal cells ( 30 ). There is also multiple, but mechanisticallyunexplained, evidence for an AVP-independent regulation of the waterpermeability of principal cells in the intact animal ( 30 ).Decreased AQP2 expression without changes in AVP or cAMP levels wasobserved in fasting and protein-deprived rats and humans ( 1, 35 ). Water deprivation increased AQP2 expression in ratschronically given V 2 R antagonists ( 24 ),indicating that the effect of water deprivation on AQP2 expression isnot solely due to AVP-elicited cAMP accumulation. Water loadingdecreased AQP2 expression, despite chronic administration of theV 2 R-specific agonist desmopressin ( 8 ).  s* @: ?4 W" k1 K& K; M% P
6 C" o  f1 |0 a0 P5 |
Studies have been conducted to investigate the effect of hypertonicityon AQP2 expression, but the results are unclear. Furuno et al.( 10 ) reported a small increase in AQP2 mRNA in cultured mouse outer medullary collecting duct cells bathed for 24 h in hypertonic medium. The finding that a 5-day AVP infusion in rats subjected to thirst increased AQP2 expression to a similar extent inrenal cortex (low osmolality) and medulla (high osmolality) favored theassumption that only cAMP, and not tissue osmolality or ionic strength,regulates AQP2 expression ( 37 ). No decrease in AQP2expression was observed after medullary osmolyte washout in ratstreated with furosemide for 4-5 days ( 23, 37 ). Astimulatory effect of osmolality on AQP2 protein levels in vivo hasbeen suggested by Preisser et al. ( 32 ), who found areduced AQP2 expression in senescent rats, which also exhibited areduced medullary osmolality in the kidney, while papillary cAMP levelsremained unchanged.4 {# B" Y3 A- E. `  L* w
1 t8 C0 ?) C$ Y' Y( J
We observed that NaCl stimulated the expression of AQP2 in adose-dependent manner when the cAMP-dependent pathway was stimulated (Fig. 9 ). This raises the question as to whether 4-5 days offurosemide treatment (see above) lowers the interstitial medullary NaClconcentration below a threshold presumably required for AQP2expression. It is also possible that elevation of AVP, or otherfactors, compensates for the effect of decreased tonicity. Furtherevidence for a promoting influence of medullary osmolality is providedby a recent study (5a) in which it was found that AQP2 proteinexpression increases in senescent rats when medullary osmolality isrestored. We suggest that NaCl-derived hypertonicity, which stimulatedAQP2 expression in a dose-dependent manner, is a key factor leading toincreased AQP2 expression (Fig. 9 ).

In the present study, elevation of medium osmolality from 300 to 600 mosmol/kgH 2 O by urea alone had no stimulatory effect onAQP2 expression (Fig. 8 ). Nevertheless, AQP2 expression was increasedwhen IMCD cells were grown in medium containing 50 mM NaCl and 200 mMurea (Fig. 8, 600 NaCl/U 50/200) compared with cells grown without ureain the presence of 50 mM NaCl (Fig. 9 ). The importance of urea in theurine-concentrating mechanism, however, was first reported decades ago.Protein deprivation leads to a decreased urine-concentrating ability inanimals and humans, which can be restored by urea infusion ( 5, 19, 31 ). More recently, the protein deprivation-induced decreasein urine-concentrating ability has been linked to a decrease in AQP2protein expression in the tip of the inner medulla ( 30 ).Our findings indicate that urea itself has no effect on AQP2 expressionbut, instead, enhances the stimulatory effect of elevated NaCl concentrations.% R; o! E' J( W% f4 o6 V" V

Considering that osmolality and solute composition did not affect CREBphosphorylation, we assume that the effect of media osmolality andsolute composition on AQP2 expression is not mediated by cAMP but isachieved via an alternative pathway. The observation 500 µMDBcAMP reduces AQP2 protein levels but increases CREB phosphorylationsuggests that higher DBcAMP levels activate factors repressing AQP2transcription, AQP2 translation, or protein stability. Taken together,our data indicate that, in addition to elevated cAMP, NaCl-derivedhypertonicity is required for sustained expression of AQP2.

A number of genes coding for proteins involved in the accumulation ofosmoprotective solutes in the kidney, such as aldose reductase,sodium- myo -inositol cotransporter, and glycine-betaine transporter, have recently been shown to be regulated by tonicity. Theregulatory element involved is the tonicity (osmolality)-responsive enhancer element TonE/ORE ( 9, 26, 28 ). On increases in tonicity, TonEBP abundance is upregulated and TonEBP translocates tothe nucleus, where it activates tonicity-responsive genes. Miyakawa etal. ( 27 ) reported that full activation of TonEBP 10 h, which is consistent with thetime required for a detectable increase in AQP2 expression elicited byhypertonicity (Fig. 7 ). Nuclear abundance and overall expression ofTonEBP are rapidly decreased by hypotonic challenge ( 27, 38 ). As reported for AQP2 ( 24, 37 ), dehydrationincreases the sodium- myo -inositol cotransporter mRNAexpression in rat renal medulla, whereas water loading decreases it.This response is presumably due to alterations in the amount of TonEBPpresent in the nucleus ( 4 ). The conservation of the TonEelement within the rat and human AQP2 promoter (Fig. 7 C )supports the idea that this element is most likely relevant to thegenes' transcriptional regulation.' |; F" d7 ^% Z: f5 I# k1 |

Altered TonEBP activity, due to altered medullary tonicity, might beresponsible for AVP/cAMP-independent changes in AQP2 expressionobserved in water loading and thirsting ( 8, 24 ). Theincrease in AQP2 expression from kidney cortex to inner medulla ( 29 ) is also well explained by an increasing activity ofTonEBP from kidney cortex to medulla. Thus the tonicity and the solute composition within a particular region of the renal collecting ductcould limit the range of the effect of AVP/cAMP on theexpression of AQP2 in vivo.  o2 S3 Q$ c" w& ~  m

ACKNOWLEDGEMENTS
4 S2 l& P' J) o2 n3 @
We thank P. Deen for providing WT-10 cells. We are indebted to JohnDickson (deceased December 2001) for invaluable help.( C# X8 e: K2 d) y& I6 U
      【参考文献】4 m4 \% F. U! t( e1 v' c# U
1. Amlal, H,Chen Q,Habo K,Wang Z,andSoleimani M. Fasting downregulates renal water channel AQP2 and causes polyuria. Am J Physiol Renal Physiol 280:F513-F523,2001 .
/ {/ Z1 a- ~( v# q

2. Bagnasco, S,Balaban R,Fales HM,Yang YM,andBurg M. Predominant osmotically active organic solutes in rat and rabbit renal medullas. J Biol Chem 261:5872-5877,1986 .  g' E* U  d3 N
4 q2 a+ p3 ^" ~( g3 R9 A4 R1 Z
$ x; Q) i3 _4 [1 U4 H% q* |% b6 N
- G" t- a$ {* ^! C; Q1 y
3. Beck, F,Dorge A,Rick R,andThurau K. Intra- and extracellular element concentrations of rat renal papilla in antidiuresis. Kidney Int 25:397-403,1984  .; e3 j; f: X/ u  @0 ?$ t

* e) l. A+ i/ V2 ^2 Z4 m

4. Cha, JH,Woo SK,Han KH,Kim YH,Handler JS,Kim J,andKwon HM. Hydration status affects nuclear distribution of transcription factor tonicity responsive enhancer binding protein in rat kidney. J Am Soc Nephrol 12:2221-2230,2001 .. D+ N" `/ ^* K. k2 ^# W
- g. n5 g) H5 N1 d+ q6 K) L
) u& E/ [  S* U: |
0 v9 w3 |! @  k6 X' T0 h4 p
5. Crawford, JD,Doyle AP,andProbst H. Service of urea in renal water conservation. Am J Physiol 196:545-548,1959 .+ y9 r- _* ?$ u2 I6 M! n3 D; j

- A4 J- L# f* k( `, x5 c% o
7 a- y- v" l: n$ H$ [
5a. Combet, S,Geoffrey N,Berthonaud V,Dick B,Teillet L,Verbavatz JM,Corman B,andTrinh-Trang-Tan MM. Correction of age-related polyuria by DDAVP: molecular analysis of aquaporins and urea transporters. Am J Physiol Renal Physiol 284:F199-F208,2002 .7 E- A0 _; M% Q% T9 J, x
% b( k; |9 P9 [; B+ }7 b+ J& [
7 j( F+ \9 A4 S8 i

6. Deen, PM,Rijss JP,Mulders SM,Errington RJ,van Baal J,andvan Os CH. Aquaporin-2 transfection of Madin-Darby canine kidney cells reconstitutes vasopressin-regulated transcellular osmotic water transport. J Am Soc Nephrol 8:1493-1501,1997 .( o. P- e! ?+ F" x% o8 B! V& B
6 ?  K5 z6 U. e2 G7 n0 L0 a

& r  d0 M7 s' z1 t% G/ j
7. Deen, PM,Verdijk TMAJ,Knoers NVAM,Wieringa B,Monnens LAH,van Os CH,andvan Oost BA. Requirement of aquaporin-2 for vasopressin-dependent concentration of urine. Science 264:92-95,1994 .% @0 T8 q7 g, l) n! q% ^7 A7 r

! d5 T) a& k4 t1 y4 [" v3 N; n
7 z/ M, D% u0 ?
8. Ecelbarger, CA,Nielsen S,Olson BR,Murase T,Baker EA,Knepper MA,andVerbalis JG. Role of renal aquaporins in escape from vasopressin-induced antidiuresis in rat. J Clin Invest 99:1852-1863,1997  .% F! K, J9 N' T4 J2 l; X+ Q

1 o& P2 a% ^4 O. O

9. Ferraris, JD,Williams CK,Jung KY,Bedford JJ,Burg MB,andGarcia-Perez A. ORE, a eukaryotic minimal essential osmotic response element. The aldose reductase gene in hyperosmotic stress. J Biol Chem 271:18318-18321,1996 .) d5 _# ~& e  y, F% [

( G: Q4 c) L0 a" l/ B& {

10. Furuno, M,Shinichi U,Fumiaki M,andSasaki S. Repressive regulation of the aquaporin-2 gene. Am J Physiol Renal Fluid Electrolyte Physiol 271:F854-F860,1996 ." }2 }# f7 Q1 @& b4 t

. A1 U2 A8 |/ g$ P: K) ]2 H6 e
8 X9 c* s" J& F( z( V3 y
11. Handler, JS,andKwon JM. Cell and molecular biology of organic osmolyte accumulation in hypertonic renal cells. Nephron 87:106-110,2001  .1 q4 ?8 V* V7 [- a3 Z1 x1 L0 e: I

. H$ f3 C' P; \  k' ]" o' e* G" x# Y
12. Hanski, C,Klussmann E,Wang J,Böhm C,Ogorek D,Hanski ML,Krüger-Krasagakes S,Eberle J,Schmitt-Gräff A,andRiecken EO. Fucosyltransferase III and sialyl-Le x expression correlate in cultured colon carcinoma cells but not in human colon carcinoma tissue. Glycoconj J 13:1-7,1996  .
( g' [" t1 s. A7 l0 C

13. Hozawa, S,Holtzman EJ,andAusiello DA. cAMP motifs regulating transcription in the aquaporin 2 gene. Am J Physiol Cell Physiol 270:C1695-C1702,1996 .5 Y2 |7 I4 T- o8 i

" ?. k8 N+ I1 Z/ a! z
14. Jo, I,Nielsen S,andHarris HW. The 17 kD band identified by multiple anti-aquaporin antisera in rat kidney medulla is a histone. Biochim Biophys Acta 1324:91-101,1997 .7 Q* L5 t* @; }
" {; x& V0 S$ n4 o$ h

15. Klussmann, E,Edemir B,Pepperle B,Tamma G,Henn V,Klauschenz E,Hundsrucker C,Maric K,andRosenthal W. Ht31: the first protein kinase A anchoring protein to integrate protein kinase A and Rho signaling. FEBS Lett 507:264-268,2001  .
" X; l- z* o7 `# c. D; F

1 U7 o3 O) B( L
16. Klussmann, E,Maric K,andRosenthal W. The mechanisms of aquaporin control in the renal collecting duct. Rev Physiol Biochem Pharmacol 141:33-95,2000  ./ |; j6 U6 s  E: W8 Z2 a
) c( D; V- F! t! t; o" t, y

17. Klussmann, E,Maric K,Wiesner B,Beyermann M,andRosenthal W. Protein kinase A anchoring proteins are required for vasopressin-mediated translocation of aquaporin-2 into cell membranes of renal principal cells. J Biol Chem 274:4934-4938,1999 .6 z# c& Y* R/ ], g2 [/ T7 i. l- x
& |! E% s  G) v9 r, i+ X

- \, B, [- H7 W" ]% A  [! P
18. Klussmann, E,Tamma G,Lorenz D,Wiesner B,Maric K,Hofmann F,Aktories K,Valenti G,andRosenthal W. An inhibitory role of Rho in the vasopressin-mediated translocation of aquaporin-2 into cell membranes of renal principal cells. J Biol Chem 276:20451-20457,2001 .
6 O" ]- r5 b2 O# E. k
+ j9 s" ^6 m' z- ]
. K+ w" C/ K% C! D
19. Levinsky, NG,andBerliner RW. The role of urea in the urine concentrating mechanism. J Clin Invest 38:741-748,1959  .

( a  f+ x% |/ ?+ Y* X/ H
20. Liebenhoff, U,andRosenthal W. Identification of Rab3-, Rab5a- and synaptobrevin II-like proteins in a preparation of rat kidney vesicles containing the vasopressin-regulated water channel. FEBS Lett 365:209-213,1995  .

8 G* \+ H' G5 F( {! B: d
% M! p" W" |9 p" ]5 Y* F
21. Maric, K,Oksche A,andRosenthal W. Aquaporin-2 expression in primary cultured rat inner medullary collecting duct cells. Am J Physiol Renal Physiol 275:F796-F801,1998 .

: a  q: K9 S/ A6 T+ P8 v
+ Z- w3 A; H5 _, P2 M6 f9 ?
22. Maric, K,Wiesner B,Lorenz D,Klussmann E,Betz T,andRosenthal W. Cell volume kinetics of adherent epithelial cells measured by laser scanning reflection microscopy: determination of water permeability changes of renal principal cells. Biophys J 80:1783-1790,2001 .
1 U/ ]* L" U4 g# d) ^* \6 l- I

23. Marples, D,Froekiaer J,Dorup J,Knepper MA,andNielsen S. Hypokalemia-induced downregulation of aquaporin-2 water channel expression in rat kidney medulla and cortex. J Clin Invest 97:1960-1968,1996  .6 e. k% R) P. B  n; j+ M2 G* P
" H# L7 r' ~. e2 L' @
. _6 C4 G4 }" J5 L
/ C0 I! I* }; @% s
24. Marples, D,Moenster Christensen B,Froekiaer J,Knepper MA,andNielsen S. Dehydration reverses vasopressin antagonist-induced diuresis and aquaporin-2 downregulation in rats. Am J Physiol Renal Physiol 275:F400-F409,1998 .
0 @6 l6 Q) {, c( N8 s1 \0 b- p
% N5 u. v6 K& t" a+ ?- }
" W" p* d+ D& M% D5 S9 c
25. Matsumura, Y,Uchida S,Rai T,Sasaki S,andMarumo FS. Transcriptional regulation of aquaporin-2 water channel gene by cAMP. J Am Soc Nephrol 8:861-867,1997 .

26. Miyakawa, H,Woo SK,Chen CP,Dahl SC,Handler JS,andKwon HM. Cis - and trans -acting factors regulating transcription of the BGT1 gene in response to hypertonicity. Am J Physiol Renal Physiol 274:F753-F761,1998 .% s' u( t7 B: P1 T" |' M9 L, e; f
2 k3 }7 e( q' F: A* J# D

$ c% k8 W3 W: N6 e* d! R& N
27. Miyakawa, H,Woo SK,Dahl SC,Handler JS,andKwon HM. Tonicity-responsive enhancer binding protein, a Rel-like protein that stimulates transcription in response to hypertonicity. Proc Natl Acad Sci USA 96:2538-2542,1999 .

0 f1 S$ S. r: B
28. Moriyama, T,Garcia-Perez A,andBurg MB. Osmotic regulation of aldose reductase protein synthesis in renal medullary cells. J Biol Chem 264:16810-16814,1989 .7 S' s+ W8 |  F" c9 V

4 A" }# A9 W* a; n1 N4 k* a5 f
29. Nielsen, S,DiGiovanni SR,Christensen EI,Knepper MA,andHarris HW. Cellular and subcellular immunolocalization of vasopressin-regulated water channel in rat kidney. Proc Natl Acad Sci USA 90:11663-11667,1993 .
7 e- C1 q" o, W2 T7 M

* E" U3 t; D  `! y9 b
30. Nielsen, S,Frokiaer J,Marples D,Kwon TH,Agre P,andKnepper MA. Aquaporins in the kidney: from molecules to medicine. Physiol Rev 28:205-244,2002.2 G" W/ E# m! @, t$ O

: u  w% q9 U! F- U0 g% J) t$ O! L

31. Pennell, JP,Sanjana V,Frey NR,andJamison RL. The effect of urea infusion on the urinary concentrating mechanism in protein-depleted rats. J Clin Invest 55:399-409,1975  .

5 O9 u5 j5 @8 _* \# H

32. Preisser, L,Teillet L,Aliotti S,Gobin R,Berthonaud V,Chevalier J,Corman B,andVerbavatz JM. Downregulation of aquaporin-2 and -3 in aging kidney is independent of V 2 vasopressin receptor. Am J Physiol Renal Physiol 279:F144-F152,2000 .5 k+ {/ H9 w1 s: L3 i. p: ]1 s

8 w- F1 j. j8 e2 y; P

33. Rai, T,Uchida S,Marumo F,andSasaki S. Cloning of rat and mouse aquaporin-2 gene promoters and identification of a negative cis -regulatory element. Am J Physiol Renal Physiol 273:F264-F273,1997 .7 ]5 o! D6 j& _  s( k

4 l9 ^2 ]0 G; M  j$ w) _; e: v
  X$ j! X, R4 g# ?( k
34. Rim, JS,Atta MG,Dahl SC,Berry GT,Handler JS,andKwon HM. Transcription of the sodium/ my o-inositol cotransporter gene is regulated by multiple tonicity-responsive enhancers spread over 50 kilobase pairs in the 5'-flanking region. J Biol Chem 273:20615-20621,1998 .0 p" q0 U+ Y8 I* ^

5 i1 p  ]' f+ H- L
  A& G6 d! F' b+ Z" ^$ _
35. Sands, JM,Naruse M,Jacobs JD,Wilcox JN,andKlein JD. Changes in aquaporin-2 protein contribute to the urine concentrating defect in rats fed a low-protein diet. J Clin Invest 97:2807-2814,1996  .- E; H. S4 F$ \! p) b5 e
$ X" K* D8 O' q, R; A

/ S' Q4 X, I. X! G4 L( G
36. Stroud, JC,Lopez-Rodriguez C,Rao A,andChen L. Structure of a TonEBP-DNA complex reveals DNA encircled by a transcription factor. Nat Struct Biol 9:2,2002  .  Y9 t; v. D/ F$ D+ e4 d' D

( I" z  I; q/ Z5 q9 Y
$ P& R: d. i/ v7 N1 Q
37. Terris, J,Ecelbarger CA,Nielsen S,andKnepper MA. Long-term regulation of four renal aquaporins in rats. Am J Physiol Renal Fluid Electrolyte Physiol 271:F414-F422,1996 .5 i' O) J/ Z2 |: t" x1 c$ e

38. Woo, SK,Dahl SC,Handler JS,andKwon HM. Bidirectional regulation of tonicity-responsive enhancer binding protein in response to changes in tonicity. Am J Physiol Renal Physiol 278:F1006-F1012,2000 .+ l, A) T  C( ~. T

' b4 l* s8 p% M) @. h$ H4 E% P' o* m
. V; I$ q. f- B1 T+ u: Z0 g) g) [# s
39. Yancey, PH,Clark ME,Hand SC,Bowlus RD,andSomero GN. Living with water stress: evolution of osmolyte systems. Science 217:1214-1222,1982 .

收藏0 分享0 顶0 踩0