|
  
- 积分
- 0
- 威望
- 0
- 包包
- 483
|

作者:Shing Leng Chana, Michael Choia, Stephan Wnendtb, Morey Krausb, Eileen Tenga, Hwei Fen Leonga, Shosh Merchava , d0 h: L+ }2 n# N
7 m0 v( S6 c% o5 i& j 4 c: |2 \, U( N4 \
: f' o$ l8 [. E 2 k0 z, Z" r% g% X# j
; t7 v( M/ b% Y! g3 Q$ h, G/ X5 G/ p
) w. @$ F% `, V. a2 ^2 P |( s3 U
% x6 ^$ `1 X9 Z p0 Q) h' Y0 O - H' h+ n& |7 b( Z% A
5 M% P1 A C/ J' g: @' f4 S# ?
+ T/ C% R7 Q2 B& @5 j) u
0 d' t2 h4 e8 Y5 i. j1 L
3 i& P, F) Y; D9 L 【摘要】
( R4 x6 n$ V, L& k+ Y7 L Mesenchymal stem cells have been implicated as playing an important role in stem cell engraftment. Recently, a new pluripotent population of umbilical cord blood (UCB) cells, unrestricted somatic stem cells (USSCs), with intrinsic and directable potential to develop into mesodermal, endodermal, and ectodermal fates, has been identified. In this study, we evaluated the capacity of ex vivo expanded USSCs to influence the homing of UCB-derived CD34 cells into the marrow and spleen of nonobese diabetic/severe combined immunodeficient (NOD/SCID) mice. USSCs induced a significant enhancement of CD34 cell homing to both bone marrow and spleen (2.2 ¡À 0.3- and 2.4 ¡À 0.6-fold, respectively; p < .05), with a magnitude similar to that induced by USSCs that had been thawed prior to transplantation. The effect of USSCs was dose-dependent and detectable at USSC:CD34 ratios of 1:1 and above. Enhanced marrow homing by USSCs was unaltered by extensive culture passaging of the cells, as similar enhancement was observed for both early-passage (passage 5 ) and late-passage (p10) USSCs. The homing effect of USSCs was also reflected in an increased proportion of NOD/SCID mice exhibiting significant human cell engraftment 6 weeks after transplantation, with a similar distribution of myeloid and lymphoid components. USSCs enhanced the homing of cellular products of ex vivo expanded UCB lineage-negative (lin¨C) cells, generated in 14-day cultures by Selective Amplification. The relative proportion of homing CD34 cells within the culture-expanded cell population was unaltered by USSC cotransplantation. Production of stromal-derived factor-1 (SDF-1) by USSCs was detected by both gene expression and protein released into culture media of these cells. Knockdown of SDF-1 production by USSCs using lentiviral-SiRNA led to a significant (p < .05) reduction in USSC-mediated enhancement of CD34 homing. Our findings thus suggest a clinical potential for using USSCs in facilitating homing and engraftment for cord blood transplant recipients.
6 N0 V& e; h. z1 h* m8 S 【关键词】 Unrestricted somatic stem cell Enhanced homing CD cells Stromal-derived factor- knockdown
% w" o5 N0 i/ Z/ j( P INTRODUCTION
+ y6 ^' A: z) a: r' I0 Q& C1 o& K- Q, f. o
Umbilical cord blood (UCB) is an attractive source of hematopoietic stem cells (HSCs) and has many advantages over bone marrow, including easy access and availability, a higher frequency of transplantable HSCs, and a higher output of progenitor cells from equivalent numbers of HSCs , where marrow stromal cells provide them with appropriate cues that collectively mediate their self-renewal and differentiation toward complete hematopoietic reconstitution.# S- d4 }; t8 K: Z- Z4 Z2 H/ ^
0 @& ~' ]- S; P9 J" X5 kTo study the kinetics and the quantitative aspects of human HSC engraftment, surrogate in vivo xenogeneic transplantation models have been used, including nonobese diabetic/severe combined immunodeficient (NOD/SCID) mice .
h8 W) C/ R: K: u$ @7 |9 H, L' v% t2 {6 _9 Q- A" v) r( j
MSCs represent a subset of bone marrow resident cells that can be ex vivo-expanded and induced to terminally differentiate into several lineages .( G2 a& ~! V& e
) `! z' r4 c7 l7 mMarrow stromal cells have been shown to sustain in vitro hematopoiesis for prolonged periods of time .
' ^2 v4 D" m+ o. o7 Z7 _& e$ |5 Q: R% j* k
The outcome of HSC transplantation is influenced by the ability of the cells to home to their specialized bone marrow niches. The impaired homing and retention of transplanted hematopoietic cells due to radiation-induced degeneration of marrow stroma provide additional support for a role of these cells in the early stages of HSC engraftment following transplantation.
8 r9 x5 ]% ^* }3 A* W. T$ A: I1 E3 {5 [4 [
Somatic stem cells that are readily available and can be propagated in large quantities, while retaining their ability to differentiate into different tissue cell types, could serve as a highly valuable resource for the development of off-the-shelf cellular therapeutics in the rapidly developing field of tissue engineering and regenerative medicine. Recently, a rare, nonimmunogenic CD34- and CD45-negative, human leukocyte antigen class II-negative population of stem cell candidates was identified . These findings suggest the possibility that USSCs also possess functional, hematopoietic-inductive properties and may possibly also be capable of supporting the homing and engraftment of transplanted cell populations.
5 Q8 h; i, i1 \! i* p& V5 N. g4 G% L$ V5 p+ T
The study presented in this communication demonstrates, for the first time, the capacity of umbilical cord blood USSCs to enhance the homing of freshly isolated and Selectively Amplified, culture-expanded cord blood hematopoietic cells to the marrow and the spleen of irradiated NOD/SCID mice. Enhanced homing was also reflected in increased numbers of mice exhibiting significant levels of human cell repopulation, thereby providing compelling evidence for an additional clinical application for USSCs, facilitating engraftment under prevalent conditions of limiting cord blood stem cell numbers for transplantation in adults.
9 b$ ?* d- V3 @* i8 g& A6 U. v5 g2 D5 N9 o1 u
MATERIALS AND METHODS6 g) l2 d7 m; C
6 O) D; h9 H) i8 f8 a' ?
Isolation of Mononuclear Cells from Umbilical Cord Blood+ i2 Y; V, ^4 `# U7 X4 u8 w% [
6 x8 ?/ D" r* b, l; e) pUCB samples were collected under sterile conditions during delivery into collection citrate phosphate dextrose bags after informed consent was obtained. UCB was fractionated on Ficoll-Hypaque, and buoyant (
3 o; A$ J" t+ z X1 A% A+ B$ @4 b1 J. T3 S& j
Isolation of CD34 Cells
- o% x# P3 i7 ^/ F3 O, J
9 s0 U: \8 D3 ]6 gCD34 cells were enriched from freshly isolated or frozen-thawed MNC fractions using the magnetic-activated cell sorting cell isolation kit (Miltenyi Biotec, Bergisch Gladbach, Germany, http://www.miltenyibiotec.com) according to the manufacturer's instructions. Purity of the cell populations was 90%.
. o' d* @0 \( Z$ g6 P6 D& W y+ x. d+ ~$ m
Isolation of Cord Blood Lineage-Negative Cells
, l% o% H+ ^4 F! J* h6 e' Y" J4 L% K$ K7 ?3 H& A
UCB lineage-negative (lin¨C) cells were enriched from freshly isolated or frozen-thawed MNC fractions by negative selection using a cocktail of lineage antibodies and a device as described by the manufacturers (StemSep; Stem Cell Technologies, Vancouver, BC, Canada, http://www.stemcell.com). The antibody-bound lin cells were eluted from the column and used as cotransplantation controls.- t+ q: [; Z* U5 r [
1 ~1 a5 `% i0 b$ ]1 H0 q# mSelective Amplification Cultures
3 ]( A, Y% w% S' [7 J
7 }3 H/ O# N) h1 _8 Q0 gUCB lin¨C cells were cultured in StemSpan serum-free expansion medium (Stem Cell Technologies) 2% Chemically Defined Lipid Concentrate (Invitrogen, Carlsbad, CA, http://www.invitrogen.com) and stimulated with a human cytokine cocktail consisting of 100 ng/ml each of recombinant human (rh) stem cell factor (Amgen, Thousand Oaks, CA, http://www.amgen.com), rhFlt-3 ligand (Amgen), and rh-thrombopoietin (Peprotech, Rocky Hill, NJ, http://www.peprotech.com). Cells (2.5 x 104 per cm2) were incubated in flat-bottomed six-well dishes (Iwaki, Glass, Tokyo, http://www.age.co.jp) at 37¡ãC at 5% CO2 in air. After 7 days in culture, the cells were reselected for the lin¨C population, and the latter were cultured for another 7 days and harvested at day 14. Prior to seeding in culture (input) and at various times thereafter, cells were harvested, enumerated, and assayed for CD34 CD45 cells by flow cytometry (FACSCalibur; Becton, Dickinson and Company, Franklin Lakes, NJ, http://www.bd.com), using anti-CD45-APC and anti-CD34-phycoerythrin (PE) (both from Becton Dickinson).
) M: t' C( x; h
$ g& w3 C5 ~4 u* `- }9 e/ b sIsolation of USSCs
6 Q" r8 n$ w3 \) }9 _
0 E5 l7 r* Q* a0 cTo initiate growth of the adherent USSC colonies, freshly isolated UCB MNC were cultured in T25 culture flasks (Nunc, Roskilde, Denmark, http://www.nuncbrand.com). The cells were cultured in Dulbecco's modified Eagle's medium (low glucose; Invitrogen) with 30% fetal calf serum (FCS) containing 10¨C7 M dexamethasone (Sigma-Aldrich) and a penicillin-streptomycin mixture (Invitrogen) at 100 U/ml:100 µg/ml. The cultures were incubated at 37¡ãC in 5% CO2 in a fully humidified atmosphere and were fed once a week by removing the complete medium with the nonadherent cells and adding 10 ml of fresh medium. After 2¨C3 weeks, adherent cells of fibroblastoid morphology (USSC) appeared in approximately 30% of all cell cultures. These cells were removed by treatment with 0.05% trypsin and 0.53 mM EDTA for 2 minutes, rinsed with 10% serum-containing medium, collected by centrifugation, and analyzed by flow cytometry after expansion in culture. USSCs were subcultured by a 1:3 dilution when they reached 80% confluence. Expanded USSCs from passages 5 to 10 were cryopreserved in FCS containing 10% DMSO (Sigma-Aldrich) at 1 to 5 x 106 cells per vial. For cotransplantation, USSCs were thawed quickly in 37¡ãC water bath and washed two times in PBS containing 2% horse serum before injection.
9 ~% O& {# L9 `3 C' s
# |: y" i; i0 D7 I1 LDetection of Stromal-Derived Factor-1 Production by USSCs, N8 t; |: p! [1 N
$ b; W" M" j4 I _1 AReal-Time Reverse Transcription-Polymerase Chain Reaction. Total RNA was isolated from USSCs using the RNeasy Mini Kit (Qiagen, Hilden, Germany, http://www1.qiagen.com) according to the manufacturer's instructions. For detection of stromal-derived factor-1 (SDF-1) knockdown, USSCs were harvested 9 days after infection with various lenti-siRNA vectors. Transcript levels were determined by real-time polymerase chain reaction (PCR) (Rotor-Gene 3000; Corbett Research, Mortlake, NSW, Australia, http://www.corbettlifescience.com) using the QuantiTect SYBR Green reverse transcription (RT)-PCR kit (Qiagen). The sequences for SDF-1 primers were as follows: sense, 5'-ATGAACGCCAAG GTCGTGGTCGTG-3'; antisense, 5' ATCTTGAACCTCTTGTTTAAAGC-3'. Primers for glyceraldehyde-3-phosphate dehydrogenase (GAPDH) were as follows: sense, 5'-ACGGGAAGCTCACTGGCATG-3'; antisense, 5'-TGGAGGAGTGGGTGTCGCTG-3'. Primers were used at a concentration of 0.5 µM for real-time PCR in each reaction. Cycling conditions for the reverse transcription and real-time PCR were as follows: step 1, 30 minutes at 50¡ãC for the reverse transcription reaction; step 2, 15 minutes at 95¡ãC; step 3, 30 seconds at 95¡ãC; step 4, 30 seconds at 60¡ãC; step 5, 30 seconds at 72¡ãC; with steps 3 to 5 repeated 40 times. Data from the reactions were collected and analyzed by complementary computer software (Corbett Research). Quantitation of gene expression was calculated by standard curves and normalized relative to GAPDH.. H2 I* R- Z! ~# M3 U8 K
, H# F0 t2 `+ U' f$ b% OSDF-1 Enzyme-Linked Immunosorbent Assay. Into each well of a six-well plate were seeded 50,000 USSCs. The amount of SDF-1 secreted into the medium at the indicated culture time points was quantitated using 100 µl of culture supernatants. The SDF-1 enzyme-linked immunosorbent assay was performed, and the data were analyzed as described by the manufacturer (R&D Systems Inc., Minneapolis, http://www.rndsystems.com)." Q0 i& c5 T |' N
3 y3 i# K$ r7 X# t+ _
Mice
$ X Y& v* S3 p' @
$ K0 l Q9 ] ?7 k" ]1 gNOD/LtSz-Prkdcscid (NOD/SCID) mice were bred and maintained under defined flora conditions in sterile microisolator cages at the satellite Animal Holding Unit at the National University of Singapore (NUS). All experiments were approved by the animal care committee of NUS. Eight- to 10-week-old mice were sublethally irradiated (325 cGy, from a 60Co source) and transplanted 16 hours thereafter with designated cell suspensions, as described below.
2 H7 y, z0 [8 Y% R
) D# T; f" Y2 c0 r) B. Y X) i' fHoming Assay
* T" h8 t1 Z8 L( p2 h$ s" |
: ~9 {4 t3 L$ Z0 E% BIsolated UCB CD34 or cells harvested from 14-day selective amplification cultures were labeled with carboxyfluorescein diacetate succinimidyl ester (CFDA-SE) (Molecular Probes Inc., Eugene, OR, http://probes.invitrogen.com) according to the manufacturer's instructions. Two to 5 x 105 CD34 equivalents of these cells were injected at 0.15-ml volumes, alone or together with 0.064 to 1 x 106 freshly cultured or frozen-thawed USSCs, into the tail vein of sublethally irradiated NOD/SCID mice. For SiRNA experiments (described below), 1 x 106 USSCs infected with the various recombinant lenti-SiRNA vectors were co-injected with 2.5 x 105 CD34 cells. Sixteen hours after transplantation into mice, single-cell suspensions were prepared from the bone marrow and spleen and analyzed for the presence of human cells by flow cytometry using signals from CFDA-SE and human-specific PE-conjugated anti-CD34 monoclonal antibody, acquiring at least 106 cells per sample. In the homing of isolated CD34 cells, similar numbers of cells, determined by gating of green CFDA fluorescence or of red, PE-conjugated anti-CD34 fluorescence, were observed. Cells obtained from mice that did not undergo transplantation or labeled with isotype control antibodies were used as negative controls. Human cells were used as a positive control, and Via-Probe (7AAD; Becton Dickinson) staining was used to exclude dead cells. Fold enhancement of homing cells cotransplanted with USSCs was calculated as the number of cells homing to either bone marrow or spleen per 106 acquired cells divided by homing achieved following transplantation of either CD34 cells or day-14 selectively amplified cells alone.
/ y2 f% X( j4 M- I3 z9 [ K* N
0 c+ C6 x* T1 T" YAnalysis of Human Cell Engraftment by Flow Cytometry
4 c$ S8 y- w' F& N |* g6 f+ T# s, h& W) Z3 x2 x, w) [
For engraftment studies, CD34 cells (1 x 105) or cells from selective amplification cultures (5 x 105 CD34 equivalent) were injected in the presence or absence of 1 x 106 USSCs. Mice were sacrificed 6 weeks later for marrow cells. The cells were used for cell surface analysis by flow cytometry (FACSCalibur; Becton Dickinson) using anti-CD45-APC and anti-CD19-PE (both from Becton Dickinson). Isotype antibodies and cells obtained from mice that did not undergo transplantation were used as negative controls.
8 c0 o3 o, J A0 ~6 O/ _8 E X! ^6 O* t3 j' Q% q, o: v/ l
Generation of Short Hairpin RNA for SiRNA Production, G3 O7 K$ A$ T/ F. C
' k& E& @+ F! E ~$ n z, t
Short hairpin RNA (shRNA) constructs were generated by synthesizing complementary oligonucleotides containing (a) a 19-nucleotide sense strand and a 19-nucleotide antisense strand, separated by a 10-nucleotide loop (TTGATATCCG); (b) a stretch of six adenines as a template for the PolIII promoter termination signal; and (c) 5'-end BamHI and 3' XhoI restriction sites. The oligonucleotides were annealed and ligated to a BamHI-, XhoI-digested pRNAT-U6.1/Lenti vector (GenScript, Piscataway, NJ, http://www.genscript.com/), which contains a coral green fluorescent protein (cGFP) coding sequence located in the middle of the vector and driven by a cytomegalovirus promoter. Two different siRNA target sequences from the open reading frame of human SDF-1 were used to construct siRNA expression cassettes in the cGFP-lentiviral vector. The shRNA oligonucleotide sequences for these were as follows (boldface indicates sense and antisense strands, italic indicates loop): (a) si-SDF1¨C1 (5'-GATCCCGTTCGAAGAATCGCATGGGTTGATATCCGCCCATGCCGATTCTTCGAATTTTTTCC-AAC-3'),(b) si-SDF1¨C2 (5'-GATCCCGTTTGAGATG CTTGACGTTGGCTTGATATCCGGCCAACGTCAAGCATCTCAAATTTTTTCC-AAC3'), and (c) si-control (5'-GATCCCATGATCGTTTAGCAGACGGTTGATATCCGCCGTCTGCTAAACGATCATTTTTTTCC-AAC3').- i. i$ j# G* W9 A S7 {
4 u3 k# ^! i! n, x. P7 [* B I rInfection of USSCs with Recombinant Lentiviral Vectors
2 U( O6 a0 a+ M+ v$ V+ b
: w: }; n z& V# [) n/ ^Recombinant lentiviruses were produced by transient transfection in human embryonic kidney 293T cells using Lipofectamine (Invitrogen) as recommended by the manufacturer. Media containing infectious lentiviruses were harvested at 48 hours after transfection and filtered through 0.22-µm-pore cellulose acetate filters.' p, w3 u L+ h/ W
* Y" v' P d: C. U3 IUSSCs were incubated with infectious lentiviral vectors for 48 hours and grown for 10 days with two passages before use. USSCs were infected with both lenti-si-SDF1¨C1-eGFP and lenti-si-SDF1¨C2-eGFP for effective knockdown of SDF-1. Control USSCs were infected with lenti-control-GFP vector. All cells used for subsequent experiments were >90% GFP-positive. Real-time PCR was performed on day 9 following infection to determine the degree of SDF-1 mRNA knockdown.3 Q! M8 W. M* U5 J
8 Z$ J) z8 D# C5 G$ v! j
Statistical Analyses: |: q3 n; z2 x9 x5 U5 i6 M
$ D9 ~- Q& x6 w, y' OAll analyses were done using the Microsoft Excel 5.0 software. The significance of each set of values was assessed using the two-tailed Student's t test assuming equal variance. The dose-dependent effect of USSCs on homing was first analyzed by analysis of variance, followed by Student's t test for difference in means, according to Fisher's least significant difference method.* I, j1 x1 _) `
- p) W) m( p7 ?) E& qRESULTS* m5 ^1 |8 a) {
- q# ^+ f9 J6 ^! @( C8 V% f) `/ D
The effect of USSCs on the homing of umbilical cord blood HSCs was evaluated by cotransplantation of these cells with UCB CD34 cells into sublethally irradiated mice. After 24 hours, mice were sacrificed, femurs and spleens were removed, and cell suspensions were analyzed for the presence of human cells. As shown in Figure 1, USSCs were found to induce a significant (p
" t5 @# I( v( d# S) h$ e! V6 ~' J% |9 p" P5 D5 b% s
Figure 1. Effect of USSC cotransplantation on homing of freshly isolated umbilical cord blood CD34 cells. The indicated cultured USSCs were removed from culture dishes by trypsinization, washed twice, and resuspended for transplantation, as described in Materials and Methods. Enriched cord blood CD34 cells were labeled with carboxyfluorescein diacetate succinimidyl ester (CFDA-SE) and transplanted (2 x 105 cells per mouse) in the presence or absence of 1 x 106 cultured USSCs, into sublethally irradiated nonobese diabetic/severe combined immunodeficient mice. Bone marrow and spleen cells were harvested 16 hours thereafter, and CFDA-SE-positive cells were quantitated by flow cytometry. (A): The number of CFDA-positive cells that homed to the marrow or spleen per 106 acquired cells (mean ¡À SD, three mice per experiment). p values obtained using a two-tailed Student's t test assuming equal variances are indicated. (B): Degree of homing enhancement (fold) due to USSC cotransplantation. Abbreviations: CFDA, carboxyfluorescein diacetate; Expt, experiment; USSC, unrestricted somatic stem cell.! C7 C: q- \! c7 I& a. B$ r) T' u
; y2 I) K" \% K* a
The capacity of USSCs to enhance the homing of CD34 cells to the marrow of NOD/SCID mice was observed for different UCB USSC isolates (Fig. 2A) and was found to be specific to this cell population, since no effect on homing could be detected by cotransplantation of CD34 cells with UCB lin cells (Fig. 2B), which contain T, B, and mature myeloid and erythroid cells. The frequency of homing cells observed was within the range described by others .# V7 t6 N7 H( X/ ?2 Y8 l
. ?) L: e0 Y) v9 b. C7 AFigure 2. Effect of different USSC isolates on marrow homing of CD34 cells. Carboxyfluorescein diacetate succinimidyl ester-labeled umbilical cord blood (UCB) CD34 cells were transplanted at 2 x 105 CD34 cells into sublethally irradiated nonobese diabetic/severe combined immunodeficient mice. Cells were transplanted alone or cotransplanted with 1 x 106 USSCs isolated from different UCB units (preparations 005, 011, and 554) (A) and 1 x 106 USSCs or 1 x 106 UCB lineage-positive cells (B). Homing to the marrow was evaluated as described in Materials and Methods. * indicates a statistically significant increase (p ( V' R9 m- D9 y& M! ]
: \( X+ m2 S0 P! ]8 s6 z2 V! YBoth cultured and freshly thawed USSCs were found to exert a similar enhancing effect on CD34 cell homing to the marrow (Fig. 3), indicating that maintained culturing of these cells prior to transplantation is not a prerequisite for their functional activity. The capacity of USSCs to enhance CD34 cell homing was also found to be unaltered by extended passaging, as a similar effect was observed for USSCs that had undergone 5 or 10 culture passages.
8 z1 q; |9 g* Y4 ]$ F7 d8 u, ?5 H" g- z L. l+ B: g4 ^+ }+ ^6 Q
Figure 3. Cotransplantation of freshly isolated and culture-expanded umbilical cord blood (UCB) cells with passaged and frozen-thawed USSCs. (A, B): 1.8 x 105 UCB CD34 cells (A) or 2.5 x 105 CD34 equivalent day 14 culture-expanded cells (B) were labeled with carboxyfluorescein diacetate succinimidyl ester (CFDA-SE) and transplanted into sublethally irradiated nonobese diabetic/severe combined immunodeficient mice in the presence or absence of cultured or thawed USSCs from the same UCB isolate (USSCs and FT USSCs, respectively). USSC isolates used in (A) and (B) were USSC-011 and USS-554, respectively. Results show the number of CFDA-SE-positive cells that homed to the bone marrow per 106 acquired cells (mean ¡À SD; n = 3). * indicates a statistically significant increase (p " d5 }4 }; N) q/ \) v: j
- h9 l) {) D! f. G ^6 y" c/ I% d
Limitations in UCB stem cell numbers for transplantation in adults previously led us to develop a Selective Amplification method, which allows the controlled amplification of selected lin¨C cells in cytokine-driven cultures . Isolated lin¨C cells that had been cultured and reselected for a total period of 14 days gave rise to cell populations exhibiting 118 ¡À 12.4- and 46 ¡À 9.8-fold expansion of total nucleated and CD34 45 cells, respectively (n = 4). As shown in Figure 4, USSCs also enhanced the homing of day-14 Selective Amplification cell products. The degree of homing enhancement of cultured cells to the marrow and spleen by USSCs (2.0 ¡À 0.32- and 2.9 ¡À 1.0-fold, respectively; n = 3) did not significantly differ from that of freshly isolated UCB CD34 cells (Fig. 1).
' h* u4 @0 G1 | X. S) h2 a1 h6 a! a2 _/ ^3 e/ r7 Q- R
Figure 4. Effect of USSC cotransplantation on homing of selectively amplified cord blood cells. Selectively amplified, culture-expanded d14 cells were labeled with carboxyfluorescein diacetate succinimidyl ester (CFDA-SE) as described in Materials and Methods and transplanted (2.5 x 105 CD34 cells equivalent per mouse) into sublethally irradiated nonobese diabetic/severe combined immunodeficient mice in the presence or absence of the indicated USSC preparations. Sixteen hours later, CFDA-SE cells that had homed to bone marrow (BM) and spleen of recipient mice were quantitated by flow cytometry. (A): Number of CFDA-positive cells that homed to the BM or spleen per 106 acquired cells (mean ¡À SD; n = 3). p values obtained using Student's t tests are indicated. (B): Fold enhancement of homing by USSC cotransplantation for each experiment. Abbreviations: CFDA, carboxyfluorescein diacetate; d, day; Expt, experiment; P, passage; USSC, unrestricted somatic stem cell.- _! Q+ h. o. W+ \7 b6 u
3 [" o! P6 ]. t: ZTo determine the USSC:CD34 cell ratio required for enhanced homing, mice were transplanted with a constant number of CD34 cells and several doses of USSCs. As shown in Figure 5A, significant (p
8 Y$ x) _0 Z4 D+ V+ \+ T2 ]( K& E% e! n2 L6 ^
Figure 5. Dose-dependent effect of USSCs on homing. Freshly isolated umbilical cord blood CD34 cells (2.5 x 105) (A) or CD34 equivalent culture-expanded cells harvested at day 14 (2.5 x 105) (B) were labeled with carboxyfluorescein diacetate succinimidyl ester and transplanted into sublethally irradiated nonobese diabetic/severe combined immunodeficient mice in the presence or absence of 6 x 104 to 1 x 106 USSCs. Detection of CD34 in the cultured cell populations that had homed to the marrow was performed with human-specific anti-CD34-phycoerythrin monoclonal antibodies. Results are presented as the number of CFDA (A, B) or CD34 (B) cells per 106 acquired mouse bone marrow cells (mean ¡À SD; n = 3). * indicates a statistically significant increase (p
5 u) I6 c2 p: C: F: R+ o9 P/ I% W6 @
To evaluate whether the enhanced homing of UCB CD34 cells would be reflected in their NOD/SCID reconstituting capacity, 6-week engraftment studies were performed. As shown in Figure 6A, cotransplantation of CD34 cells with USSCs increased the mean percentage of human hematopoietic (hCD45 ) cells in NOD/SCID mice. Although the fold increase in percentage of CD45 cells was not statistically significant (p = .2), cotransplantation increased the number of mice exhibiting human cell engraftment above the threshold of 0.1% hCD45 cells: human cell engraftment increased from 3 of 5 mice injected with CD34 alone to 5 of 6 mice cotransplanted with of USSCs and CD34 cells. Analysis of the human CD45 populations in engrafted mice with lineage markers indicates similar proportions of CD45 CD19 lymphoid cells, CD45 33 myeloid cells, and CD45 33 13 granulocytes/macrophages in mice transplanted with CD34 alone or together USSCs.4 W) c5 P' p& _% W' }! I
, v# l; t; }8 W: Z6 J2 V) G3 RFigure 6. Effect of USSC cotransplantation on engraftment of freshly isolated and culture-expanded umbilical cord blood (UCB) cells. (A): Freshly isolated UCB CD34 cells (8 x 104 cells) were transplanted in the presence or absence of 1 x 106 USSCs into sublethally irradiated nonobese diabetic/severe combined immunodeficient mice. The percentage of human CD45 (hCD45 ) cells in cell suspensions isolated from recipient mouse bone marrow was determined 6 weeks after transplantation by flow cytometry using human-specific anti-CD45 monoclonal antibodies (mAbs). Results from the surviving mice are plotted; each diamond indicates results from one mouse. (B): The proportion of the indicated lymphoid and myeloid cell lineages was assayed in the bone marrow of the engrafted mice (% hCD45 > 0.1%) using anti-CD19 , CD33 , and CD13 mAbs. p values obtained using Student's t tests are indicated. Abbreviation: USSC, unrestricted somatic stem cell.. b) i; c/ T0 S1 }0 E
. e; s/ P5 Q/ J% b0 J# Y8 u. Z
Previous studies had shown that exposure of ex vivo-expanded cord blood stem cells to SDF-1 or its analogs enhances their ability to engraft NOD/SCID mice . In an attempt to elucidate the mechanism(s) whereby USSCs may enhance the homing/engraftment of CD34 cells, we first assessed the capacity of these cells to produce SDF-1. As shown in a representative experiment (Fig. 7A), transcripts for SDF-1 were detected in USSCs by real-time RT-PCR. Translation of mRNA to mature protein was demonstrated by the capacity of USSCs to secrete SDF-1 over time. As shown in Figure 7B, significant levels of SDF-1 were detected in medium conditioned for 24 hours by USSCs, compared with control culture media (p
. m" F1 m. a2 i: G1 C5 r" j
- v1 @6 I- ]; ?) m) X! z8 HFigure 7. Production of stromal-derived factor-1 (SDF-1) by USSCs. (A): Detection of SDF-1 mRNA transcripts in USSCs (011-P5) by real-time reverse transcription-polymerase chain reaction. The results are expressed as relative mRNA level normalized to glyceraldehyde-3-phosphate dehydrogenase. (B): SDF-1 in conditioned media of USSC-011-P5 harvested at 24 and 72 hours, as determined by enzyme-linked immunosorbent assay. (C): Effect of lenti-SDF-1-treated USSCs on homing of CD34 cells. Enriched cord blood CD34 cells were labeled with carboxyfluorescein diacetate succinimidyl ester (CFDA-SE) and transplanted (2 x 105 cells per mouse) in the presence or absence of 1 x 106 of the respective USSCs into sublethally irradiated nonobese diabetic/severe combined immunodeficient mice. Bone marrow cells were harvested 16 hours thereafter, and CFDA-SE-positive cells were quantitated by flow cytometry. * indicates a statistically significant difference (p
' \1 u |: F& N6 M, k% T$ D. U. ~: G" T# f. C+ t* ~
To assess whether SDF-1 production by USSCs may play a role in their effect on homing, we tested the functional activity of USSCs infected with SDF-1 SiRNA. As shown in Figure 7A, we observed an 85% knockdown in SDF-1 mRNA, compared with the SDF-1 mRNA level in USSCs infected with Si-control-lentiviral vector. No difference in GAPDH gene expression levels due to lentiviral infection was observed (data not shown). In addition to these findings, conditioned media from USSCs infected with the Si-SDF-1-lentiviral vector, collected during the last 2 days of USSC culture prior to transplantation, did not have detectable levels of SDF-1. In contrast, control lentiviral and mock-infected controls contained 0.26 and 0.35 ng/ml of SDF-1, respectively.
2 I$ ]- r" k! j# {
, S! L$ U6 V- X* RThe capacity of USSCs infected with lenti-SDF-1 and lenti-control to enhance the marrow homing of freshly isolated CD34 cells was evaluated. As shown in Figure 7C, although USSCs infected with control lentivirus maintained an approximately twofold enhancement of CD34 cell homing, a significant reduction (p
7 W/ e0 T# j8 X4 E: e+ E" w3 Z. A7 i' Q. P& ^6 k
DISCUSSION: F. `9 n' Z1 F! P* o& r
L& a+ D& @/ \Human bone marrow contains MSCs that produce adventitial cells in the marrow microenvironment; these cells provide support to hematopoiesis by producing membrane-bound and soluble signals and cytokines. Therefore, it was postulated and shown in preliminary clinical studies that MSCs may enhance hematopoietic engraftment rate and quality after myeloablative and stroma-damaging treatments.
" F$ Q9 @ v$ L+ P7 t' z3 h' L b* W6 f/ l( X
In this study, we evaluated the capacity of umbilical cord blood-derived USSCs to play a role in hematopoietic reconstitution. We demonstrated that the USSC cotransplantation enhances the homing, as well as the engraftment, of umbilical cord blood CD34 cells in NOD/SCID mice. Our observations contrast with the studies of Noort et al. , who showed that a cultured subset of human marrow MSCs lacking the Stro-1 antigen, but not the Stro-1-positive subset, enhanced the engraftment of isolated CD34 cells in NOD/SCID mice. The immediate-early effect of both these populations on homing was not investigated.: k& z( z. x) h4 }' V
# h' `0 D2 f/ v8 O3 j' ZKim et al. did not find any significant increase in the level of engraftment in cotransplantation of human marrow MSCs with UCB MNC, at a 1:1 or lower ratio of MSCs:CD34 cells. Although our engraftment studies were performed with a 10-fold higher ratio of injected cells, a 1:1 ratio of USSCs:CD34 cells was found by us to be the minimum requirement for a significant effect on homing.
3 ~; H! J; V/ v' b
" ^. V+ q L/ T- \/ GSDF-1 not only serves as an extrinsic factor providing a gradient for the migration/homing of HSC to bone marrow, it also exerts some intrinsic effects through signaling cascades on cells expressing CXCR4, which enhance adhesion and chemotaxis, both of which are important for cellular homing and engraftment in the marrow .3 ^% q: b* m/ ^ ` a5 L
7 V z, s' q! e, t( d5 u! Q# H
In this investigation, we detected mRNA as well as production of SDF-1 protein by USSCs. In accordance with our findings, SDF-1 gene expression was also recently shown in both bone marrow and UCB-derived MSCs .$ ~: F* T0 | S. c' Z! y1 \; d
/ R' \ c @9 Z$ G' qIn an attempt to assess whether the SDF-1 produced by USSCs is involved in the functional activity of these cells, we evaluated and demonstrated that knockdown of SDF-1 significantly reduces their ability to enhance homing of CD34 cells to the bone marrow. This observation is in accordance with previous engraftment studies using SDF-1 or its analogs , as well as with our recent observations that co-administration of SDF-1 with UCB CD34 cells enhances their homing to the marrow of NOD/SCID mice (manuscript in preparation). Taken together, these findings support a role for SDF-1 in the functional activity of USSCs. Although the inhibition of USSC-enhanced homing by siRNA was partial, low levels of SDF-1 may still be produced by knockdown cells, which still exhibited residual (15%) SDF-1 mRNA expression. Furthermore, we cannot exclude the possibility that one or more other, as yet unknown factors may play a role in the enhanced homing effect of USSCs.% \1 ]6 B- \' f7 @5 p2 J3 E4 A: |
& R2 d; ~2 h( x
The enhancing effect of USSCs on homing may not be restricted to CD34 cells alone, as the homing of cultured CFDA-positive cells that do not express this cell surface antigen was also enhanced by cotransplantation with USSCs (Fig. 5B). The similar distribution of CD34 cells in the marrow and spleen of mice cotransplanted with culture-expanded cells and USSCs (34% ¡À 5% vs. 38% ¡À 2% and 19% ¡À 5% vs. 18% ¡À 3%), further indicates that the effect induced by the latter is not selective to a specific homing population, nor does it alter the tissue distribution of the engrafted cells within the recipient.& V9 c/ i; n, u- j e& e4 i+ q+ Y3 y; M
; t) }& F/ \& C- KThe findings obtained with USSCs in this study are unique in that they indicate, for the first time, an effect of such cells on enhanced homing and engraftment not only of unmanipulated but also of cultured, ex vivo-expanded cord blood hematopoietic cell populations. UCB stem cell expansion provides a major strategic approach for transplantation of UCB into adults, thereby facilitating greater cell-dose-dependent engraftment success. The use of UCB USSCs as cotransplanted cellular components of such grafts offers the potential to further facilitate successful engraftment through initial events related to the homing and lodging of the transplanted populations within the supportive and instructive marrow environment.
- Y! }9 K5 N* M+ l5 G7 E& u s. p& v- D$ ~
Both cultured and freshly thawed USSCs were found to exert a similar enhancing effect on CD34 cell homing to the marrow (Fig. 3), indicating that maintained culturing of these cells prior to transplantation is not a prerequisite for their functional activity. This observation may strongly facilitate the logistics of clinical USSC cotransplantation into patients receiving freshly thawed UCB units. The undiminished capacity of freshly thawed USSCs to enhance the homing of culture-expanded UCB cells (Fig. 3B) is of even greater significance, as it relieves the complexity that may be associated with aligned timing required for cotransplantation of distinct culture products. Our findings provide a basis for the banking of large USSC stock numbers, obtained through exponential expansion and passaging during the culturing process of these cells. Under current USSC production conditions, an estimated 243-fold (35) increase in total cell yield can be anticipated by expanding USSCs between passage 5 and passage 10, without loss of functional activity. Taken as a whole, our study strongly supports the valuable potential in establishing USSC storage banks of these cells, as a source of facilitating cells for immediate therapeutic use, under conditions of limiting cord blood stem cell numbers.
# [! I0 B( g/ ~) ^# i2 J
% D- |& W( q, r' n' x$ Z' iDISCLOSURES
# J, Z* @( p2 L6 |6 q. E3 A' o, o" u5 `" Q; `; g; |7 c4 d
M.K., S.W., S.L.C., M.C., E.T., and H.F.L. all have a financial interest in ViaCell, Inc. (Singapore). M.K. owns stock in ViaCell, and S.W. has served as an officer of member of the Board of ViaCell within the past 2 years.- c/ C* ~5 {) C
" Y1 h; q! n( v: yACKNOWLEDGMENTS, d+ H( c- \! u; B- D; d3 i( h5 x$ l- a
e4 U4 I. n/ E& _1 V# `+ XThis work was supported in part by Research Incentives Scheme Grant S02/00282 of the Singapore Economic Development Board. We thank Dr. Joseph Laning for critical review of the manuscript. This work was presented in part at the Annual Society of Hematology meeting, December 8¨C13, 2005, Atlanta, GA.! c+ r: }5 E2 R) j, [' ?& B$ {' C
【参考文献】5 {9 q' a u5 _- s7 Y- N
8 m( l8 s" L; L d" {- I+ _: t* @: R7 ? H( j4 E
Holyoake TL, Nicolini FE, Eaves CJ. Functional differences between transplantable human hematopoietic stem cells from fetal liver, cord blood, and adult marrow. Exp Hematol 1999;27:1418¨C1427.
# @" I6 T6 ]; u" t" @% b( }
4 E( Y( G/ r4 [) K: hWang JC, Doedens M, Dick JE. Primitive human hematopoietic cells are enriched in cord blood compared with adult bone marrow or mobilized peripheral blood as measured by the quantitative in vivo SCID-repopulating cell assay. Blood 1997;89:3919¨C3924.
9 p& U% f6 W( H; g x; Z7 v$ @& A( A4 v
Gluckman E, Rocha V, Boyer-Chammard A et al. Outcome of cord-blood transplantation from related and unrelated donors. Eurocord Transplant Group and the European Blood and Marrow Transplantation Group. N Engl J Med 1997;337:373¨C381.! ~; O8 O3 R( K) o& a
; T% d9 L( G. eRubinstein P, Carrier C, Scaradavou A et al. Outcomes among 562 recipients of placental-blood transplants from unrelated donors. N Engl J Med 1998;339:1565¨C1577.
4 \: v8 h% t: F, w F4 Z S9 v5 _9 J' r/ G- _5 w! U9 u) J' F
Lord BI, Woolford LB, Wood LM. Mobilization of early hematopoietic progenitor cells with BB-10010: A genetically engineered variant of human macrophage inflammatory protein-1 alpha. Blood 1995;85:3412¨C3415.
9 N+ @. N2 N3 q. e# P
. J5 Z4 R2 g8 M& M! P+ q( N% b1 R7 gTrentin JJ. Influence of hematopoietic organ stroma (hematopoietic inductive microenvironments) on stem cell differentiation. In: Gordon A, ed. Regulation of Hematopoiesis.New York: Appleton-Century-Crafts,1970;Vol 1:161¨C185.4 w$ d `4 O, C% X
3 ]- X; s! R) l" r* [/ V% \
Wolf NS. The haemopoietic microenvironment. Clin Haematol 1979;8:469¨C500." ^! G, Q$ s2 j! l0 c
; N7 k' ^0 G+ y3 J+ ~
Larochelle A, Vormoor J, Hanenberg H et al. Identification of primitive human hematopoietic cells capable of repopulating NOD/SCID mouse bone marrow: Implications for gene therapy. Nat Med 1996;2:1329¨C1337.) o: ~% ~3 Q# U2 B$ b
. _* ? f9 Q# O8 iPeled A, Petit I, Kollet O et al. Dependence of human stem cell engraftment and repopulation of NOD/SCID mice on CXCR4. Science 1999;283:845¨C848.9 K8 N# x) N* a' d3 l3 k
; j4 ~6 _* |4 U. fKollet O, Petit I, Kahn J et al. Human CD34( )CXCR4(¨C) sorted cells harbor intracellular CXCR4, which can be functionally expressed and provide NOD/SCID repopulation. Blood 2002;100:2778¨C2786.1 O: Q7 h* R! ~& y0 U
( y: o. N- @. `3 k) {5 g
Prockop DJ. Marrow stromal cells as stem cells for nonhematopoietic tissues. Science 1997;276:71¨C74." w; j/ G0 \" t4 I3 Z2 a* `
, M2 F; Y3 i7 d7 \9 h8 k
Pittenger MF, Mackay AM, Beck SC et al. Multilineage potential of adult human mesenchymal stem cells. Science 1999;284:143¨C147., X/ L: `2 T( d6 `
$ @, T; p. y0 H% m! e- Y
Allen TD, Dexter TM. The essential cells of the hemopoietic microenvironment. Exp Hematol 1984;12:517¨C522.
# [4 D% Q3 c5 Y* O
; t- W, q' H# X& U% N+ Y. N6 W3 D+ BDexter TM, Allen TD, Lajtha LD. Conditions controlling the proliferation of hematopoietic stem cells in vivo. J Cell Physiol 1977;91:335¨C339.
; g* e; y0 i$ p3 z1 n; z; f$ Y( C0 P9 a6 V/ T" k( u. m J9 W( ?
Sutherland HJ, Lansdorp PM, Henkelman DH et al. Functional characterization of individual human hematopoietic stem cells cultured at limiting dilution on supportive marrow stromal layers. Proc Natl Acad Sci U S A 1990;87:3584¨C3588.+ j! v3 u% d9 L1 O# l
3 F6 W; I1 X6 o6 w; P. a6 d
Eaves CJ, Cashman JD, Kay RJ et al. Mechanisms that regulate the cell cycle status of very primitive hematopoietic cells in long-term human marrow cultures. II. Analysis of positive and negative regulators produced by stromal cells within the adherent layer. Blood 1991;78:110¨C117.9 u+ \6 O( G; Z2 s
7 f* m9 }4 C2 G$ r
Moore KA, Pytowski B, Witte L et al. Hematopoietic activity of a stromal cell transmembrane protein containing epidermal growth factor-like repeat motifs. Proc Natl Acad Sci U S A 1997;94:4011¨C4016.
& M! { s* v: n- ~, g4 w+ v% x; S; H9 B; f' Z8 C
Karanu FN, Murdoch B, Miyabayashi T et al. Human homologues of Delta-1 and Delta-4 function as mitogenic regulators of primitive human hematopoietic cells. Blood 2001;97:1960¨C1967.7 x5 b* U6 `+ F9 t2 @- L
' T0 u( E9 C) A( P }1 y; q* `: M' Y
Noort WA, Kruisselbrink AB, in't Anker PS et al. Mesenchymal stem cells promote engraftment of human umbilical cord blood-derived CD34( ) cells in NOD/scid mice. Exp Hematol 2002;30:870¨C878.9 L- ~7 [% w. [5 s. ]! F! r
( V2 o( e e, S P
Almeida-Porada G, Porada CD, Tran N et al. Cotransplantation of human stromal cell progenitors into preimmune fetal sheep results in early appearance of human donor cells in circulation and boosts cell levels in marrow at later time points after transplantation. Blood 2000;95:3620¨C3627.) `' R; Y2 S' m2 N/ M* g
* x! |3 l' w3 T5 f" G8 ]
Koc ON, Gerson SL, Cooper BW et al. Rapid hematopoietic recovery after coinfusion of autologous-blood stem cells and culture-expanded marrow mesenchymal stem cells in advanced breast cancer patients receiving high-dose chemotherapy. J Clin Oncol 2000;18:307¨C336./ N- ~/ B% J* [8 l0 @! B
# d% _+ E0 U: [$ e4 t0 S0 Z
Koc ON, Lazarus HM. Mesenchymal stem cells: Heading into the clinic. Bone Marrow Transplant 2001;27:244¨C255.
Q9 g: k, d% D. l) {
, U3 V' ?4 p8 v4 c5 N- y* {, D/ A% ]Madhusudhan T, Majumdar SS, Mukhopadhyay A. Degeneration of stroma reduces retention of homed cells in bone marrow of lethally irradiated mice. Stem Cells Dev 2004;13:173¨C182.+ x' z6 F1 ^/ F3 T* t- b' J' v2 g+ ^, W
6 X* A& K. k. W7 j8 N3 H! |, aFouillard L, Bensidhoum M, Bories D et al. Engraftment of allogeneic mesenchymal stem cells in the bone marrow of a patient with severe idiopathic aplastic anemia improves stroma. Leukemia 2003;17:474¨C476.
9 p' W' P5 ^. ]4 R) x* s! |( M+ \9 g( [( V9 G& J" T" l
Koegler G, Sensken S, Airey JA et al. A new human somatic stem cell from placental cord blood with intrinsic pluripotent differentiation potential. J Exp Med 2004;200:123¨C135.
7 I% A W, w* k1 W9 U" f/ `2 O
$ f8 P' a+ m- a/ g) KWang J-F, Wang L-J, Wu Y-F et al. Mesenchymal stem/progenitor cells in human umbilical cord blood as support for ex vivo expansion of CD34 hematopoietic stem cells and for chondrogenic differentiation. Haematologica 2004;89:837¨C844.9 k8 v1 T9 [# e( u
6 |5 Q% }6 e* b4 O, _Kogler G, Radke TF, Lefort A et al. Cytokine production and hematopoiesis supporting activity of cord blood-derived unrestricted somatic stem cells. Exp Hematol 2005;5:573¨C583.4 }9 X$ ?$ n- w4 L; i
4 g- n7 T l5 d5 v
Ahmed F, Ings SJ, Pizzey AR et al. Impaired bone marrow homing of cytokine-activated CD34 cells in the NOD/SCID model. Blood 2004;103:2079¨C2087.
0 C0 q0 M8 b A/ C) p
" R ?7 w* _% G- s7 ?Kahn J, Byk T, Jansson-Sjostrand L et al. Overexpression of CXCR4 on human CD34 progenitors increases their proliferation, migration, and NOD/SCID repopulation. Blood 2004;103:2942¨C2949.# P$ g4 P# s8 o
* r$ y4 f$ o4 P( h+ `1 {1 o; k8 GMackin W, Gunter K, Kraus M. The frontier of cellular medicine: Expanding umbilical cord blood stem cells for clinical use. Cancer J 2001;7 (suppl 2):95¨C105./ E* w2 ?$ s- @
. u2 V, U5 X: F3 C& LGlimm H, Tang P, Clark-Lewis I et al. Ex vivo treatment of proliferating human cord blood stem cells with stroma-derived factor-1 enhances their ability to engraft NOD/SCID mice. Blood 2002;99:3454¨C3457.
, X4 ^: i8 }' q" P
. A: \$ x/ f" R9 H5 d* l! i( WLi K, Chuen CK, Lee SM et al. Small peptide analog of SDF-1alpha supports survival of cord blood CD34 cells in synergy with other cytokines, enhances their ex vivo expansion and engraftment into NOD/SCID mice. STEM CELLS 2006;24:55¨C64.5 i7 w/ B7 a+ G" K" s% i- @/ x
! m# ^* L8 v5 y; ]Bensidhoum M, Chapel A, Francois S et al. Homing of in vitro expanded Stro-1- or Stro1 human mesenchymal stem cells into the NOD/SCID mouse and their role in supporting human CD34 cell engraftment. Blood 2004;103:3313¨C3319.. f% _% i) M0 n* O5 y% }# H
4 ^! s. `# i# S! U% IKim DW, Chung YJ, Kim TG et al. Cotransplantation of third-party mesenchymal stromal cells can alleviate single-donor predominance and increase engraftment from double cord transplantation. Blood 2004;103:1941¨C1948.' ?& v& H |% O# ?. A* U
$ |- A3 a% w* {Plett PA, Frankovitz SM, Wolber FM et al. Treatment of circulating CD34( ) cells with SDF-1 alpha or anti-CXCR4 antibody enhances migration and NOD/SCID repopulating potential. Exp Hematol 2002;30:1061¨C1069.! f4 x7 W; j) h. {
3 @: B }9 C7 U; JPetit I, Goichberg P, Spiegel A et al. Atypical PKC-zeta regulates SDF-1-mediated migration and development of human CD34 progenitor cells. J Clin Invest 2005;115:168¨C176.8 P" J0 V' [6 a( @/ k
/ G- L8 l2 j& X9 lLu LL, Liu YJ, Yang SG et al. Isolation and characterization of human umbilical cord mesenchymal stem cells with hematopoiesis-supportive function and other potentials. Haematologica 2006;91:1017¨C1026. |
|