Suppressions of chronic glomerular injuries and TGF- 1 production by HGF in atte - 《American Journal of Physiology》美国生理学杂志干细胞之家



免疫细胞治疗专区	欢迎关注干细胞微信公众号

12 3 4 5 6 7 8 9 10 ... 22 下一页

返回列表

查看: 434114\|回复: 217	go Suppressions of chronic glomerular injuries and TGF- 1 production by HGF in atte [复制链接]

轻羽

新手上路

Rank: 1

积分: 0
威望: 0
包包: 0

楼主

发表于 2009-4-22 08:18 |只看该作者 |倒序浏览 |打印

作者：Shinya Mizuno and Toshikazu Nakamura作者单位：Division of Molecular Regenerative Medicine, Department of Molecular Regenerative Medicine, Osaka University Graduate School of Medicine, Yamadaoka 2-2-B Japan . O* b" U& ?1 @
   - j1 `6 a; i' y& c0 Q7 u+ T


                     + U! g8 \6 K5 c& t( n2 t

         8 _5 T; s8 u, v6 y- N( v! N$ K0 X4 B6 F% h
         " J0 H% T' x+ i4 [* Q( u

                  5 {& T( b4 M& L) ^. s
      4 I" G( j$ Q( r( y
      ; A- r; }: Y/ \2 @- j5 ]+ {
      5 L* n' ^; v. M' Q
      【摘要】
   Diabetic nephropathy is now the leading cause of end-stage renal diseases, and glomerular sclerotic injury is an initial event that provokes renal dysfunction during processes of diabetes-linked kidney disease. Growing evidence shows that transforming growth factor- 1 (TGF- 1 ) plays a key role in this process, especially in eliciting hypertrophy and matrix overaccumulation. Thus it is important to find a ligand system to antagonize the TGF- 1 -mediated pathogenesis under high-glucose conditions. Herein, we provide evidence that hepatocyte growth factor (HGF) targets mesangial cells, suppresses TGF- 1 production, and minimizes glomerular sclerotic changes, using streptozotocin-induced diabetic mice. In our murine model, glomerular sclerogenesis (such as tuft area expansion and collagen deposition) progressed between 6 and 10 wk after the induction of hyperglycemia, during a natural course of diabetic disease. Glomerular HGF expression levels in the diabetic kidney transiently increased but then declined below a basal level, with manifestation of glomerular sclerogenesis. When anti-HGF IgG was injected into mice for 2 wk (i.e., from weeks 4 to 6 after onset of hyperglycemia), these glomerular changes were significantly aggravated. When recombinant HGF was injected into the mice for 4 wk (i.e., between 6 and 10 wk following streptozotocin treatment), the progression of glomerular hypertrophy and sclerosis was almost completely inhibited, even 500 mg/dl). Even more important, HGF repressed TGF- 1 production in glomerular mesangial cells even under hyperglycemic conditions both in vitro and in vivo. Consequently, not only albuminuria but also tubulointerstitial fibrogenesis were attenuated by HGF. Overall, HGF therapy inhibited the onset of renal dysfunction in the diabetic mice. On the basis of these findings, we wish to emphasize that HGF plays physiological and therapeutic roles in blocking renal fibrogenesis during a course of diabetic nephropathy. 4 }3 @0 {2 p' |9 y/ J5 D: D
      【关键词】 chronic renal failure glomerular sclerosis hepatocyte growth factor transforming growth factor
   IN CHRONIC RENAL diseases, renal fibrosis (such as glomerulosclerosis and interstitial fibrosis) occurs to replace the loss of parenchymal nephrons ( 29 ), but this pathological condition eventually leads to intractable renal dysfunction and hemodialysis becomes necessary. Among chronic renal disorders, diabetic nephropathy is now worldwide one of the most common etiologies of hemodialysis ( 1, 19 ); for example, the annual cost is $900 billion in Japan, and diabetics reaching dialysis have a twofold excess mortality risk. Given that diabetic nephropathy is a major contributor to dialysis-related financial and medical problems, it is important to elucidate a mechanism(s) as to how diabetic nephropathy progresses (or is delayed) under high-glucose conditions. The initial attention of nephrologists was directed to glomerular components, as mesangial injuries are considered to be the first step in the manifestation of diabetic nephropathy ( 5, 31 ).

Several lines of evidence revealed critical roles of transforming growth factor- 1 (TGF- 1 ) during the progression of glomerular lesions in diabetic nephropathy: 1 ) TGF- 1 expression is upregulated by glucose and enhances extracellular matrix (ECM) accumulation in mesangial cells ( 36, 48 ); 2 ) TGF- 1 expression levels are markedly increased in mesangial areas in animals or in patients after the onset of diabetic nephropathy ( 43 ); and 3 ) importantly, neutralization of TGF- 1 actions with a specific antibody suppresses glomerular hypertrophy as well as sclerosis in vivo ( 33, 47 ). Thus TGF- 1 is now considered to be a key molecule that aggravates diabetic nephropathy ( 13, 34 ). To prevent TGF- 1 -mediated fibrogenesis under diabetic conditions, there may possibly be a self-protection mechanism in vivo, but such a defense system is not well understood.

Hepatocyte growth factor (HGF) was originally identified and cloned as a potent mitogen for mature hepatocytes ( 27, 28 ). HGF is a potent mitogen and morphogen for renal tubular epithelial cells ( 3, 21 ). Actually, HGF accelerates renal tubular repair after the onset of acute renal failure, with rapid recovery of tubular morphology and functions ( 14, 16 ). Of note, HGF has therapeutic effects on chronic renal failure linked with enhanced tubular regeneration, and tubulointerstitial fibrosis was inhibited ( 15, 23 - 25, 44, 45 ) even when renal function was impaired. These studies focused on HGF's roles mainly related to tubular and tubulointerstitial lesions. We recently obtained evidence that HGF works on mesangial cells and then inhibits their proliferation in a rat model of acute glomerulonephritis ( 4 ). Nevertheless, it is still unclear whether HGF directly inhibits chronic mesangial injuries, an important cascade leading to renal dysfunction ( 29 ).
& |2 T- |5 [" M; @5 [4 ?
To elucidate a role of HGF during the onset of glomerular injuries, we focused on diabetic nephropathy, because glomerular sclerogenesis (including hypertrophy and matrix overdeposition) precedes the onset of tubulointerstitial fibrosis, and this time lag seems advantageous to determine whether HGF's roles regarding glomeruli are direct or indirect. In this study when we used streptozotocin (STZ)-injected mice as a model of diabetic nephropathy, we found that HGF prevents chronic glomerular lesions, which may determine predisposition to albuminuria, tubulointerstitial fibrosis, and renal dysfunction. We describe herein physiological and therapeutic effects of HGF to suppress TGF- 1 -induced pathological states in hyperglycemia-linked nephropathy.
4 P7 V( z5 v( n
MATERIALS AND METHODS
' q$ P+ U% W( Z, k/ u
Animals. Eight-week-old female C57B/6Cr Slc mice (18-20 g; SLC, Hamamatsu, Japan) were used. We attempted to induce hyperglycemia in these mice, based on a reported method ( 8 ): after fasting these mice for 24 h, we injected STZ (Nacalai, Kyoto, Japan) in a dose of 120 mg/kg ip for the initial 2 days and in a dose of 80 mg/kg ip for the subsequent 2 days. About 70% of the mice manifested severe hyperglycemia (plasma glucose 500 mg/dl) within 1 wk after the last injection of STZ, and 20% of the animals died of severe dehydration. The remaining mice had mild hyperglycemia and were removed from the present experiments.) f5 s8 |' i; p" j; Y8 w

Reagents. For HGF-neutralizing treatment, anti-HGF antibody was raised by immunizing rat HGF in normal rabbits. The anti-HGF IgG cross-reacts with mouse (but not human) HGF and accelerates renal fibrogenesis ( 24, 25 ). A variant type of recombinant human HGF (rh-HGF) was produced by Chinese hamster ovary cells, a cell line transfected with human HGF cDNA with a deletion of 5 amino acid residues in the first kringle domain ( 14 - 16, 23 - 25 98% pure.
6 A# @/ u4 |9 w! W0 |  q
Observations on the natural course of diabetic nephropathy. Twenty STZ-injected mice were housed under specific pathogen-free conditions and were fed a standard diet (MF, Oriental yeast, Tokyo, Japan). To analyze the natural course of renal phenotypes, mice were killed at 0, 2, 6, and 10 wk after the STZ treatment (each group includes 5 mice). At necropsy, they were anesthetized with pentobarbital sodium (50 mg/kg ip), and plasma and renal tissues were collected for biochemical or pathological analyses, as described below.
4 Y) c/ f: G: y! j% ]8 ]
Anti-HGF antibody treatment. For the anti-HGF IgG treatment, another 12 STZ-injected mice were generated. Four weeks after the STZ injections, they were divided into two groups (based on clinical data as described below) and intraperitoneally injected with the rabbit anti-rat HGF IgG (250 µg/mouse; n = 6) or normal rabbit IgG (250 µg/mouse; n = 6) on alternate days over a period of 12 days. These mice were killed on day 14 after start of this treatment.
' O. m4 ?9 r  \6 Z! w
Administration of exogenous HGF. To evaluate the effect of rh-HGF on progression of diabetic nephropathy, 12 diabetic mice were prepared. These mice were found to be in an early stage of renal insufficiency when their blood urea nitrogen (BUN) levels reached near 40 mg/dl (e.g., 6 wk after the STZ treatments), and they were then divided into an HGF-injected group and a saline-injected group: in the rh-HGF-injected group ( n = 6), mice were given 300 µg·kg -1 ·12 h -1 HGF sc daily for 28 days, whereas control mice ( n = 6) received subcutaneous injections of an identical volume of saline.

Blood and tissue chemistry. Plasma glucose levels were determined using a kit (Glucose B test, Wako, Osaka, Japan). BUN levels were determined with the urease indophenol method, using a kit (Urea B test, Wako) ( 23 ). The plasma creatinine level was measured using a kit (Creatinine test, Wako) ( 23 ). In an experiment related to rh-HGF therapy, plasma was obtained from postorbital veins on weeks 6, 8.5, and 10 and subjected to the laboratory examinations. The urinary albumin levels were determined, using a kit (A/G B test, Wako) ( 23, 24 ). Renal tissue extracts were prepared, as described ( 23 - 25 ). Renal HGF levels were determined in ELISA, using a kit (HGF EIA, Institute of Immunology, Tokyo, Japan). Renal TGF- 1 levels were determined, using an ELISA kit (Quantikine TGF- 1, R & D) ( 23 - 25 ). Renal monocyte chemoattractant protein-1 (MCP-1) levels were determined using a sandwich ELISA system (Amersham-Pharmacia, Little Chalfont, UK).
- _$ G& o4 W7 \$ I' O) {
Histopathology. The left kidneys were excised and fixed in cold 70% ethanol. The transversally trimmed kidney tissues were submitted to a routine process for paraffin embedding. The sections were cut into 4-µm slices, dewaxed, and then stained with hematoxylin and eosin. The remaining sections were subjected to immunohistochemistry: goat IgG against mouse type IV collagen (1:400; Chemicon, Temecula, CA) was used for the primary reactions to determine the extent of glomerular sclerosis. To visualize the primary antibody, an avidin-biotin coupling (ABC) immunoperoxidase technique was used together with a commercial kit (Vectstain Elite ABC, Vector Labs, Burlingame, CA) ( 23 - 25 ). To detect the expression of growth factors, rabbit IgG against rat HGF (1:1,000) [prepared in our laboratory ( 24, 25 )] and rabbit IgG against porcine and human TGF- 1,2,5 (pan-TGF- ) (1:100) were used for the primary reactions, followed by the ABC technique mentioned above. To support the fibrogenic events in diabetic kidneys, other parameters such as fibronectin, type I collagen, -smooth muscle actin ( -SMA; a marker for myofibroblasts), and Mac-1 (a marker for macrophages) were detected immunohistologically as described ( 23 - 25 ). To detect a chemokine involved in macrophage influx, anti-mouse MCP-1 hamster IgG (BD Biosiences, San Jose, CA) was used, followed by the ABC technique as mentioned.

Renal morphometry. Glomerular sclerosis (characterized by mesansial expansion) was graded according to the extent of mesangial involvement on a scale of 0 to 4: 0, normal; 0.5, small focal area of the tubular injury; 1, involvement of over 10% of the cortex; 2, involvement up to 25% of the cortex; 3, involvement up to 50 to 75% of the cortex; and 4, extensive damage involving more than 75% of the glomeruli ( 23 ). To evaluate the glomerular tuft hypertrophy, glomerular size was determined by measuring the glomerular area on the same glomeruli, by means of a video microscope (VM-30, Olympus, Tokyo, Japan). The glomerular scores of collagen (IV/I), TGF- 1, -SMA, and fibronectins were determined as described ( 23 ). The overall means of these parameters were calculated based on individual values ( n = 6), which were determined in at least 30 glomeruli per mouse. Finally, the degree of tubulointerstitial lesions was evaluated based on interstitial Mac-1, -SMA, and type IV collagen scores ( 24, 25 ). These semiquantitative analyses were all made in a blinded fashion.
+ v# }6 ~" I" N* j* |" `
In vitro study. To evaluate the direct effect of HGF on TGF- 1 production, we prepared an in vitro model of diabetic nephropathy, based on reported data ( 36 ). We used human normal mesangial cells (HNMC; Sanko, Chiba, Japan) to induce fibrogenic phenotypes: the culture was passaged in dishes supplemented with 10% fetal bovine serum containing MCDB-131 (GIBCO, Grand Island, NY). These cells were adjusted at a density of 3 x 104 cells/cm 2 in a 48-well plate at 37°C overnight and then the medium was replaced with fresh serum-free MCDB-131, where D -glucose was pulsed at concentrations of 5.5 mM (=100 mg/dl, i.e., normal) or 33 mM glucose (=600 mg/dl, i.e., diabetic). After the medium change, rh-HGF was added to the culture systems in various doses (0-30 ng/ml), and TGF- 1 levels in the supernatants were determined, as mentioned. To evaluate the fibrogenesis on mesangial cells, type IV collagen and -SMA expressions were evaluated in an immunoblot analysis for lysates of cultured cells, as described ( 4 ). We extracted mRNA from HNMC using an acid guanidium thiocyanate-phenol chlorform method. To determine changes in TGF- 1 at transcription levels, mRNA was reversed to cDNA and subjected to amplification with primers specific to TGF- 1 cDNA (sense vs. antisense primer): CCGCAAGGACCTCGGCTGGAA vs. GATCATGTTGGACAGCTGCTC. As an internal control, GAPDH was used (GGATTTGGCCGTATTGG vs. GGATTTGGCCGTATTGG).2 I0 d1 I7 K, U, W+ M- ]/ x5 w/ u, {
0 v9 I$ q, O5 T6 `3 `0 d
Statistical analyses. All data are expressed as means ± SD. An unpaired two-tailed t -test was used to compare the means, and a value of P
7 Q- c+ [" |+ z$ }) i
RESULTS

Changes in renal HGF levels during progression of diabetic nephropathy in mice. To determine the role of HGF during the pathogenesis of diabetic nephropathy, we first prepared an animal model in which renal dysfunction progresses under high-glucose conditions. In STZ-injected mice, blood glucose levels rapidly increased within 7 days after serial administrations of STZ to a threefold level over the control ( Fig. 1 A, left ), concomitantly with persistent polyuria and glycouria. In the diabetic mice, BUN levels increased between 6 and 10 wk after the onset of hyperglycemia in association 500 mg/dl; Fig. 1 A, middle ). Similarly, the mice showed significant increases in plasma creatinine levels during the experimental periods (0W: 0.36 ± 0.05 mg/dl; 6W: 0.52 ± 0.08 mg/dl; and 10W: 0.93 ± 0.12 mg/dl). Renal morphometry revealed that the glomerular sclerosis score increased, in association with elevated parameters of renal functions ( Fig. 1 A, right ). In this model, renal HGF levels increased for up to 2 wk after the STZ injection to a twofold level over the pretreatment control ( Fig. 1 B, line graph). However, HGF levels reverted to near the basal level at 6 wk after the onset of hyperglycemia with reciprocal increases in BUN levels. In renal histochemistry, immunoreactive signals for HGF were evident in mesangial regions of the glomeruli in the mice especially at 2 wk after the initiation of diabetes. The glomerular HGF expression became faint following 6 wk (6W) of the STZ treatments ( Fig. 1 B ). In this time point (i.e., 6W), interstitial lesions were very mild but became evident at 10 wk after the STZ challenge, with the increase in peritubular HGF expression (not shown).

Fig. 1. Time course of changes in renal phenotypes in mice after the onset of experimental diabetes. A : changes in plasma glucose, blood urea nitrogen (BUN) levels, and glomerular sclerosis scores in diabetic mice which had been given serial injections of streptozotocin (STZ), as described in MATERIALS AND METHODS. Data are means ± SD ( n = 5). B : alterations of hepatocyte growth factor (HGF) levels and localization in nondiabetic and diabetic mouse kidneys. Left : renal HGF levels in the mice, as measured using an ELISA system. Data are means ± SD ( n = 5). Statistical analysis: * P
( y9 h- Y1 S2 h2 S# o1 s
Involvement of a decrease in HGF-positive glomerular cells in tuft sclerotic injuries. Measurement of endogenous HGF in whole renal tissues included glomerular and peritubular HGF and did not accurately reflect glomerular HGF changes. Thus we counted the number of HGF-positive cells in glomeruli, as described ( 4 ). The HGF-positive glomerular cells transiently increased 2 wk after STZ injections, followed by significant losses of intrinsic HGF, especially noted at 10 wk following the induction of diabetes (0W: 4.46 ± 0.57 vs. 10W: 2.15 ± 0.31 cells per glomerulus, P . x8 h) j! Q* P: q6 z

Fig. 2. Contribution of glomerular HGF to suppress tuft hypertrophy and matrix deposition in diabetic mice. A, left : changes in glomerular HGF-positive cells in a natural course of diabetic nephropathy in STZ-injected mice. Data are means ± SD ( n = 5). Statistical analysis: * P . T/ L( d" Y; z8 Y: f

Effect of exogenous HGF administrations on diabetes-related conditions in mice. To gain support for our hypothesis, supplement therapy with rh-HGF was given to the diabetic mice during a 4-wk period (from weeks 6 to 10 after STZ injections), because: 1 ) intrinsic HGF rapidly declined within this time and 2 ) in the earlier phase (i.e., 2W), the mice showed hydration and did not stably manifest renal dysfunction. Throughout the administration periods, rh-HGF did not alter the natural course of blood glucose levels, noted in diabetic mice treated with saline ( Fig. 3 A ). We next checked BUN and creatinine levels in mice to estimate renal functions: in salineinjected mice, BUN levels gradually increased, up to the end-point (i.e., 10W) of this study. Of note, HGF suppressed increases in BUN levels at 8.5 and 10 wk after the onset of diabetic conditions ( Fig. 3 B ). Furthermore, HGF also inhibited the elevation of plasma creatinine levels at the time of death, with a significant difference ( Fig. 3 C ), thus indicating that HGF functioned to inhibit progression of renal dysfunction, even though blood glucose levels were still higher.

Fig. 3. Alterations of hyperglycemia and renal dysfunctions in mice after HGF supplement therapy. After 6 wk of STZ injections, mice were treated twice daily with saline or recombinant human (rh)-HGF (600 µg·kg -1 ·day -1 sc) for a 4-wk period. During the administration periods, plasma was collected from postorbital veins of diabetic mice, and glucose ( A ), BUN ( B ), and creatinine ( C ) levels were determined in saline-injected mice and rh-HGF-treated mice, respectively. Data are means ± SD ( n = 6). Statistical analysis: n.s., not significant; * P

Attenuations of glomerular changes in diabetic mice by HGF therapy. To explain the therapeutic effects by HGF on chronic renal failure, we first focused on glomerular lesions, an initial hallmark of diabetic nephropathy ( 5, 31 ). In saline-injected diabetic mice, some glomeruli became hypertrophic, with a hyalynosis-like lobular nodule ( Fig. 4 A, left ). In contrast, glomerular hypertrophy decreased in HGF-treated diabetic mice, with almost normal capillary morphology ( Fig. 4 A, middle ). In the HGF-treated animals, glomerular tuft size was reduced to the level seen in the pretreatment group (e.g., 6W; Fig. 4 A, right ). Ratios of left kidney weight to heart weight in diabetic mice are pretreatment (6W) = 1.98 ± 0.24, saline (10W) = 2.52 ± 0.57, and rh-HGF (10W) = 1.91 ± 0.21. A significant difference in kidney weight was seen between the saline- and HGF-injected animals ( P 2 S7 T, \, M* f+ ?% h+ r3 W
3 w/ r! t$ k' ?/ `
Fig. 4. Prevention of glomerular hypertrophy and sclerosis in diabetic mice by rh-HGF supplement therapy. The diabetic mice were killed 4 wk after the initiation of saline or rh-HGF administration. Renal tissues were removed and submitted to histological examinations, as stated in MATERIALS AND METHODS. A : inhibitory effect of rh-HGF injections on glomerular hypertrophy, as determined by size of tuft areas. A, left : representative microphotographs of glomerular findings, noted in saline- and HGF-treated groups (hematoxylin and eosin staining, x 120). A nodule with hyalinosis was noted in an expanded tuft (arrowhead). A, right : comparisons of glomerular area sizes among pretreated (6W), saline-treated vs. rh-HGF-treated diabetic groups (10W). B : suppression of type IV collagen depositions in glomeruli after the HGF treatments. B, left : immunohistochemical findings for mesangial sclerosis in saline and HGF groups (type IV collagen staining, x 220). B, right: degree of the collagen deposition was quantified by determining type IV collagen scores. C : comparisons of fibrogenic events between saline and HGF groups, based on glomerular type I collagen, fibronectin (FN), and -smooth muscle actin (SMA) scores. Data are means ± SD ( n = 6). Statistical analysis: * P " v% K$ g" R9 c5 L: Q) j8 |
7 `5 h. ^  Q3 C6 A4 Z
Glomerular TGF- expression and its modulation by HGF in diabetic mice. As TGF- is critical to elicit glomerular sclerosis in diabetic renal diseases ( 13, 33, 34 ), we asked whether HGF would alter glomerular TGF- expression under diabetic conditions. Immunohistochemical examinations demonstrated TGF- -positive areas in sclerotic regions in the saline group, while this pathological event was attenuated after rh-HGF treatment ( Fig. 5 A ). The glomerular TGF- score was significantly lower in the rh-HGF group than in the saline group (2.69 ± 0.41 vs. 1.27 ± 0.33, P

Fig. 5. Suppressive effect of rh-HGF administrations on glomerular transforming growth factor (TGF)- expression in diabetic mice. A : typical findings of TGF- -immunoreactive stainings in glomeruli of saline- and HGF-treated diabetic mice ( x 580). TGF- -positive areas were extensive in the control mice but were reduced in HGF-treated mice. B : renal TGF- 1 levels in the pretreatment group (6W) or those in saline- or HGF-treated groups (10W). TGF- 1 protein levels were measured in renal tissue extractions, using an ELISA system. Data are means ± SD ( n = 6). Statistical analysis: ** P
$ [) [0 r/ y6 q$ W  D
Inhibitory effect of HGF on TGF- 1 production, -SMA, and type IV collagen accumulation in cultured mesangial cells. Because mesangial cells are a major source of TGF- 1 in diabetic nephropathy ( 43, 48 ), we focused on a role for HGF in the TGF- 1 -producing cells. Under a high-glucose condition (with 33 mM glucose), supernatant TGF- 1 levels increased to a 1.8-fold level over the physiological control (i.e., 5.5 mM glucose; Fig. 6 A ), being similar to documented data ( 36, 48 ). In this model, HGF dose dependently repressed sugar-induced increases in TGF- 1 levels, noted in the diabetic (33 mM glucose) but not nondiabetic (5.5 mM) cultures. Especially, there was a significant difference in TGF- 1 levels between 33 mM glucose alone vs. the high glucose plus rh-HGF (30 ng/ml; P

Fig. 6. HGF-mediated attenuation of high glucose-induced TGF- 1 production, myofibroblast conversion, and extracellular matrix (ECM) deposits in cultured mesangial cells. A : effect of rh-HGF concentrations on TGF- 1 levels in the culture medium of human mesangial cells. The mesangial cells were incubated for 96 h under a physiological glucose (Glc) level (5.5 mM, corresponding to 100 mg/dl) or a diabetic level (33 mM, corresponding to 600 mg/dl). Supernatant TGF- 1 protein levels were determined using an ELISA kit (see MATERIALS AND METHODS ). Statistical analysis: ** P , i7 x. e( @/ H2 d

Prevention of albuminuria-related interstitial changes by HGF in diabetic kidneys. Glomerular injuries elicit urinary albumin excretion, while in turn albuminuria triggers peritubular inflammation and fibrogenesis, possibly via enhanced MCP-1 production ( 9, 35 ). In our model, urinary albumin levels gradually increased in the saline-injected group ( Fig. 7 A ). By contrast, urinary albumin levels declined in HGF-treated mice, especially at 10 wk after STZ injections ( P

Fig. 7. Inhibitory effects of HGF supplement on albuminuria, tubulointerstitial inflammation, and fibrogenic events in diabetic mice. A : suppression of urinary albumin excretion by rh-HGF supplement therapy. Data are means ± SD ( n = 6). Statistical analysis: * P ( t% K# B; o8 ~; p  L8 W% B

DISCUSSION8 P4 E$ q; e* i/ s; R' Z2 S( a

Diabetes is now the leading cause of end-stage renal disease in many developed countries and diabetic nephropathy has emerged as a silent epidemic worldwide ( 1, 19 ). This is the typical case in the United States, where diabetic nephropathy accounts for 42% of all new cases of end-stage renal disease as of 1997 ( 1 ). The physical and monetary costs for both patients and society are enormous, and these backgrounds stimulated basic research to elucidate a mechanism(s) related to progression of diabetic nephropathy regulated at a molecular level(s) ( 13, 34 ). Using cultures and animal models of diabetes, we provided evidence that HGF directly targets mesangial cells, suppresses TGF- 1 production, and minimizes glomerular (and possibly peritubular) fibrosis, all contributing to prevention of renal dysfunction in diabetic nephropathy. This is the first report identifying a natural ligand to protect kidneys from pathological conditions related to diabetes.

Hyperglycemia and renal hypertrophy are key determinants of diabetic complications, including nephropathy in insulin-dependent ( 40 ) and -nondependent diabetes mellitus ( 41 ). It is of interest to note that glomerular HGF levels show an inverse correlation with the severity of tuft hypertrophy in the mouse model we used. Of note, anti-HGF IgG treatment led to a significant increase in the size of glomerular tufts. Inversely, supplements of rh-HGF almost completely not only arrested renal growth but also minimized glomerular tuft expansions, thereby revealing a role of mesangial HGF in inhibiting renal hypertrophy. A causal involvement of TGF- 1 in diabetic renal hypertrophy was demonstrated given that application of TGF- antibodies attenuated the effect in experimental animals ( 33, 47 ). Therefore, we focused on renal TGF- 1 expression to explain anti-hypertophic effects of HGF. In our culture system, we found that high-glucose-stimulated TGF- 1 induction was abolished by HGF. This effect was reproduced in vivo: rh-HGF therapy for diabetic mice led to a reduction of the TGF- -positive mesangial areas. Thus one possible explanation is that HGF may inhibit tuft hypertrophy via suppression of TGF- 1 production. Another possibility is that HGF may reduce glomerular hyperfiltration [linked with glomerular hypertrophy ( 7, 29 )], because urinary volume in the HGF-treated mice was reduced to 70% over control levels (data not shown).

In addition to tuft hypertrophy, glomerular sclerosis is a risk factor for renal dysfunction in subjects with diabetic nephropathy ( 5, 31 ). Overexcessive ECM in mesangial spaces can cause vascular capillary collapse ( 5, 29 ), leading to albuminuria and interstitial injuries are accelerated. To produce ECM proteins, mesangial cells acquire myofibroblast-like phenotypes (including -SMA fibers) ( 10 ) and TGF- 1 plays a central role in this process ( 6 ). After the onset of hyperglycemia, glomerular HGF levels are inversely proportional to the degree of mesangial sclerosis. Moreover, rh-HGF led to decreased TGF- 1 levels and attenuated sclerosis in the mice, suggesting that endogenous HGF is preventive for the progression of diabetic glomerulopathy in the advanced stage. Our in vitro results suggest that antisclerogenic effects (such as attenuated myofibroblastosis and reduced ECM deposition) by HGF are, at least in part, directed toward mesangial cells.  g* d; ^# _# {. ~: Z& i: H- M8 g2 e1 D
+ Y. R6 z& j3 R# {: ~
We discuss other mechanisms of HGF-mediated outcomes in diabetic glomerulopathy. A loss of glomerular endothelial cells or podocytes may be critical for glomerular sclerosis to be manifest ( 17, 37 ). HGF is protective to endothelial cells and podocytes ( 11, 26 ), even under diabetic states. Thus protection of glomerular resident cells by HGF may involve attenuated glomerular injuries. We reported that HGF arrests mesangial overproliferation ( 4 ), an initial event that provokes sclerosis. HGF represses upregulation of connective tissue growth factor ( 15 ), a key cytokine needed for fibrosis to develop ( 32 ). Given that HGF induces ECM-degradating enzymes (such as matrix metalloproteinase-1/-9) ( 20, 30 ), HGF-induced matrix metalloproteinases likely contribute to attenuated fibrosis. HGF can decrease blood pressure in vivo ( 46 ), and this may be linked with suppressions of tuft hypertrophy by HGF. Such multifunctional activities by HGF would lead to attenuated glomerular injuries.

Clinical studies imply that tubulointerstitial lesions show the best correlation with renal failure in diabetic nephropathy ( 5, 12 ). Urinary albumin provokes MCP-1 upregulation, and then peritubular inflammation and fibrosis may develop ( 9, 35 ). Notably, HGF was shown to repress albuminuria in our model. Renal MCP-1 levels were reduced by HGF, such being the opposite of findings in vitro ( 42 ). Concomitantly, tubulointerstitial fibrogenic events (such as macrophage infiltration, myofibroblastosis, and ECM overdeposition) were suppressed in HGF-injected diabetic mice. Thus sequential mechanisms for attenuated renal dysfunction include 1 ) HGF protects from glomerular injuries in diabetic stress; 2 ) albumin excretion and in turn tubular MCP-1 expression are controlled; and 3 ) overall, onset of peritubular inflammation and fibrogenesis is avoided. On the other hand, we also consider direct effects of HGF toward tubular lesions, as reported ( 23 - 25 ).
% ^2 m; _3 C1 U- o2 f+ y& X' c
Recently, Laping et al. ( 18 ) reported that a strain of mice ( db / db ) developed diabetic kidney disease under an HGF supplement protocol. This finding conflicts with our observations. In their study, however, very low doses of HGF (160 ng·kg -1 ·day -1 = "1/3,000" of ours, sc) were used. Because the half-time of HGF in the circulation is within 10 min, at least several hundred micrograms of HGF are needed to produce and sustain physiological HGF levels (our unpublished data), especially in cases of systemic (subcutaneous or intramuscular) administrations. Of note, giving physiological doses of HGF (i.e., 600 µg·kg -1 ·day -1 sc) to db / db mice led to a trend of improvement of renal functions (Kajihara M and Kuroda A, unpublished data). Although the way in which the very low dose of HGF has different effects awaits results from additional studies, the use of HGF at physiological doses seems to be safe and effective.5 t" l% F4 Q3 P: `$ k
! g8 G0 s4 V; `& M7 O8 D* }$ l
Finally, it is important to discuss a cause-and-result relationship between reciprocal expressions of HGF and TGF- 1 in the diabetic kidney. HGF represses TGF- 1 production, as shown herein and reported elsewhere ( 38, 39 ), and vice versa ( 22, 26 ). Thus a potential mechanism for regulating the balance involves 1 ) in an early stage of diabetic disease, HGF expression is enhanced to block TGF- 1 production after which a shift to renal sclerosis is prevented; and 2 ) in turn, excessive TGF- 1 in a later phase leads to successful fibrogenesis via inhibiting HGF production. Previous evidence implies that HGF is a tubulotrophic factor ( 21 ), and HGF is now recognized as glomerulotrophic. The above taken together, we hypothesize that there may be reciprocal mechanisms of TGF- 1 and HGF to regulate progression of glomerular as well as tubulointerstitial fibrosis in chronic renal organ diseases and that supplement of HGF is considered as a molecular pathogenesis-based strategy to limit renal fibrosis ( Fig. 8 ). Alternatively, novel specific approaches with enhancing or sustaining endogenous HGF production can be developed to limit TGF- 1 overexpression and chronic renal failure.0 Y) P' ?" w' h6 W& S
" Q! H0 |. L( R# |; S
Fig. 8. Hypothetical model for molecular pathogenesis and therapy of renal fibrosis by HGF. Reciprocal balance between HGF and TGF- 1 is involved in determining the fates of chronic renal diseases. In an early stage of chronic renal disorders, HGF production is enhanced to suppress TGF- 1 production. In the HGF-dominant balance, renotropic, protective, and antifibrotic events occur as a compensatory response. By contrast, TGF- 1 production is, in turn, upregulated in an advanced stage to prohibit HGF production. Under the TGF- 1 -dominant condition, a loss of parenchymal regeneration leads to accelerated renal fibrosis and dysfunction. To reverse the fibrosis-progressed balance, supplement therapy with HGF (or its gene) could be considered as a strategy for attenuating fibrosis, a common pathway leading to end-stage chronic renal failures [including diabetic nephropathy, nephrotic syndrome ( 23, 24 ), obstructive nephropathy ( 25, 44, 45 ), and chronic allograft nephropathy ( 2 )].; ]: {. o: C, N( o2 f

ACKNOWLEDGMENTS% I& F$ P2 ^, z& W+ [. i) n! {# N
# f3 P/ {' @6 ]. {
We are grateful to M. Ohara (Fukuoka) for critical readings of the manuscript and for pertinent comments.

GRANTS1 Y" x" L( j3 h) _
  x. @  i8 o0 N9 Z
This study was supported by grants from the Ministry of Education, Science, Technology, Sports and Culture of Japan (14207005 and 12215082 to T. Nakamura and 14570187 to S. Mizuno) and by the Mochida Memorial Foundation for Medical and Pharmaceutical Research (to S. Mizuno).  q$ H# q, D0 k6 C% E+ i
      【参考文献】3 E7 Z0 @1 b" C
Akmal M. Hemodialysis in diabetic patients. Am J Kidney Dis 38: S195-S199, 2001.
& M0 w4 W2 i9 g$ G
6 `9 N! M! V& p9 p: ^7 `3 A$ W0 l
5 T: _' C7 l5 z8 @+ M8 x
Azuma H, Takahara S, Matsumoto K, Ichimaru N, Wang JD, Moriyama T, Wega A, Otsuki Y, Kitamura M, Okuyama A, Katsuoka Y, Chandraker A, Sayegh MH, and Nakamura T. Hepatocyte growth factor prevents development of chronic allograft nephropathy in an experimental rat transplant model. J Am Soc Nephrol 12: 1280-1292, 2001.1 X' e+ ]! C  ~: `& m6 z

Balkovetz DF and Lipschutz JH. Hepatocyte growth factor and the kidney: it is not just for the liver. Int Rev Cytol 186: 225-260, 1999.: ~/ r6 U3 r6 ]5 y' M3 b0 T
. ]2 J" u. d+ D/ p3 e

/ l3 g" @% q3 _! V, ^
Bessho K, Mizuno S, Matsumoto K, and Nakamura T. Counteractive effects of HGF on PDGF-mediated mesangial cell proliferation in a rat model of glomerulonephritis. Am J Physiol Renal Physiol 284: F1171-F1180, 2003.
: M7 B# J3 M# j6 a
3 _" d3 u  A- W( j0 u2 W

Bohle A, Wehrmann M, Bogenschutz O, Batz C, Muller CA, and Muller GA. The pathogenesis of chronic renal failure in diabetic nephropathy. Investigation of 488 cases of diabetic glomerulosclerosis. Pathol Res Pract 187: 251-259, 1991.

Border WA and Noble NA. Transforming growth factor in tissue fibrosis. N Engl J Med 331: 1286-1292, 1994.8 A# N) T) E: e6 p0 T
4 z1 t% ]( P7 A) w

2 u7 D# T# i1 {9 P% ~2 r1 P( G% }2 e1 ^
Brenner BM, Meyer TW, and Hostetter TH. Dietary protein intake and the progressive nature of kidney disease: the role of hemodynamically mediated glomerular injury in the pathogenesis of progressive glomerular sclerosis in aging, renal ablation, and intrinsic renal disease. N Engl J Med 307: 652-659, 1982.. x- h5 U5 i1 m5 z) ~
- q* f. p) P; L

Chen N, Chen WY, Bellush L, Yang CW, Striker LJ, Striker JE, and Kopchick JJ. Effects of STZ treatment in growth hormone (GH) and GH antagonist transgenic mice. Endocrinology 136: 660-667, 1995.
8 Q8 X8 [! w/ f7 n6 s" O

/ T5 h- t8 G: u0 n9 @2 J; [2 O6 p
Eddy AA and Giachelli CM. Renal expression of genes that promote interstitial inflammation and fibrosis in rats with protein-overload proteinuria. Kidney Int 47: 1546-1557, 1995.! U7 N: R( U' o# j* ~& w& v: R

Essawy M, Soylemezoglu O, Muchaneta-Kubara EC, Shortland J, Brown CB, and Nahas AM. Myofibroblasts and the progression of diabetic nephropathy. Nephrol Dial Transplant 12: 43-50, 1997.
7 l3 O: c! r% F0 r& ^

Fornoni A, Li H, Foschi A, Striker GE, and Striker LJ. Hepatocyte growth factor, but not insulin-like growth factor I, protects podocytes against cyclosporin-A-induced apoptosis. Am J Pathol 158: 275-280, 2001.

5 S2 V/ n- A2 [. h

Gilbert RE and Cooper ME. The tubulointerstitium in progressive diabetic kidney disease: more than an aftermath of glomerular injury? Kidney Int 56: 1627-1637, 1999.

! x; ~* i! B, b
% d& V5 p# |( e% k% O
Goldfar S and Ziyadeh FN. TGF- : a crucial component of the pathogenesis of diabetic nephropathy. Trans Am Clin Climatol Assoc 112: 27-32, 2001.

1 D7 m6 X8 x2 _" Q
6 R: U& S. W9 ^  {* l
Igawa T, Matsumot K, Kanda S, Saito Y, and Nakamura T. Hepatocyte growth factor may function as a renotropic factor for regeneration in rats with acute renal injury. Am J Physiol Renal Fluid Electrolyte Physiol 265: F61-F69, 1993.7 @1 a$ @$ {) K: Q6 P5 S7 v' H. ~, `

) d7 \' k* h7 D; m+ A& m0 W0 @, z
3 Y: Y7 P8 _" {% Q# |9 {0 N9 @" g
Inoue T, Okada H, Kobayashi T, Watanabe Y, Kanno Y, Kopp JB, Nishida T, Takigawa M, Ueno M, Nakamura T, and Suzuki H. Hepatocyte growth factor counteracts transforming growth factor- 1, through attenuation of connective tissue growth factor induction, and prevents renal fibrogenesis in 5/6-nephrectomized mice. FASEB J 17: 268-270, 2003.

Kawaida K, Matsumoto K, Shimazu H, and Nakamura T. Hepatocyte growth factor prevents acute renal failure and accelerates renal regeneration in mice. Proc Natl Acad Sci USA 91: 4357-4361, 1994.9 d0 z' b) S. E' b

Kriz W and Lemley KV. The role of the podocyte in glomerulosclerosis. Curr Opin Nephrol Hypertens 8: 489-497, 1999.! {1 x7 h  p( z" Z

: E' r& N" m0 q& z/ W
  m/ g9 p) i4 n1 Q
Laping NJ, Olson BA, Ho T, Ziyadeh FN, and Albrightson CR. Hepatocyte growth factor: a regulator of extracellular matrix genes in mouse mesangial cells. Biochem Pharmacol 59: 847-853, 2000.
$ C- F; p$ F2 a; `; |# l

4 ~8 ^9 n9 j, D, G# v
Lazarus JM, Denker BM, and Owen WF. Hemodialysis. In: The Kidney (5th ed.), edited by Brenner BM. Philadelphia: W. B. Saunders, 1996, p. 2424-2506.5 }& W7 h' n7 B2 ^
% I% K  b7 Z5 x# Q
0 f) d  V: D: [) A

Liu Y, Raju K, Tolbert E, and Dworkin LD. Endogenous hepatocyte growth factor ameliorates chronic renal injury by activating matrix degradation pathways. Kidney Int 58: 2028-2043, 2000.+ D- O$ F5 ~  j% K" G4 `

: C# G4 }: F8 Q# c& `- m% Q: I
Matsumoto K and Nakamura T. Hepatocyte growth factor: renotropic role and potential therapeutics for renal diseases. Kidney Int 59: 2023-2038, 2001.
2 @& N% ^$ d) L+ n# L7 u
* n$ O6 r" B% C# Y$ ]  q$ Y! x
9 ~: J* n8 g& O7 X" @
Matsumoto K, Tajima H, Okazaki H, and Nakamura T. Negative regulation of hepatocyte growth factor gene expression in human lung fibroblasts and leukemic cells by transforming growth factor- 1 and glucocorticoids. J Biol Chem 267: 24917-24920, 1992.

9 k2 n, a9 B4 q8 p: v! F
& y2 P) L  y0 P- n. U
Mizuno S, Kurosawa T, Matumoto K, Mizuno-Horikawa Y, Okamoto M, and Nakamura T. Hepatocyte growth factor prevents renal fibrosis and dysfunction in a mouse model of chronic renal disease. J Clin Invest 101: 1827-1834, 1998.6 K1 H! J2 _0 m1 E  v6 e

6 d+ z0 P6 n9 J
! u1 `; d1 S* j9 j
Mizuno S, Matsumoto K, Kurosawa T, Mizuno-Horikawa Y, and Nakamura T. Reciprocal balance of hepatocyte growth factor and transforming growth factor- 1 in renal fibrosis in mice. Kidney Int 57: 937-948, 2000.

$ i7 S3 h& z6 m5 Q6 j& Y/ |3 U; n
Mizuno S, Matsumoto K, and Nakamura T. Hepatocyte growth factor suppresses tubulo-interstitial fibrosis in a mouse model of obstructive nephropathy. Kidney Int 59: 1304-1314, 2001.

7 d& U" s7 s( c: J
Morishita R, Nakamura S, Nakamura Y, Aoki M, Moriguchi A, Kida I, Yo Y, Matsumoto K, Nakamura T, Higaki J, and Ogihara T. Potential role of an endothelium specific growth factor, hepatocyte growth factor, on endothelial damage in diabetes. Diabetes 46: 138-142, 1997.

7 e  R3 C" L9 K9 S' D5 s" Z
" E! f+ X9 i" n/ K- M
Nakamura T, Nawa K, and Ichihara A. Partial purification and characterization of hepatocyte growth factor from serum of hepatectomized rats. Biochem Biophys Res Commun 122: 1450-1459, 1984.$ b9 i2 O! L. b& ~0 q0 P$ M
" ?: `$ Z4 o/ b3 l  ~
! z! Q! C8 B4 T5 p6 {  `" `( Z  N
7 v/ k% }' x  ~2 Y& n) E* N3 p
Nakamura T, Nishizawa T, Hagiya M, Seki T, Shimonishi M, Sugimura A, Tashiro K, and Shimizu S. Molecular cloning and expression of human hepatocyte growth factor. Nature 342: 440-443, 1989.. o4 `4 V. a& D: p9 f7 W. f* t% z  Q

Ong AC and Fine LG. Loss of glomerular function and tubulointerstitial fibrosis: cause or effect? Kidney Int 45: 345-351, 1994.
" D1 n3 l# h2 [

Ozaki I, Zhao G, Mizuta T, Ogawa Y, Hara T, Kajihara S, Hisatomi A, Sakai T, and Yamamoto K. HGF induces collagenase (matrix metalloproteinase-1) via the transcription factor Ets-1 in human hepatic stellate cell line. J Hepatol 36: 169-178, 2000.7 E2 B" v' V" C* ?0 |# J- G) G% \2 n

. s- Z8 Q  f" P, y- J; d- P

Parving HH. Initiation and progression of diabetic nephropathy. N Engl J Med 335: 1682-1683, 1996.0 m4 L4 H$ O6 H

Riser BL, Denichilo M, Cortes P, Baker C, Grondin JM, Yee J, and Narins RG. Regulation of connective tissue growth factor activity in cultured rat mesangial cells and its expression in experimental diabetic glomerulosclerosis. J Am Soc Nephrol 11: 25-38, 2000.  z  I( a9 l2 m3 Q6 [
. _* i" t5 ^, ^3 G( L3 X% H
6 Z% M+ x+ J3 p$ L1 r  w& q
1 }. a# `4 |$ Z& j! F1 Z; X
Sharma K, Jin Y, Guo J, and Ziyadeh FN. Neutralization of TGF- by anti-TGF- antibody attenuates kidney hypertrophy and the enhanced extracellular matrix gene expression in STZ-induced diabetic mice. Diabetes 45: 522-530, 1996.

) P. t4 v. b# Q, X4 |

Sharma K and Ziyadeh FN. Hyperglycemia and diabetic kidney disease. The case for transforming growth factor-beta as a key mediator. Diabetes 44: 1139-1146, 1995./ I: [" c. |$ b. n( k9 L" s& h1 L

Shimizu H, Maruyama S, Yuzawa Y, Kato T, Miki Y, Suzuki S, Sata W, Morita Y, Maruyama H, Egashira K, and Matsuo S. Anti-monocyte chemoattractant protein-1 gene therapy attenuates renal injuries induced by protein-overload proteinuria. J Am Soc Nephrol 14: 1496-1505, 2003.. h0 O& V0 v6 y

3 R/ u3 F  }: E  I1 G. {8 _% p3 u
Singh R, Alavi N, Singh AK, and Leehey DJ. Role of angiotensin II in glucose-induced inhibition of mesangial matrix degradation. Diabetes 48: 2066-2073, 1999." R; F' _# u1 I! g

( ^+ t. d* ]( t
Takahashi T, Huynh-Do U, and Daniel TO. Renal microvascular assembly and repair: power and promise of molecular definition. Kidney Int 53: 826-835, 1998.

5 m, M4 w5 C0 M; y6 n

Taniyama Y, Morishita R, Nakagami H, Moriguchi A, Sakonjo H, Shokei-Kim H, Matsumoto K, Nakamura T, Higaki J, and Ogihara T. Potential contribution of a novel antifibrotic factor, hepatocyte growth factor, to prevention of myocardial fibrosis by angiotensin II blockade in cardiomyopathic hamsters. Circulation 102: 246-252, 2000.8 Y, f) f+ `* `" y% h
: I  b7 R: f6 L7 a$ r, M8 x( u
. G; u* S9 t+ K2 E9 e) }0 c3 k
0 j5 G% {8 e7 e5 X! N5 e- C
Taylor GA, Jeffers M, Webb CP, Koo HM, Anve M, Sekiguchi K, and Vande-Woude GF. Decreased fibronectin expression in Met/HGF-mediated tumorigenesis. Oncogene 17: 1179-1183, 1998.

( j! S8 x9 n3 d2 x
The Diabetes Control and Complications Trial Research Group. The effect of intensive treatment of diabetes on the developmental and progression of long-term complications in insulin-dependent diabetes mellitus. N Engl J Med 329: 977-986, 1993.
2 H9 K/ {% B# \) B5 x: N! ^
: w: l/ y# O/ B) K3 @; Z
% h0 f% h& N* C5 N" f/ M
UK Prospective Diabetes Study (UKPDS) Group. Intensive bloodglucose control with sulphonylureas or insulin compared with conventional treatment and risk of complications in patients with type 2 diabetes. Lancet 352: 837-853, 1998.- c4 ]; U2 t3 @' g' d
8 u" }: I5 Y* J5 w; P" O2 W

+ P6 x9 m+ m5 U& s
Wang SN, Lapage J, and Hirschberg R. Role of glomerular ultrafiltration of growth factors in progressive interstitial fibrosis in diabetic nephropathy. Kidney Int 57: 1002-1014, 2000.
' k8 b* Y7 _6 @# Z" I# I( a

Yamamoto T, Nakamura T, Noble NA, Ruoslahti E, and Border WA. Expression of transforming growth factor is elevated in human and experimental diabetic nephropathy. Proc Natl Acad Sci USA 90: 1814-1818, 1993.

Yang J, Dai C, and Liu Y. Systemic administration of naked plasmid encoding hepatocyte growth factor ameliorates chronic renal fibrosis in mice. Gene Ther 8: 1470-1479, 2001.3 t9 r. _* e6 E+ k2 k

6 f/ N0 s5 Y9 q7 b' U1 k
Yang J and Liu Y. Delayed administration of hepatocyte growth factor reduces renal fibrosis in obstructive nephropathy. Am J Physiol Renal Physiol 284: F349-F357, 2003.
: ?: g: \) ?9 V% d

Yang R, Bunting S, Ko A, Schwall R, and Jin H. Hemodynamic effects of scatter factor in concious rats. J Cardiovasc Pharmacol 30: 294-301, 1997.; S: R, l' h7 f5 C) W

  J$ \, ]( T' R( Q3 G0 t# ~  A
Ziyadeh FN, Hoffman BB, Han CC, Iglesias-Cruz MC, Hong SW, Isono M, Chen S, McGowan TA, and Sharma K. Long-term prevention of renal insufficiency, excess matrix gene expression, and glomerular mesangial matrix expansion by treatment with monoclonal antitransforming growth factor- antibody in db / db diabetic mice. Proc Natl Acad Sci USA 97: 8015-8020, 2000.8 j# C5 Z4 S5 x4 w3 t+ d
! D3 G6 m4 j' ], B" f* E

Ziyadeh FN, Sharma K, Ericksen M, and Wolf G. Stimulation of collagen gene expression and protein synthesis in murine mesangial cells by high glucose is mediated by autocrine activation of transforming growth factor-. J Clin Invest 93: 536-542, 1994.

收藏0 分享0 顶0 踩0