|
 
- 积分
- 429
- 威望
- 429
- 包包
- 1768
|
本帖最后由 qianqianlaile 于 2011-3-22 22:26 编辑
! J7 ]* X O" A2 l' W. t' L, a+ d( o, g# J
MATERIALS AND METHODS
2 i* x }, B! s" c+ C0 Q5 D- \9 kIsolation of Dental-Derived Stem Cells (PDLSCs, SHEDs) % c- m5 B# A$ F* B7 h, N3 s; H* ?
PDLSCs and SHEDs were harvested as previously described (Miura et. al, 2003; Seo et.
- b( Z! M$ e' \al, 2004). Briefly, PDLSCs were scraped from the root surface of a tooth into a p60 dish
) k7 }& P! k6 h. G+ D/ D. gcontaining minimum essential alpha medium (DMEM, Gibco) and SHEDs were harvested by
: J" O5 U1 u- o w' g- t. Nscraping out the dental pulp tissue from a deciduous tooth into a p60 dish containing DMEM.8 z2 U0 o2 r2 i5 ?
After collection, the cells were centrifuged at 1600 rpm for 5 minutes at room temperature. The / R p- D% w" b; y; b
supernatant was aspirated and the cells were resuspended in a phosphate buffered saline (PBS; j( A2 c, `8 q" V& N+ L
Gibco #14190) solution with 4 mg/ml Dispase II (Roche #04 942 078 001) and 2 mg/ml3 K$ `) w" N* }/ ^" q
Collagenase Type II (Worthington # LS004196) and incubated at 37°C for 60 minutes. The , `' E5 {4 ~. t- V2 A
enzyme solution was inactivated with 5 ml of DMEM- 15% FBS- 100µM ascorbic acid 2 ' |; q* [3 P8 e) q
phosphate (ASAP, Sigma A-8960) and centrifuged at 1600 rpm for 5 minutes at room& d! i0 F+ M! C2 N) `% H! U
temperature. Cells were resuspeneded in 5 ml DMEM- 15% FBS- 0.1mM ASAP and transferred / j0 z) r0 `. O' z4 k6 b# t6 v
to T-25 flasks. Media was changed the next day and then every 2-3 days. 3 Q/ _+ W: I1 s0 M
Cell Culture! K/ ~6 P5 v$ N
Cells were expanded in culture in DMEM, Iscove’s modified Dulbecco’s media (IMDM, * l7 S. \8 P# F& J$ @1 S' x6 T
Gibco-Invitrogen #12571), Gibco Stem Pro Mesenchymal Stem Cell Serum-Free Media 2 l% a: W, i$ f; W2 n7 i
(MSCSFM; Invitrogen# A1033401) or Lonza Therapeak Mesenchymal Stem Cell Growth
6 i$ ~3 i0 x% t" hMedia- Chemically Defined (MSCGM-CD; Lonza #00190632) and grown in a 37°C humidified, p; k' @1 m L& a
tissue culture incubator at 5% CO2. Media formulations are as follows: DMem (Gibco-2 {6 [. l+ I+ }4 L% d$ @& v
Invitrogen #12571) with 15% FBS (Gibco-Invitrogen-16000), 100µM ASAP and 5 µg/ml+ V2 R' m+ }0 r d$ v, h0 h' h) x
Gentamicin (Invitrogen # 15750060) (FBS-M); DMem with 2% bovine serum albumin (BSA;
) w' U/ n: X: X- _) \0 y$ bSigma A7888), 10ug/ml human insulin (Sigma), 4ug/ml low density lipoprotein, 200ug/ml
- A* c2 f2 r5 r& |transferrin, 10 nM dexamethasone, 100 uM ASAP, 50 uM ȕ-mercaptoethanol, 5 ug/ml
" a! B3 h9 ?' F7 mgentamicin, 10ng/ml platelet-derived growth factor (PDGF; Sigma), 10ng/ml epidermal growth
4 x5 x m5 o; ]( H3 }( f) t. J7 ifactor (EGF; R&D Systems), 10ng/ml basic fibroblast growth factor (b-FGF, Sigma) (SDM);; T, a2 ~& w- @: [4 v, N, K) t
IMDM with 0.2% BSA, SITE 3 (Sigma #S5295), 384µM ASAP, 10 ng/ml PDGF, 10ng/ml9 A! B7 L7 ]6 O
hydrocortisone 5ng/ml b-FGF, 1 ng/ml EGF, 10-7
* k6 a w4 j3 |# m# G; Y9 _+ f mgm/ml parathyroid hormone (PTH) and 5 5 B( K/ R0 o/ N! P
µg/ml gentamicin (K-M). Media on the cells were changed every 2 or 3 days. Cells were grown' t! n. \$ k3 ^# V- c9 o
in T-150 flasks to about 80% confluency then media was aspirated from the flasks, cells were
9 @0 i0 f4 a1 d bwashed with PBS and trypsinized with TrypLE Express (Gibco#12605) before being split into 12
* _; Q4 j: z: F9 ywell plates for the assays. , x& l( s: o' `9 P
Fibronectin Coating of Tissue Culture Plates
: t9 X( V3 s( W0 Z5 i" UFibronectin (FN) was coated on the plates and flasks to provide growth and attachment
0 E( o( q2 u7 F* R( z: J; r; @: s/ ?support for cells grown in the serum-free, IMDM media. For the 12 well plates, 0.1% FN
6 q( _# G6 ^) s: Q- o3 q: o( S2 ~solution (Sigma F-1141) was diluted in PBS so that each well received 3.8 micrograms per well
7 F+ e* g9 S7 F. }9 W8 w Y(1µg FN/cm2). The T-150 flasks were coated so that each received 150 micrograms of FN (1µg
" V2 V' ^2 u$ g8 z0 W) DFN /cm2). The plates and flasks were tilted back and forth to ensure complete coverage of the ) w8 D4 o* I, d- B# Q# ^
FN solution. The FN coating was allowed to stand at room temperature for 90 minutes. The FN 7 w7 [" `5 F/ Z( M
solution was then aspirated before the resuspended cells were transferred to the flasks and plates.
Z d( b0 u! M* L. j6 s! T6 F0 bProliferation Assays( f8 n7 Y; Y2 ]1 J6 B& y2 u( h
After trypsinization cells were resuspended in an equal amount of the appropriate media0 T( G7 |" H C0 m; S
before an aliquot was removed for counting on a hemocytometer to determine the concentration.6 u( I+ ~. o" I: d# F8 g
The cells were then centrifuged at ~1600 rpm for 5 minutes at room temperature. Cells were
5 f# A( A5 S" w* m4 J& [$ Uresuspended in the appropriate media at a concentration of 3800 cells per ml. One milliliter of
4 I# g6 }, X+ fcells was dispensed into each well of a 12 well plate. K-M plates were precoated with FN
" U8 ?6 D- P5 \3 C2 @solution (as outlined above). Four plates for each cell type and media condition were plated and
' R3 u2 d2 z* M( A$ ucounted on a hemocytometer at days 1, 3, 5 and 7 to determine the cell numbers within each 5 [7 y6 `, \7 t2 l/ K
well. All experiments were performed in triplicate. # ^1 G+ @- d4 u# O/ `& K
RNA Isolation and Purification for MicroArray + {0 i" P* L; T
PDLSCs and SHEDs were grown in T-75 flasks to 80% confluency before the cells were
1 v, Z$ ]( H! F- M, g* l+ h" iharvested for RNA. The Trizol method (Invitrogen) was used for RNA isolation. This involved
% I( `' f: L/ W8 [washing the cell layer with PBS, adding Trizol directly to the cells and transferring this cell
& K# f4 P) B" d4 h# M6 A' L* P* nsuspension to polypropylene tubes. RNA was isolated from the cells by a Trizol-choloroform
1 x" z+ Z7 U- X9 x2 gextraction, isopropanol precipitation, an ethanol rinse and resuspension of theRNA pellet in
3 c& ]6 e7 p- c% s& a# V" e2 ^Diethylpyrocarbonate (DEPC) water. The RNA was further purified by column
" J: |% M8 {: v, Jchromatography, following manufacturer’s instructions (Qiagen RNeasy Kit # 74104), and ; H! z9 G8 ?2 f' G
resuspended in DEPC water. RNA concentration was determined by the 260/280 absorbance 1 R4 X8 Q) H: d
measurement using a Beckman DU540 spectrophotometer.* G" _3 \4 x# H; H. O
In Vitro Multilineage Differentiation $ ?2 A" Z/ M3 Z) A: b- ^& |
Multipotency of PDLSCs and SHEDs was determined through lineage specific
4 r2 {3 ^! R6 J6 d# |1 ^osteogenic, chondrogenic, and adipogenic induction, according to previously described methods
; j0 }1 Q, H8 x s' z0 ^(Pittenger et. al, 1999). Briefly, cells were plated at a density of 30,000 cells per well in 12 well 4 j1 H" E, ~" S4 q2 Z5 S- ^
plates. At 80% confluency cells were induced with osteogenic [Growth media plus 5mM E-1 ^$ G5 u# w8 u* x3 w; q l9 ^4 [( x
glycerophosphate, 100nM dexamethasone, 50µM ascorbic acid 2-phosphate] or chondrogenic g, l' n# I3 x, E% ?+ p- o
[growth media plus 50µM ascorbic acid 2-phosphate, 100nM dexamethasone, 5 µg/ml human
0 u" @- \. h4 R) K8 @+ W3 u1 {insulin (Sigma I-9278), 1 ng/ml TGFE, 400µM proline, 1X Non essential amino acids] or
& u( G8 u. n6 u- L7 z& wadipogenic [growth media plus 0.5mM IBMX, 1 µM dexamethasone, 10 µg/ml human insulin,
) `+ f: z) D. R, z$ F3 [; v! B200µM indomethacin] induction media. Cells were grown at 37°C in a humidified 5% CO2
+ V- a, g1 G7 vincubator. The media was changed every 2-3 days. At three weeks the cells were fixed and
# }+ {& d4 a% W I6 v+ Ustained as outlined below.
- w( v/ ]5 x- ?, P9 T* O8 m. AMultipotent Staining of PDLSCs and SHEDs
4 |* T( B/ k# s+ rTo identify the mineralized nodules, induced PDLSC, SHED and DPSC were fixed in 4%
, s. Y9 s2 R0 X! [6 n. `paraformaldehyde for 30 minutes, immersed in fresh 5% silver nitrate and incubated in the dark # ^ |2 K- I) h- r; m% a0 {
for 30 minutes. After washing in water the PDLSC, SHED and DPSC were exposed to ' Q. B) g$ S+ n2 q+ P# e
ultraviolet light for 30 minutes followed by a four minute incubation in 1% sodium thiosulfate to , `) L+ G9 X& `6 ^
neutralize the silver nitrate. Cells were washed twice with water before 1 ml of PBS was added
. l0 i, r$ D) f l: V, qto each well and viewed. Plates were stored at 4°C. 1 C4 w* A4 T. X( {5 }/ H
To detect chondrogenic differentiation induced PDLSC, SHED and DPSC were fixed in & \2 B/ d5 Z/ L5 }" z
cold 100% methanol for 30 minutes and then exposed to 1% alcian blue in 0.1N HCl for 30
1 |$ }) u# w/ f5 U8 J- bminutes. Cells were washed twice with 0.1N HCl before 1 ml of PBS was added to each well
V9 O% G# g4 q$ [! m0 gand viewed. Plates were stored at 4°C.. g+ F" M/ k' R. c
To detect adipogenic differentiation by identifying lipid vesicles, induced PDLSC, SHED & j; |/ i8 U. z- n# r
and DPSC were fixed in 4% paraformaldehyde for 30 minutes, and then immersed in 0.3% oil
: @" X' k# o9 Y% W! a3 |; E8 X9 lred O solution for 30 minutes. Cells were washed twice with water before 1 ml of PBS was # s& X* y' C$ T( F
added to each well and viewed. Plates were stored at 4°C.
. l2 F, A% {# U3 O' DAlkaline Phosphatase Activity and Detection
; {9 {( r' L Q+ g, @1 FEarly osteogenic differentiation was detected and quantified by the alkaline phosphatase # D- R+ K- B5 y) T6 J) w
(ALP) enzyme assay. Cells were plated at a density of 30,000 cells per well in 12 well plates.
/ e$ Y% X% J' A1 t& { j4 sAt 80% confluence, cells were induced with osteogenic media as described above. The media& {3 a) \/ f8 B+ r+ r6 f
was changed every 2-3 days and after one week, ALP activity was measured.9 w5 a, F& {, i( q" X3 g0 |9 ?
To detect phosphatase activity, PDLSCs and SHEDs were fixed in 70% ethanol for 30 3 {, F+ d# w8 b3 X& c7 Y: _' Z5 ?8 E& h
minutes. They were then incubated with freshly made substrate containing naphthol AS-TR 9 w3 P l* v2 R& [4 S0 A4 I/ c' k
phosphate (Sigma) and Fast blue (Sigma) for 30 minutes. Cells were washed twice with PBS then
/ R8 f# r# E6 L Nviewed or stored at 4’C.
2 k1 L9 h1 G0 x F( U7 ]; \5 M1 y, xTo quantify the ALP activity and normalize the results, cells were lysed in Passive Lysis
# e5 m) \& \: rBuffer (Promega) according to manufacturer’s instructions. Cell lysates were then sonicated, ( [7 N h! B2 K$ _" A% q/ K ` a
and centrifuged (10,000 rpm for 10 minutes at 4°C). The supernatant was recovered for the 1 n2 O2 B, W6 ^ }$ w) Z' Y
quantitative colormetric ALP assay (Manolagas et al., 1981) and the cell pellet was used for * \8 c& \0 O r8 I f" }
DNA isolation and the determination of the DNA concentration using the Quant-iT™ dsDNA
* r4 b' E G0 S# S5 I# D$ ^BR Assay (Invitrogen) per the manufacturer’s instructions.
, U& j. {0 [+ ~' h8 O9 J/ o- b2 WReverse Transcriptase Polymerase Chain Reaction (RT-PCR) 1 g+ I* Z% r. n; C
To confirm chondrogenic and adipogenic differentiation, total PDLSC and SHED cellular / v; l5 u& O# \2 U4 d2 t# U. S! A' _
RNA was extracted, reverse transcribed, and amplified using osteoblast specific gene primers.$ h4 f1 `- {9 p5 n# p
Media from the wells of induced and uninduced PDLSCs and SHEDs were aspirated. Cells
. n; E- v w) C6 fwere immediately resuspended in 1 ml of Trizol (Invitrogen) and RNA was isolated according to
3 }2 W1 C5 c6 a Nthe manufacturer’s instructions. Synthesis of cDNA was performed using Invitrogen’s 8 x+ Y: S9 z8 w* A9 i
SuperScriptII kit and oligo dT. PCR reaction components and concentrations were as described ! L! `* B' Q0 P2 } h& f! M
in the Invitrogen Platinum Taq polymerase instructions using the primer sets below. An MJ
' I5 G9 C1 _2 q9 z# i2 X. Z6 z2 O; |) tthemorcycler was used for the following two PCR reaction conditions: & t* k& q% {! J" c& `6 k1 }4 K
*94°C 2 minutes [94°C 45” 56°C 45” 72°C 1’] X 35 cycles 72°C 15’ 8 I5 K5 @% w. y5 M! L6 g P3 Q
or
2 _9 X0 ?9 X. z**94°C 2 minutes [94°C 45” 67°C 45” 72°C 1’] X 35 cycles 72°C 15’
- v( p; F8 k# @8 N$ C* v* P6 [PCR Primer Pairs
: ~/ Q. N+ M6 `Primer Name Primer Sequence Product/ q5 e! \4 M$ D
Size2 ?' |- Z; T$ H# b2 j$ ?6 R
Accession
/ _' L8 l- \4 S- V B: i( V. bNumber
* G5 `' d4 g6 F% B3 R, F1 a*GAPDH FWD AGCCGCATCTTCTTTTGCGTC 815 bp NM_002046' H g- T9 [9 n
*GAPDH REV TCATATTTGGCAGGTTTTTCT1 Y1 z" p9 {0 ` ?8 m% y2 I4 _
PPARJ2 FWD GCTGTGCAGGAGATCACAGA 226 bp NM_005037
4 }6 V. a7 Q, xPPARJ2 REV GGGCTCCATAAAGTCACCAA3 D, L- g6 W5 n/ f( T5 n5 H% \
Lipoprotein lipase FWD GTCCGTGGCTACCTGTCATT 212 bp NM_000237
* v& d, c" K) X5 w9 ?Lipoprotein lipase REV TGTCCCACCAGTTTGGTGTA7 X+ G$ X% N; i2 o3 N% B# _; r7 L
Sox 9 FWD TTGAGCCTTAAAACGGTGCT 224 bp NM0003464 r+ F" ]. p! U. ?7 J0 }
Sox 9 REV CTGGTGTTCTGAGAGGCACA
/ O A% [! ~! t; kType X collagen FWD TGAGCAGCAACGTAAAAACG 471 bp NM_00049
' q" a; ?' r* n, sType X collagen REV AGGAAATGCCGAGTTTCTCA
7 F/ h% J& S4 n Z5 |3 Z/ |( HStatistical Analysis + [; R* T: S$ k7 l
Statistical analysis was performed with the use of Instat software (GraphPad Software, San
$ d- G5 H9 b: c. [3 o4 Z dDiego, CA, USA). All data were plotted as mean ± standard error of the mean (SEM), unless
1 ^9 X; O7 E; Potherwise noted. Statistically significant differences were determined by two-tailed Student t
, ~/ I/ ?! d2 r* J7 {1 w8 b; otests, and statistical significance was defined as p < 0.05. |
|
发表于 2011-3-20 08:21
，脑子里也没有独家生产这个概念
，所以没理解。 I" v- @9 ?0 ~2 {' w