|
 
- 积分
- 429
- 威望
- 429
- 包包
- 1768
|
本帖最后由 qianqianlaile 于 2011-3-22 22:26 编辑
0 f( M( j( E9 R; R2 y. s# u4 }
1 W* r3 m( N, @: FMATERIALS AND METHODS 0 e0 n- m; [4 {4 [+ G4 d; g& B n8 ~
Isolation of Dental-Derived Stem Cells (PDLSCs, SHEDs) 3 G! [1 q' S+ P) A& k6 l; |
PDLSCs and SHEDs were harvested as previously described (Miura et. al, 2003; Seo et. 8 D3 Y( M2 S( y+ g
al, 2004). Briefly, PDLSCs were scraped from the root surface of a tooth into a p60 dish
3 S* J2 x6 u, ^! I- i$ [containing minimum essential alpha medium (DMEM, Gibco) and SHEDs were harvested by 6 r. n+ O4 D' N2 T) [
scraping out the dental pulp tissue from a deciduous tooth into a p60 dish containing DMEM.
3 _2 b0 o# \, [- I) aAfter collection, the cells were centrifuged at 1600 rpm for 5 minutes at room temperature. The , `' j' C; _" z
supernatant was aspirated and the cells were resuspended in a phosphate buffered saline (PBS;
) U. B& g2 ?# ~) l# N, `2 zGibco #14190) solution with 4 mg/ml Dispase II (Roche #04 942 078 001) and 2 mg/ml% d! L+ A7 }. I2 V4 h q4 E) s8 ~
Collagenase Type II (Worthington # LS004196) and incubated at 37°C for 60 minutes. The
& b/ i, v* r( K! Wenzyme solution was inactivated with 5 ml of DMEM- 15% FBS- 100µM ascorbic acid 2
' L2 Q: G. O" u8 b3 J! Z- w1 pphosphate (ASAP, Sigma A-8960) and centrifuged at 1600 rpm for 5 minutes at room
/ M+ P" H% o% Ttemperature. Cells were resuspeneded in 5 ml DMEM- 15% FBS- 0.1mM ASAP and transferred
9 X) d) e/ y1 s9 e( R; Bto T-25 flasks. Media was changed the next day and then every 2-3 days. ' S' f" @# x; K, M. E# B0 M
Cell Culture) q+ \6 Q8 S/ q T( `/ e3 |
Cells were expanded in culture in DMEM, Iscove’s modified Dulbecco’s media (IMDM, $ ?, R2 [8 A" f! c9 q
Gibco-Invitrogen #12571), Gibco Stem Pro Mesenchymal Stem Cell Serum-Free Media 4 _# w K$ J4 y, Z& o
(MSCSFM; Invitrogen# A1033401) or Lonza Therapeak Mesenchymal Stem Cell Growth 3 Z; I6 `9 ?8 y- Y: B! w. ~6 V
Media- Chemically Defined (MSCGM-CD; Lonza #00190632) and grown in a 37°C humidified
5 C/ i! H8 U) Ntissue culture incubator at 5% CO2. Media formulations are as follows: DMem (Gibco- A& y1 f) Y X6 M
Invitrogen #12571) with 15% FBS (Gibco-Invitrogen-16000), 100µM ASAP and 5 µg/ml- @. l, ^* P& R* M3 D/ c
Gentamicin (Invitrogen # 15750060) (FBS-M); DMem with 2% bovine serum albumin (BSA;
; y/ ^! C) F! P, ~/ e" OSigma A7888), 10ug/ml human insulin (Sigma), 4ug/ml low density lipoprotein, 200ug/ml+ k) ^# y1 R# m' M: u7 c( p
transferrin, 10 nM dexamethasone, 100 uM ASAP, 50 uM ȕ-mercaptoethanol, 5 ug/ml
& p; {; E9 z- U6 Q: jgentamicin, 10ng/ml platelet-derived growth factor (PDGF; Sigma), 10ng/ml epidermal growth
9 ~2 s* ^0 I$ [9 |( Ufactor (EGF; R&D Systems), 10ng/ml basic fibroblast growth factor (b-FGF, Sigma) (SDM);
& w& C4 K+ T7 Y1 K: [IMDM with 0.2% BSA, SITE 3 (Sigma #S5295), 384µM ASAP, 10 ng/ml PDGF, 10ng/ml6 i9 e7 }2 N& d4 F8 i( I" Z8 q8 P
hydrocortisone 5ng/ml b-FGF, 1 ng/ml EGF, 10-7/ @. k6 i8 i( v+ ~9 j( F, R. X+ v D
mgm/ml parathyroid hormone (PTH) and 5
" o1 E) P* f3 fµg/ml gentamicin (K-M). Media on the cells were changed every 2 or 3 days. Cells were grown
- i+ z8 N" e* @ Win T-150 flasks to about 80% confluency then media was aspirated from the flasks, cells were 1 G2 @- P5 g: X6 R6 \
washed with PBS and trypsinized with TrypLE Express (Gibco#12605) before being split into 12
3 r7 j- ]$ |! n, C/ pwell plates for the assays.
6 V0 c$ j- [" U4 b& SFibronectin Coating of Tissue Culture Plates
# o( l% S; N, S1 u3 mFibronectin (FN) was coated on the plates and flasks to provide growth and attachment5 f% z% U4 C2 H: Y, G! f
support for cells grown in the serum-free, IMDM media. For the 12 well plates, 0.1% FN 9 M i4 }$ E$ _: ~6 |+ S0 h
solution (Sigma F-1141) was diluted in PBS so that each well received 3.8 micrograms per well : u, e& A( R# x9 H+ f [
(1µg FN/cm2). The T-150 flasks were coated so that each received 150 micrograms of FN (1µg 7 W; w. y1 U' L+ y6 }) u& r6 M
FN /cm2). The plates and flasks were tilted back and forth to ensure complete coverage of the
6 `) f. C4 W+ e% {5 W6 x+ cFN solution. The FN coating was allowed to stand at room temperature for 90 minutes. The FN ) ^8 j5 n. |" x; a1 V3 T# b6 w2 @1 {
solution was then aspirated before the resuspended cells were transferred to the flasks and plates.5 L/ x) y3 M8 n* m- s! \
Proliferation Assays; P8 s$ u1 L4 D+ S
After trypsinization cells were resuspended in an equal amount of the appropriate media
; X* @/ ?. B) \1 |: A1 Rbefore an aliquot was removed for counting on a hemocytometer to determine the concentration.
2 Y- N$ C% |6 x9 a/ |/ W% GThe cells were then centrifuged at ~1600 rpm for 5 minutes at room temperature. Cells were & [! c$ M8 t) v0 H4 u
resuspended in the appropriate media at a concentration of 3800 cells per ml. One milliliter of & e# n- d n. _! l
cells was dispensed into each well of a 12 well plate. K-M plates were precoated with FN
B5 N% `0 G$ K7 }% n- F& j Q5 r0 v7 @solution (as outlined above). Four plates for each cell type and media condition were plated and
# P$ ^! H0 Q' z" U" g& k I( p* ~counted on a hemocytometer at days 1, 3, 5 and 7 to determine the cell numbers within each 5 E( H' o3 a6 k! C
well. All experiments were performed in triplicate.
" K7 B( X8 m+ Y+ X. e, u$ yRNA Isolation and Purification for MicroArray
) r) f" r+ w+ V/ p: DPDLSCs and SHEDs were grown in T-75 flasks to 80% confluency before the cells were
9 k4 p: p! N# ?% yharvested for RNA. The Trizol method (Invitrogen) was used for RNA isolation. This involved 8 o) |8 e8 V4 _: X# N1 k) u3 G
washing the cell layer with PBS, adding Trizol directly to the cells and transferring this cell + k2 ]' B$ n9 s& D6 N; A
suspension to polypropylene tubes. RNA was isolated from the cells by a Trizol-choloroform8 [; ]) x+ Q. Z4 \
extraction, isopropanol precipitation, an ethanol rinse and resuspension of theRNA pellet in
% i: L1 E" \- B8 z6 i' d( HDiethylpyrocarbonate (DEPC) water. The RNA was further purified by column
4 r G8 o: Z* ]) S7 L" }chromatography, following manufacturer’s instructions (Qiagen RNeasy Kit # 74104), and - p3 M2 j) l' h" H
resuspended in DEPC water. RNA concentration was determined by the 260/280 absorbance
! E' y3 l- F# }! ]# P+ d4 l$ jmeasurement using a Beckman DU540 spectrophotometer.
- t% c: H* N6 }5 s3 xIn Vitro Multilineage Differentiation * Q% i( f6 |2 {9 P3 Z0 v3 B. G' Z
Multipotency of PDLSCs and SHEDs was determined through lineage specific
' T. n: `% B5 e8 u" _osteogenic, chondrogenic, and adipogenic induction, according to previously described methods
9 }* w' S& J# P9 i" ^0 F(Pittenger et. al, 1999). Briefly, cells were plated at a density of 30,000 cells per well in 12 well
; v* f/ s1 |8 o0 S& ?plates. At 80% confluency cells were induced with osteogenic [Growth media plus 5mM E-$ V! K, T. c) I7 C
glycerophosphate, 100nM dexamethasone, 50µM ascorbic acid 2-phosphate] or chondrogenic 6 O- |+ @* H1 ^# T; u
[growth media plus 50µM ascorbic acid 2-phosphate, 100nM dexamethasone, 5 µg/ml human: V; u! m% ?2 U+ @% n
insulin (Sigma I-9278), 1 ng/ml TGFE, 400µM proline, 1X Non essential amino acids] or
- \8 r, M* f& |5 g* ]7 Wadipogenic [growth media plus 0.5mM IBMX, 1 µM dexamethasone, 10 µg/ml human insulin,
* A6 F7 d( | D- W9 ?% n* d200µM indomethacin] induction media. Cells were grown at 37°C in a humidified 5% CO2
2 B$ I7 W% e2 k# bincubator. The media was changed every 2-3 days. At three weeks the cells were fixed and
; M# A( ^9 }- Tstained as outlined below. # f" L. q) x6 _( M0 {# W) N2 J
Multipotent Staining of PDLSCs and SHEDs
! \$ e9 u; N% \ {5 H iTo identify the mineralized nodules, induced PDLSC, SHED and DPSC were fixed in 4%
+ R; d9 G0 J$ Cparaformaldehyde for 30 minutes, immersed in fresh 5% silver nitrate and incubated in the dark
7 U! x* A' ^! N8 rfor 30 minutes. After washing in water the PDLSC, SHED and DPSC were exposed to 5 N, v( E$ T$ K
ultraviolet light for 30 minutes followed by a four minute incubation in 1% sodium thiosulfate to / r) k+ I6 ?1 {* o' h' J3 z
neutralize the silver nitrate. Cells were washed twice with water before 1 ml of PBS was added / U7 W) B; a& U6 c! Q
to each well and viewed. Plates were stored at 4°C.
] `$ k3 [( F0 x; M' [To detect chondrogenic differentiation induced PDLSC, SHED and DPSC were fixed in " G- I6 l$ v. [
cold 100% methanol for 30 minutes and then exposed to 1% alcian blue in 0.1N HCl for 30 : M! ]' s! M% R0 h W
minutes. Cells were washed twice with 0.1N HCl before 1 ml of PBS was added to each well
" T6 G" C9 F# g# W, f: t- a: Qand viewed. Plates were stored at 4°C.
. |; T- x: L8 F9 kTo detect adipogenic differentiation by identifying lipid vesicles, induced PDLSC, SHED
& u; H% X2 h2 ~) w0 i5 V9 W3 w0 xand DPSC were fixed in 4% paraformaldehyde for 30 minutes, and then immersed in 0.3% oil 6 x1 _$ i% ]6 H9 n2 B9 X) d
red O solution for 30 minutes. Cells were washed twice with water before 1 ml of PBS was
2 g C% l9 B: n% Dadded to each well and viewed. Plates were stored at 4°C.
( V% z" m/ i- n KAlkaline Phosphatase Activity and Detection n9 @/ P' w9 p
Early osteogenic differentiation was detected and quantified by the alkaline phosphatase ! ]5 Y4 a: h" z& ?% j$ ~4 G1 ]
(ALP) enzyme assay. Cells were plated at a density of 30,000 cells per well in 12 well plates. `! O# Z% }5 k+ o& z
At 80% confluence, cells were induced with osteogenic media as described above. The media
! f4 |/ d9 [ I- U2 Wwas changed every 2-3 days and after one week, ALP activity was measured.
; s/ l M# c: s- aTo detect phosphatase activity, PDLSCs and SHEDs were fixed in 70% ethanol for 30
- K" m1 F- V( D% Z2 O" C* qminutes. They were then incubated with freshly made substrate containing naphthol AS-TR
& V2 d; Y. ?. J# E% v J" ]phosphate (Sigma) and Fast blue (Sigma) for 30 minutes. Cells were washed twice with PBS then
( `. Z, }8 Q# c, _# o/ |viewed or stored at 4’C.
5 G( \( t. W; d9 D' O( p4 ~To quantify the ALP activity and normalize the results, cells were lysed in Passive Lysis / q P/ `& g9 Y6 U3 R6 z H: L4 s
Buffer (Promega) according to manufacturer’s instructions. Cell lysates were then sonicated, 2 V" ]7 [! h s& u. a- {
and centrifuged (10,000 rpm for 10 minutes at 4°C). The supernatant was recovered for the
% z4 e& F8 x5 B+ E a7 @quantitative colormetric ALP assay (Manolagas et al., 1981) and the cell pellet was used for - r$ O& k" a+ c. b3 ?
DNA isolation and the determination of the DNA concentration using the Quant-iT™ dsDNA 7 s* b5 I5 ?* F
BR Assay (Invitrogen) per the manufacturer’s instructions. $ _( s a1 Y0 o) g
Reverse Transcriptase Polymerase Chain Reaction (RT-PCR)
4 _5 s- R/ K; i4 E2 B4 a- LTo confirm chondrogenic and adipogenic differentiation, total PDLSC and SHED cellular ! q1 z) f ~9 d O9 g4 J
RNA was extracted, reverse transcribed, and amplified using osteoblast specific gene primers.) N u2 f" U9 z4 L8 z3 ^) y- d
Media from the wells of induced and uninduced PDLSCs and SHEDs were aspirated. Cells
4 ~+ g* p" o% Z6 s6 C4 i( ^were immediately resuspended in 1 ml of Trizol (Invitrogen) and RNA was isolated according to ! j* P( {3 \# L( E9 |6 m U0 t
the manufacturer’s instructions. Synthesis of cDNA was performed using Invitrogen’s
" y* i* o2 Q9 j: o; p- [" \* Q8 hSuperScriptII kit and oligo dT. PCR reaction components and concentrations were as described
3 d, j+ }% C. Yin the Invitrogen Platinum Taq polymerase instructions using the primer sets below. An MJ
6 u% f- g/ W j) M. Z% @6 gthemorcycler was used for the following two PCR reaction conditions: $ ]8 I! O; l, C, h
*94°C 2 minutes [94°C 45” 56°C 45” 72°C 1’] X 35 cycles 72°C 15’
0 x2 D7 d; y3 i0 ]3 Z: m! ]% Lor
# r+ c, J* ?/ N" ~& [% l$ P& [**94°C 2 minutes [94°C 45” 67°C 45” 72°C 1’] X 35 cycles 72°C 15’ 2 j9 t7 G7 z& ^+ ]# t5 W7 A! l1 B
PCR Primer Pairs
# H6 e1 f* Z* v1 r2 n# SPrimer Name Primer Sequence Product
8 J- j! V4 x8 Y- O4 ]5 e |6 xSize+ H- O! x. {% f. v8 |6 T
Accession( `$ X& S( E0 w& j# W
Number
1 O/ |4 `) q* A; X5 j5 m' S. J*GAPDH FWD AGCCGCATCTTCTTTTGCGTC 815 bp NM_002046
8 i( i/ B, p0 o0 {: \*GAPDH REV TCATATTTGGCAGGTTTTTCT7 B6 H+ |4 a2 N: U" s' U) p
PPARJ2 FWD GCTGTGCAGGAGATCACAGA 226 bp NM_005037
* O! R5 j0 Z8 X; j4 V* GPPARJ2 REV GGGCTCCATAAAGTCACCAA
0 n5 t/ P/ V4 m9 [, gLipoprotein lipase FWD GTCCGTGGCTACCTGTCATT 212 bp NM_000237
% e" q, I! T$ \" l; Y: U* rLipoprotein lipase REV TGTCCCACCAGTTTGGTGTA
8 |" H/ D6 K2 g! M& R1 g1 XSox 9 FWD TTGAGCCTTAAAACGGTGCT 224 bp NM000346
+ D: y4 r' C' {, l" x/ t. vSox 9 REV CTGGTGTTCTGAGAGGCACA+ T& t: v3 d1 F& X, i, S9 V# ~, R
Type X collagen FWD TGAGCAGCAACGTAAAAACG 471 bp NM_00049
+ I% C# ^2 J% c; j8 a" ]- U0 J: nType X collagen REV AGGAAATGCCGAGTTTCTCA
! B% T( j3 m4 s* A* C/ n3 {0 o8 g3 MStatistical Analysis
, i( C4 `# ]3 c# t+ SStatistical analysis was performed with the use of Instat software (GraphPad Software, San
9 r9 y1 W! s# W+ B8 u9 Q' r; r0 DDiego, CA, USA). All data were plotted as mean ± standard error of the mean (SEM), unless
( P5 L# T, {1 V& wotherwise noted. Statistically significant differences were determined by two-tailed Student t
4 _. z/ {: J' s8 i0 p* N" [. Jtests, and statistical significance was defined as p < 0.05. |
|
发表于 2011-3-20 08:21
，脑子里也没有独家生产这个概念
，所以没理解。
