|

- 积分
- 0
- 威望
- 0
- 包包
- 0
|

作者:P. Kaler and R. Prasad作者单位:Department of Biochemistry, Postgraduate Institute of Medical Education and Research, Chandigarh, India 4 g6 y, q- p6 W- N0 \
6 z! Y3 \7 W/ K& O# L. i
' e9 C ~5 a; |* ~ F$ `* A ' W+ v: V) z# ?* n6 T( u- @
0 R: D! f, q( K$ Y0 b. u6 V
& c# i: J/ ]0 T3 o" o' R
' D: F/ d& j0 q" n+ G
: l8 ^/ m5 \* L
' Q; R) [) N# _: E6 C
- t+ D7 D* H, B1 x7 y. n
g7 a0 O' o2 a
$ D1 n/ v1 h5 [) G4 t+ a6 R& z* A
& y, B& I* ~, F, ?1 f 【摘要】
) a' z$ p$ I/ O( W ?9 M Previously, in our laboratory a 40-kDa zinc transporter protein was purified and functionally reconstituted in proteoliposomes (Kumar R, Prasad R. Biochim Biophys Acta 1419: 23-32, 1999). Furthermore, we now report the identification of Slc39a10 cDNA encoding the 40-kDa zinc transporter protein by isolating a cloned DNA complementary to zinc transporter mRNA. cDNA was constructed from immunoenriched mRNA encoding the zinc transporter. cDNA was inserted into pBR322 using poly(dC)- poly(dG) tailing. Escherichia coli DH5 cells were transformed, and colonies were screened for zinc transporter cDNA by insertional inactivation. Plasmid DNA was purified from the ampicillin-sensitive clones, and the cDNA was sequenced from both strands. A basic local alignment research tool (BLAST) search of cDNA revealed that it belongs to the Slc39 gene family of zinc transporters and was designated as Slc39a10. Zinc transporter protein deduced on the basis of cDNA sequence was named rZip10 and consists of 385 amino acids with 9 predicted transmembrane domains. The Slc39a10 gene was abundantly expressed in both rat and human tissues. Increased extracellular zinc concentration resulted in upregulation of Slc39a10 in LLC-PK 1 cells expressing rZip10, which was downregulated at higher zinc concentrations. These cells accumulated more zinc than control cells. rZip10-mediated zinc uptake activity was time-, temperature-, and concentration-dependent and saturable which followed Michaelis-Menten kinetics with a K m of 19.2 µM and V max of 50 pmol·min -1 ·mg protein -1. This activity was competitively inhibited by cadmium with K i of 91 µM. rZip10-mediated zinc uptake was inhibited by COOH group-modifying agents such as DCC. Immunofluorescence studies showed that rZip10 localizes to the plasma membrane of LLC-PK 1 cells.
( o' i2 R+ _$ [, d9 }( @ 【关键词】 rat renal brushborder membrane metal influx solute carrier gene superfamily LLCPK cells plasma membrane localization( _0 [) N5 Q, P: n
ZINC IS AN INDISPENSABLE TRACE element that is required for many proteins entangled in DNA synthesis, protein synthesis, mitosis, and cell division ( 21, 27, 41 ). In animals, zinc balance is primarily maintained through a regulated rate of intestinal uptake, fecal elimination of excess zinc, renal reabsorption, and distribution to cells, including intracellular storage ( 23 ). Most, if not all, of these zinc movement pathways are mediated by membrane proteins and zinc transporters. Therefore, regulation of the number, activity, and cellular location of these transporters plays an important role in zinc homoeostasis.- P. {6 ~: [: ~8 H& y! L7 B
# j) [, X. n+ F& @ Y- I
The disturbance of zinc homeostasis causes a variety of severe detrimental effects on animals, including humans. Manifestations of zinc deficiency include growth retardation, hypogonadism in males, dermatitis, poor appetite, mental lethargy, delayed wound healing, cell-mediated and antibody-mediated immune disorders, and, in severe cases, death. Numerous factors that contribute to zinc deficiency in animals include increased anabolic demand, decreased intestinal absorption, and increased urinary/fecal excretion. Two genetic disorders, Acrodermatitis enteropathica ( 31 ) and sickle cell disease ( 33 ), are known to be associated with zinc deficiency. All these disease states of zinc deficiency are thought to be associated with either malabsorption of zinc in the intestine or reduced reabsorption of zinc by tubular epithelial cells in the kidneys.* \9 c; s& V' \* Y5 U" B
" s4 X1 Y q' ~The transport of zinc has been studied in several different isolated cell types including enterocytes, fibroblasts, synaptic vesicles, and membrane vesicles. However, the mechanism of reabsorption and regulatory events which control the transmembrane movement of zinc across renal brush-border membrane (BBM) of epithelial cells as yet remains to be elucidated. We have previously reported the kinetics of zinc transport in monkey renal BBM vesicles, which showed uptake of Zn 2 to be saturable, temperature sensitive, and competitively inhibited by cadmium ( 35 ). Zinc binding studies revealed that in the first instance there is binding of Zn 2 to the exofacial Zn 2 binding component and concomitantly its translocation across the membrane followed by its massive binding to the interior sites of the BBM ( 36 ). Furthermore, we have identified and purified a 40-kDa zinc transporter protein from rat renal BBM, which is the first barrier in the transepithelial movement of zinc ( 24 ). Immunofluorescence staining localized the protein mainly in the renal proximal tubules, indicating its role in zinc transport. Functional characterization of the protein by reconstituting into liposomes further substantiated the role of zinc transporter protein as a zinc importer ( 25 ).
4 {+ z S. x: d# P
6 H( R) f4 b; W) A* k9 {9 y g* [" DIn this study, we report the molecular cloning of a novel 40-kDa zinc transporter (rZip10) protein purified from renal cortex by enriching BBM, whose sequence places it within the ZIP family (Zrt- and Irt-like proteins) of zinc transporters. 65 Zn uptake studies indicate that the Slc39a10 gene encodes a zinc transporter involved in the influx of zinc. We found that the Slc39a10 gene is ubiquitously expressed in both rat and human tissues and demonstrates regulation of Slc39a10 mRNA expression by zinc in the LLC-PK 1 renal cell line.7 }2 w0 \7 o, Z$ }
0 Y: Z8 e1 H* x3 C( i( sMATERIALS AND METHODS1 S% }' k4 w4 D6 H' X
4 \7 a0 }9 }( s% A/ ^: [+ q9 [2 m& e q
Animals and cell line. The experiments conducted in this study were approved by the Animal Ethics Committee, Postgraduate Institute of Medical Education and Research (PGIMER), Chandigarh, India. Adult male Wistar rats were procured from Central Animal House, PGIMER. Bacterial strain Escherichia coli DH5 cells were purchased from Bangalore Genei. The renal epithelial cell line LLC-PK 1 (culture pig kidney type 1, Lilly Laboratories) was purchased from the National Centre for Cell Science (Pune, India).9 q& c9 F) m4 b. N; U
2 O/ B3 t, P3 M7 u6 U- hPurification of zinc transporter protein. Rat renal cortical BBM was prepared by a differential centrifugation method ( 24, 37 ). The purity of the BBM was checked by assaying the marker enzymes of BBM, alkaline phosphatase ( 1 ) and maltase ( 6 ). The contamination of basolateral membrane in the BBM preparation was checked by assaying Na /K -ATPase, the marker enzyme of basolateral membrane ( 38 ). Protein content was estimated as described by Bradford ( 2 ). Zinc transporter protein (40 kDa) from rat renal BBM was purified using different chromatographic procedures, and the purity of the protein was checked by FPLC and SDS-PAGE as described earlier ( 24, 25 ).
- r5 N5 f1 W, Z9 P M' E( p' [
/ b4 \5 p) F5 o/ aGeneration and purification of antisera against purified zinc transporter protein. Five- to seven-month-old healthy rabbits were immunized with 100-150 µg of purified zinc transporter protein emulsified with an equal volume of Freund's complete adjuvant followed by booster doses of emulsified immunogen (50-60 µg) in Freund's incomplete adjuvant at days 7, 14, and 21 ( 45 ). The titer of the antibodies in pre- and postimmunized sera was checked by ELISA. The antiserum showing the highest titer was processed for the purification of anti-zinc transporter IgG by salt precipitation and gel filtration chromatography followed by protein A-Sepharose affinity chromatography ( 45 ). The specificity of anti-zinc transporter antibody for zinc transporter protein was verified by the disappearance of unique immunoreactive bands after coincubation with Zip10 protein (1 mg).
) N- g" v- i8 f% K# Q
4 \" |. B/ n" \; o3 v$ d% EIn vitro translation and gene cloning. mRNA encoding 40-kDa zinc transporter protein was isolated from rat kidney cortexes by polysome immunoadsorption ( 22 ). Specificity of mRNA was assessed by Rapid Translation System 100 using an E. coli HY Kit (Roche Diagnostics) according to the supplier's instructions. Standard protocols were used for synthesis of cDNA ( 40 ), and duplex cDNA was extended with deoxycytidylate (dC) residues. dC-tailed duplex cDNA was ligated into Pst I-cleaved vector pBR322 tailed with deoxyguanylate residues to generate pBR322-Zip10. E. coli DH5 cells were transformed with pBR322-Zip10 ( 40 ). Transformants were selected on LB-plate containing tetracyclin (12.5 µg/ml) and subsequently toothpicked in an ordered array onto a plate containing ampicillin (100 µg/ml) to identify the clones bearing the insert. Plasmid DNA was isolated from the clone containing pBR322-Zip10, and the cDNA insert was sequenced from both strands using universal primers for Pst I.
0 t9 D- I) F/ H4 g
# I% r7 P) k9 G2 ]Plasmid cDNA constructs, transfection, and cell culture. Full-length Slc39a10 cDNA was obtained by RT-PCR using primers with Eco RI (5'-GGAATTCCTTCTCCACAGCGCCGCT) and Xba I (5'-GCTCTAGAAGGTCTTGGCGATACT-3') sites added to their 5' ends. This fragment was digested with Eco RI and Xba I and inserted into Eco RI- and Xba I-digested pcDNA3.1neo( ) vector (Invitrogen) to generate pcDNA3.1-Zip10. LLC-PK 1 cells were grown in medium 199 with Earle's balanced salt solution adjusted to contain 1.5 g/l sodium bicarbonate supplemented with 5% heat-inactivated fetal bovine serum. Cells were cultured in 25-cm 2 flasks incubated in humidified 5% CO 2 isothermal incubators and transfected with vector alone and pcDNA3.1-Zip10 by the calcium phosphate method ( 40 ) using 3-5 x 10 6 cells and 7-10 µg of plasmid DNA. Stable transfectant cell lines (LLC-PK 1 -Vec and LLC-PK 1 -Zip10) were maintained in the presence of neomycin (300 µg/ml). Cell number was determined with a hemacytometer, and cultures were examined weekly for mycoplasma contamination.
B- m2 i4 n# K7 ^$ @$ P, L
( q: l, Q0 `8 e T0 n6 h/ fRegulation of Slc39a10 gene expression in response to zinc concentration. For growth at increased concentration of zinc, ZnSO 4 was added to the culture medium, progressively increasing the concentration from 3 to 20, 50, and, finally, 100 µM at the time of passaging. This approach was necessary because ZnSO 4 at 100 µM added to nonconditioned cells proved toxic. The cells were maintained at different ZnSO 4 concentrations (5, 20, 50, and 100 µM) for 10 days before harvesting of RNA. Total RNA was isolated from LLC-PK 1 -Zip10 cells by acid phenol-guanidinium thiocyanate-chloroform extraction ( 40 ). Slc39a10 and -actin fragments were amplified using a Qiagen One step RT-PCR kit according to the manufacturer's protocol. Slc39a10 amplification primers used were 5'-CCTGCGTAGAATCCCTC-3' and 5'-GTCTGCAGGATGTAATCTTC-3', and primers used for amplification of -actin were 5'-CCAAGGCCAACCGCGAGAAGATGAC-3' and 5'-AGGGTACATGGTGGTGCCGCCAGAC-3'. Products were analyzed by 1% agarose gel electrophoresis with ethidium bromide staining. Band intensities of the RT-PCR products were quantified by densitometry using AlphaEase FC Stand Alone Software taking the known concentration of the 100-bp molecular weight marker bands as a reference.4 ]+ v( `* x1 M3 ^9 w2 q- D
a% n# ?* L* {4 d1 A
Western blotting. For preparing the cell lysate, 5 ml of ice-cold PBSTDS (mixed 50 ml of 10 x PBS with 5 ml of 100% Triton X-100, 2.5 g of sodium deoxycholate, 0.5 g of SDS, and 2 ml of protease inhibitor cocktail) were added to the LLC-PK 1 -Vec and LLC-PK 1 -Zip10 cell monolayer. The cells were incubated at 4°C for 10 min and then centrifuged at 3,000 rpm at 4°C for 15 min. Protein content was estimated in the cell lysate by Bradford method ( 2 ). Cell lysate proteins were resolved on a 12% SDS-polyacrylamide gel. The protein samples were transferred from the polyacrylamide gel to a nitrocellulose membrane for 1 h at 50 V using a Biometra Tankblot electroblotting apparatus. The blot was blocked with 3% BSA in PBS for 12 h. The blot was then washed twice with 2% Tween 20 in PBS for 5 min each. The blot was next incubated with anti-zinc transporter antibody (1:10) for 3 h at room temperature. The blot was again washed twice with 2% Tween 20 in PBS for 5 min each. The blot was then incubated with horseradish peroxidase-conjugated goat anti-rabbit IgG (1:500) for 1 h at room temperature. Finally, the blot was washed twice with 2% Tween 20 in PBS for 5 min each. The color was developed by incubating the blot in the developing solution (6 mg diaminobenzidine in 10 ml PBS containing 10 µl of 30% H 2 O 2 ).
: c9 B: s% w; i0 R% f3 Z
d; M; C/ x+ x; e) JZn uptake assays. Stably transfected LLC-PK 1 -Vec and LLC-PK 1 -Zip10 cells were grown to 50% confluence in 24-well plates and washed once with uptake buffer (15 mM HEPES, 100 mM glucose, and 150 mM KCl, pH 7.0). The cells were then incubated for 15 min (or as indicated) with 0.1 ml of uptake buffer containing 1.0 µCi 65 Zn (Board of Radiation and Isotope Technology, Mumbai, India) at 37°C. Assays were stopped by adding 1 ml of ice-cold uptake buffer supplemented with 1 mM EDTA (stop buffer). Cells were collected by filtration on nitrocellulose filters (0.45-µm pore size, Millipore) and washed three times with stop buffer to give a total wash of 10 ml. Cell-associated 65 Zn radioactivity was measured with a gamma counter. Zinc accumulation in LLC-PK 1 -Vec and LLC-PK 1 -Zip10 cells was measured on an atomic absorption spectrophotometer (Analyst-400, PerkinElmer) by the wet ashing method ( 42 ). A ZnCl 2 stock was prepared at 100 mM in 0.02 N HCl. For complete medium as the uptake buffer, the 65 Zn was added to the medium and incubated at 20°C for 24 h before use to ensure its equilibration with the medium components. Cells were grown in complete medium to 50% confluence, harvested, and washed twice with an equal volume of PBS with or without 1 mM EDTA. The cells were resuspended in 1 ml of perchloric-nitric acid mixture (1:1), and the samples were incubated at 100°C for 16 h. One milliliter of 0.36 N HNO 3 was added in each sample, and zinc content was estimated on the atomic absorption spectrophotometer calibrated with Zn standards (Sigma) and standard reference material SRM-1577 (bovine liver) obtained from the National Bureau of Standards (Washington, DC) using a hollow cathode lamp type C-HCl at a wavelength of 213.86 nm. The final values were normalized to protein content.
+ f8 }) @! r5 d6 h4 X) s
. U1 K/ _5 n% n6 A9 p' ~: L; s! hImmunofluorescence microscopy. Cell lines were harvested, washed once in PBS, and resuspended in PBS containing 2% fetal bovine serum. The cells were attached to polylysine-coated microscope slides and fixed in ice-cold 100% methanol for 15 min at -20°C. The cells were washed three times in PBS and probed with anti-zinc transporter antibody (1:10 dilution) for 60 min at 20°C, washed with PBS, and then probed with FITC-conjugated goat anti-rabbit IgG antibody (1:20 dilution) for 60 min at 20°C. A duplicate set was stained with Evan's blue dye. The cells were mounted in 50% glycerol. Slides were examined under a Nikon E600 fluorescent microscope equipped with a 260-W Hg illuminator (488-nm excitation and a 610-nm band-pass filter). The dull red color of the Evans blue makes for the maximum color contrast against the green of fluorescein, thus facilitating photography. y% T. }) M4 }( j0 |. U
! L8 s/ w" o- d k0 w1 eAssessment of rZip10 expression in rat and human tissues. The presence and level of Slc39a10 mRNA in different rat and human tissues were determined by RT-PCR. Total RNA was isolated from rat kidney, intestine, liver, brain, pancreas, testis, human kidney, and intestine by acid phenol-guanidinium thiocyanate-chloroform extraction ( 39 ). RT-PCR was carried out using a Qiagen one-step RT-PCR kit using Slc39a10 gene-specific primers synthesized on the basis of cDNA sequence (5'CCTGCGTAGATATCCCTC 3' and 5'GTCTGCAGGATGTAATCTTC 3'). Slc39a10 primers were used to amplify a 550-bp fragment from within the Slc39a10 open reading frame. The products were analyzed by 1% agarose gel electrophoresis, stained with ethidium bromide, and photographed with a gel documentation system. Specific -actin primers were used to ensure that all reactions were performed in a linear range with respect to template DNA. Quantification of amplification products was done by densitometric analysis using AlphaEase FC Stand Alone Software taking the known concentration of the 100-bp molecular weight marker bands as a reference.
& g5 c* V+ t- F/ B" Z) m" j; S# G' P# W' A7 g Y
cDNA nucleotide and amino acid sequence analysis. Database comparisons were performed using basic local alignment research tool (BLAST). Protein sequence alignments and hydropathy plots were constructed using Gene Runner Program, Version 3.02.
6 I: U) X5 `- r$ O3 F. T9 |# v( ?' `
Accession number. The sequence data reported for Slc39a10 were submitted to GenBank under accession number DQ256461.6 l- `$ d" o6 ~, m5 \5 X X
( e! D- \2 e6 [9 N6 T. B. P
Statistical analysis. All assays were performed three times with duplicates each time. Statistical significance between the groups was determined by way of ANOVA for means and SD ( P 0.05 was considered significant) using Student's unpaired t -test. SPSS statistical software (version 10.0) was used for statistical analysis., z5 F K4 Q( g7 N2 H$ C5 ], d
( I9 S6 F/ C0 q; DRESULTS
9 W, D [8 A7 @8 y3 ?) `( w4 B' S- @
Purification of zinc transporter protein. BBM from rat kidney cortexes was isolated and purity was checked by assaying its marker enzymes, alkaline phosphatase and maltase. Alkaline phosphatase and maltase were found to be enriched 8- to 11-fold in the BBM preparation compared with the homogenate. There was negligible contamination of the basolateral membrane as suggested by a decrease in Na -K ATPase activity in the BBM preparation compared with the cortical homogenate. Fold-purification in zinc transporter protein after different steps of purification was found to be 33 ( Table 1 ). The purified protein showed a single band on silver nitrate staining and moved with apparent electrophoretic mobility of 40 kDa on 12% SDS-PAGE ( Fig. 1 A ). This protein has been functionally characterized by incorporation into proteoliposomes, as reported earlier ( 25 ).
+ p) w3 r) V' R: {1 t; g. h
+ K( i7 Z. H0 zTable 1. Fold-purification of zinc transporter protein after each step of purification; p: c! u/ l! b2 D; Z: w' R+ @
5 S/ a* r; T7 z# |% G$ u
Fig. 1. A : SDS-PAGE of protein samples obtained after various steps of chromatographic purification. Lane 1, standard molecular weight marker; lane 2, brush-border membrane (BBM) proteins; lane 3, -octylglucopyranoside-solubilized BBM proteins; lane 4, Sephadex G-75-purified proteins; lane 5, DEAE-Sepharose-purified protein; lane 6, phenyl Sepharose-purified protein. B : characterization of rabbit anti-zinc transporter antibody. Representative Western blot of rat zinc transporter protein incubated with purified anti-zinc transporter antibody ( lane 2 ), preimmune serum ( lane 3 ), or coincubated with zinc transporter protein ( lane 4 ) illustrating antibody specificity is shown. C : SDS-PAGE gel analysis of in vitro translated polypeptides from total rat kidney mRNA and from purified zinc transporter mRNA. Lane 1, standard molecular weight marker; lane 2, translation products of total mRNA; lane 3, translation product shown in lane 2 after immunoprecipitation with anti-zinc transporter antibody; lane 4, translation products of zinc transporter mRNA; lane 5, translation product shown in lane 4 after immunoprecipitation with anti-zinc transporter antibody.3 c. X8 o4 D9 K
* y3 _- ]% @ E a: V7 s( h. qSpecificity of anti-zinc transporter antibody. The specificity of the anti-zinc transporter antibody was evident from the appearance of a single band corresponding to 40 kDa on the immunoblot ( Fig. 1 B, lane 2 ). This band was not observed in the immunoblot of zinc transporter protein incubated with preimmune sera ( Fig. 1 B, lane 3 ).6 F4 }5 \. q/ |7 }6 U
+ T- a2 x: W) ?& ]: g/ c
Isolation of Slc39a10 cDNA. Purification of mRNA encoding 40-kDa zinc transporter protein up to homogeneity by polysome immunoadsorption was evident from in vitro translated products. Translation of immunopurified mRNA encoding the zinc transporter showed a single band of 40 kDa on a 12% polyacrylamide gel ( Fig. 1 C ). To favor the production of long transcripts, Slc39a10 cDNA was synthesized from mRNA with a high concentration of dNTPs and Moloney murine leukemia virus reverse transcriptase. The yield of first-strand cDNA synthesized was 50.4% of the mRNA used in the reaction mixture. Second-strand cDNA was synthesized using E. coli DNA polymerase I. The amount of second-strand synthesis was found to be 76.19% of first-strand incorporation. dG-tailed pBR322 was annealed to duplex cDNA, having a terminal dC tract of 15-30 residues to generate pBR322-Zip10. Transformation of competent E. coli DH5 cells with 0.1 pmol of pBR322-Zip10 produced four tetracyclin-resistant transformants. Seventy-five percent of the tetracyclin-resistant clones were found to be ampicillin resistant, and only 25% were found to be ampicillin sensitive. Plasmid pBR322-Zip10 was isolated from E. coli DH5 cells using a Qiagen plasmid DNA isolation kit. For analysis of the cDNA insert, pBR322-Zip10 was digested with restriction enzymes Eco RI and Pst 1. Analysis of digestion products on 1.5% agarose gels showed the presence of a single band that moved at a mobility of 4,363 ± 1,450 bp. This is because a single Eco RI restriction site is present in the plasmid pBR322, and therefore the recombinant plasmid pBR322-Zip10 was cut at only one site. The plasmid pBR322-Zip10 digested with Pst 1 was cleaved into two fragments, as the insertion of a cDNA insert produces two Pst 1 restriction sites. One of these fragments moved at a mobility of 4,363 bp, corresponding to the Pst 1-digested plasmid pBR322. The second fragment moved at a mobility of 1,450 ± 50 bp. This fragment represents the cDNA encoding zinc transporter protein and was sequenced from both strands. The cDNA insert was 1,463 bp in length ( Fig. 2 ).
/ ~0 d" X* V; I% f. K3 ], N1 t/ E% h
7 o$ ]- ?7 n' FFig. 2. Slc39a10 cDNA and rZip10 protein sequence. The amino acid sequence of the zinc transporter rZip10 was deduced from the Slc39a10 cDNA sequence on the basis of genetic code using Gene Runner, version 3.02. Transmembrane domains (I-IX) are underlined, and the histidine-rich motif is depicted by asterisks (*).
4 o0 `/ u6 B! ^6 m N& o8 L7 _% H' W" p0 b
The amino acid sequence of zinc transporter protein (385 amino acids) was deduced from the 1,463-bp cDNA sequence on the basis of genetic code using Gene Runner (version 3.02). The Slc39a10 sequence has been submitted to GenBank under accession number DQ256461. BLAST results of both the nucleotide (BLASTn) and amino acid sequence (BLASTp) of the zinc transporter showed that this membrane transporter belongs to a metal transporter family of Zip proteins (Zrt- and Irt-like protein); hence, we designated this zinc transporter protein as rZip10, and the gene encoding rZip10 was represented as Slc39a10. Identity between rZip10 and other members of the ZIP family showed 80% similarity over a region 432 amino acids for human Zip4; 53% similarity over a stretch of 466 amino acids for rat Zip4; 23 and 26% similarity over a region of 147 amino acids for human and rat Zip8, respectively; 24% similarity over a stretch of 191 amino acids for human Zip12; and 28 and 26% similarity over a region of 164 and 156 amino acids for human and rat Zip14, respectively.3 V4 p4 ?7 y) b# W
' S3 T! t, g! W
Multiple sequence alignment analysis of rZip10 was studied with human, rat, and plant zinc transporters ( Fig. 3 A ). Shaded residues represent positions of identity or similarity among the sequences compared with rZip10. The region best conserved among ZIP family members encompasses transmembrane domains VII-IX of the nine-transmembrane domain structure ( Fig. 3 C ). Topology prediction indicates the presence of nine membrane-spanning domains (I-IX) and a histidine-rich intracellular loop (-HSDHSH-) between transmembrane domains VI and VII ( Figs. 2 and 3 B ). This histidine-rich loop may be potentially involved in zinc binding. Sequence analysis also revealed the presence of various peptidase sites i.e., sites for endoproteinase, carboxypeptidase B, trypsin, and chymotrypsin. The protein has an isoelectric point of 4.67. ZIP family transporters are involved in zinc influx into the cytosol from the outside of cells or from the lumen of intracellular compartments.
" B6 |) v/ i* m% o6 I( N% e# y% ^( v8 {! L7 x
Fig. 3. A : alignment of rZip10 amino acid sequence with representative plant, human, and rat ZIP transporters. Arabidopsis thaliana atZIP4 (accession no. NM_100972 ), human hZip2 (accession no. NM_014579 ) and hZip4 (accession no. NM_017767 ), and rat rZip2 (accession no. XM_223975 ) and rZip4 (accession no. XM_216970 ) were aligned with rat rZip10 (accession no. DQ256461 ). Shaded residues represent positions of identity or similarity among the sequences compared with rZip10. B : Kyte-Doolittle hydropathy plot for rZip10 was constructed using Gene Runner (version 3.02). The 9 predicted transmembrane domains are numbered I-IX. C : basic local alignment research tool (BLAST) of rZip10 showing a conserved domain with the ZIP family of zinc transporter proteins.
. Z1 z6 h: f$ V* l5 r" M, n1 e8 @4 a. ?* K8 R
Regulation of Slc39a10 mRNA in response to zinc levels. To assess the regulation of Slc39a10 mRNA expression in response to varying extracellular zinc concentrations, LLC-PK 1 -Zip10 cells were exposed to increasing extracellular zinc concentrations. Total RNA was isolated from rZip10-expressing LLC-PK 1 cells by acid phenol-guanidinium thiocyanate-chloroform extraction. The quality of total RNA was assessed on 1.5% formaldehyde agarose gels after ethidium bromide staining. Both 28S and 18S RNA bands were clearly visible, thereby indicating that total RNA isolated from cells at each zinc concentration was of good quality ( Fig. 4 C ). Expression of Slc39a10 in LLC-PK 1 -Zip10 cells incubated with varying extracellular zinc concentrations was assessed by RT-PCR. An internal fragment of 550 bp was amplified using Slc39a10 gene-specific primers by RT-PCR. Expression of Slc39a10 was significantly increased in LLC-PK 1 -Zip10 cells with increasing extracellular zinc concentrations, i.e., from 5 to 50 µM, but the expression of Slc39a10 was downregulated when the cells were exposed to high levels of zinc (100 µM) ( Fig. 4 A ). -Actin expression was used as a positive control to check the efficacy of an RT-PCR reaction. -Actin expression was found to be similar at each zinc concentration, thereby indicating that equal amounts of total RNA were used in the RT-PCR ( Fig. 4 B ). h1 w% P7 W- @+ d# U1 \" s: Q
I& P+ g- X4 F# {; h$ W# u5 ~* q
Fig. 4. Expression of Slc39a10 mRNA in response to zinc levels. LLC-PK 1 -Vec and LLC-PK 1 -Zip10 cells were maintained at increasing extracellular zinc concentrations, i.e., at 5, 20, 50, and 100 µM. Total RNA was isolated by acid phenol-guanidinium thiocyanate-chloroform extraction. Expression of Slc39a10 mRNA in response to zinc levels was assessed by RT-PCR. A : Slc39a10 mRNA levels in response to 5 ( lane 2 ), 20 ( lane 3 ), 50 ( lane 4 ), and 100 µM zinc ( lane 5 ); lane 1, 100-bp DNA molecular weight marker. B : -actin expression using specific -actin primers as a control. -Actin expression was found to be similar at each zinc concentration, ensuring that all reactions were performed in a linear range with respect to template DNA. C : total RNA was visualized on 1.5% formaldehyde-agarose gels after ethidium bromide staining. D : Western blotting was done for the detection of Zip10 in LLC-PK 1 -Vec and LLC-PK 1 -Zip10 cells in response to varying extracellular zinc concentrations, i.e., at 5, 20, 50, and 100 µM. E : histograms were obtained by densitometric measurement of band intensities of Slc39a10 that were normalized with -actin band intensities. Light bars, LLC-PK 1 -Vec; dark bars, LLC-PK 1 -Zip10.
: G* ~; j$ k6 A3 ?% j4 [! d
3 B5 v1 T9 G4 q6 Z& DExpression of endogenous Slc39a10 mRNA was also found to be significantly increased in LLC-PK 1 -Vec cells with increasing extracellular zinc concentrations, i.e., from 5 to 50 µM, but the expression of Slc39a10 was downregulated when the cells were exposed to high levels of zinc (100 µM) ( Fig. 4 A ). However, the expression of endogenous Slc39a10 mRNA was less compared with transfected Slc39a10 mRNA.
2 | H* x K/ Y0 f
) J+ |: X. a+ S" j0 }3 vThe levels of Zip10 protein in LLC-PK 1 -Vec and LLC-PK 1 -Zip10 cells in response to varying extracellular zinc concentrations were determined by Western blotting. Zip10 levels were found to be consistent with levels of Slc39a10 mRNA as observed by RT-PCR ( Fig. 4 D ).
) Z s4 y) s) u$ k8 b4 s/ }7 \4 l- I$ O5 y
rZip10 is a zinc transporter. Analysis of zinc content by atomic absorption spectroscopy showed that LLC-PK 1 -Zip10 cells accumulated 60% more zinc than did control cells ( Fig. 5 A ). When PBS containing 1 mM EDTA was used as a more stringent buffer for the removal of surface-bound zinc, cell-associated zinc was reduced in both cell types. However, rZip10-expressing cells consistently accumulated more zinc than did control cells. This conclusion was further supported by the analysis of uptake rates using complete medium assay buffer. @* @2 q6 n# t8 r! e
+ u% z w6 d0 E6 [. Z: M) [ a
Fig. 5. Characterization of rZip10 zinc transporter. A : LLC-PK 1 -Vec (light bars)- and rZip10-expressing cells (dark bars) were grown in complete medium to 50% confluence, harvested, and washed with PBS ± EDTA before analysis of zinc accumulation by atomic absorption spectroscopy. B : 65 Zn uptake measured as a function of time at 37 and 4°C in LLC-PK1-Vec (, )- and rZIP10-expressing cells (, ). C : 65 Zn uptake measured at varying Zn concentrations (5-60 µM) for 15 min at 37°C. D : measurement of kinetic constants in LLC-PK 1 -Vec ( )- and rZIP10-expressing cells ( ). E : 65 Zn uptake measured in the absence ( ) and/or presence of divalent cations Cd 2 ( ) and Ca 2 ( ). F : 65 Zn uptake of sulfhydral and COOH group pageers in LLC-PK 1 (light bars)- and rZip10-expressing cells (dark bars). Zn, zinc; IA, iodoacetate; ME, -mercaptoethanol; DCC, N, N '-dicyclohexylcarbodiimide.( @) }) \ J, h1 {
1 h0 J! s3 d4 {* |5 p. F) }
65 Zn uptake was examined in the LLC-PK 1 cells transfected with vector pcDNA3.1 and pcDNA3.1-Zip10 (LLC-PK 1 -Vec and LLC-PK 1 -Zip10, respectively). At 4°C, little zinc accumulation was detectable with either cell type ( Fig. 5 B ). At 37°C, zinc uptake by LLC-PK 1 -Vec cells indicated the presence of an endogenous zinc uptake system. Consistent with an ability of rZip10 to transport zinc, 65 Zn uptake was greatly stimulated in LLC-PK 1 cells expressing rZip10 ( Fig. 5 B ).* Z, P2 k# c% d! ?
& S9 D! r( F/ }3 ?; kEndogenous zinc uptake activity measured in LLC-PK 1 -Vec cells was found to be concentration dependent and saturable ( Fig. 5 C ). When assayed over a range of zinc concentrations, this system showed Michaelis-Menten kinetics with a K m of 19.6 µM and a V max of 27 pmol·min -1 ·mg protein -1 ( Fig. 5 D ). Zinc uptake into LLC-PK 1 -Zip10 cells was also found to be concentration dependent and saturable ( Fig. 5 C ). LLC-PK 1 -Zip10 cells also showed Michaelis-Menten kinetics with a K m of 19.2 µM and V max of 50 pmol·min -1 ·mg protein -1 ( Fig. 5 D ). K m of the previously characterized transporter and rZip10 differ by 50-fold. Both proteins are really the same. Previously, purified zinc transporter was reconstituted into proteoliposomes. In the present study, zinc uptake assays were done in stably transfected LLC-PK 1 -Zip10 cells. The probable reason for the difference in the kinetic constants of the protein is the change in the microenvironment of the protein in the proteoliposomes. The contribution of rZip10 to zinc uptake activity was estimated by subtracting the vector control values from the LLC-PK 1 -Zip10 value ( Fig. 5 C, dashed line). Thus both rZip10-dependent uptake activity and endogenous zinc uptake activity in LLC-PK 1 cells were found to be time, temperature, and concentration dependent and saturable. These results indicate that the Slc39a10 gene encodes a zinc transporter involved in the influx of zinc.
/ ^. Q1 ~5 Q$ t
; E7 {8 C1 n5 n$ C$ nEffect of divalent metal cations on zinc uptake. It has been reported earlier that zinc uptake across renal BBM is competitively inhibited by cadmium whereas calcium had no effect on zinc uptake ( 36 ). To assess whether the endogenous zinc uptake system or rZip10 is potentially capable of transporting substrates other than zinc, we tested cadmium and calcium for their ability to inhibit zinc uptake activity. In these assays, zinc uptake by LLC-PK 1 -Vec and LLC-PK 1 -Zip10 cells was measured at different zinc concentrations in the presence of 50 µM cadmium or calcium. Zinc uptake by both the LLC-PK 1 endogenous system (data not shown) and LLC-PK 1 -Zip10 cells was significantly inhibited by cadmium ( P
' [- M8 Q* A2 G0 v2 I
1 v2 `9 b3 W0 M1 [& f0 a2 C, q4 SEffect of sulfhydryl group and COOH group blockers on zinc uptake. In the presence of the sulfhydryl group blocker iodoacetate, zinc uptake by LLC-PK 1 -Zip10 cells was inhibited by 8% ( Fig. 5 F ). Zinc uptake in the presence of -mercaptoethanol was inhibited by 45% in cells expressing rZip10. In the presence of COOH group blocker DCC, zinc uptake by LLC-PK 1 -Zip10 cells was inhibited by 56% ( Fig. 5 F ).1 X, G$ t! C4 u) I. n
: P! y" }) O! d0 a2 u. J! dLocalization of rZip10. Cellular localization of rZip10 was determined in LLC-PK 1 - and rZip10-expressing cells by immunofluorescence. The role of rZip10 as a zinc uptake transporter suggests that this protein should be localized to the plasma membrane of the cell. Less fluorescence was detected in control LLC-PK 1 cells, whereas rZip10-expressing cells showed a bright rim of fluorescence at the periphery, thereby indicating that rZip10 is localized on the cell membrane ( Fig. 6 ). However, we cannot comment on the localization of the Zip10 protein to internal membranes as this aspect has not been evaluated in the current study.
! F4 w* Q4 a1 P! V$ k! F) N: }+ w7 ^' T6 u9 F& [1 \, E
Fig. 6. Subcellular localization of rZip10. LLC-PK 1 -Vec and LLC-PK 1 -Zip10 cells were attached to polylysine-coated microscope slides and fixed in ice-cold 100% methanol. The cells were washed with PBS and probed with anti-zinc transporter antibody for 60 min at 20°C, washed with PBS, and then probed with FITC-conjugated goat anti-rabbit IgG antibody for 60 min at 20°C. A duplicate set was stained with Evan's blue. The cells were mounted in 50% glycerol and viewed with a Nikon Eclipse E600 fluorescence microscope. A : no significant fluorescence was observed in control LLC-PK I -Vec cells. E : counterstain with Evan's blue. B : localization in rZip10-expressing cells at 20 µM zinc concentration. F : counterstain with Evan's blue. C : localization in rZip10-expressing cells at 50 µM zinc concentration. G : counterstain with Evan's blue. D : localization in rZip10-expressing cells at 100 µM zinc concentration. H : counterstain with Evan's blue.
. ^1 z& Y) Y. x- p4 p
8 O7 b3 d7 N; w( ~* xSlc39a10 gene is ubiquitously expressed. Expression of the Slc39a10 gene was examined in various rat and human tissues by RT-PCR. Slc39a10 mRNA levels were detectable in rat small intestine, pancreas, testis, brain, and liver as well as in human kidney and intestine. All these tissues are known to play an important role in zinc uptake and/or storage ( Fig. 7 ). However, the levels of Slc39a10 mRNA varied among these tissues. This mRNA was far more abundant in the small intestine, an important organ involved in the regulation of mineral metabolism. Intestinal and renal absorptive cells are polar in nature and possess BBM, which is the first barrier encountered by various cells during absorption in the intestine and kidney. In the pancreas, zinc is required for the synthesis and action of insulin, both physiologically and in the pathogenic state of diabetes.; [0 h% [4 P* C/ C
) G. D( k- R7 k3 L0 v H
Fig. 7. Expression of Slc39a10 mRNA in rat and human tissues as assessed by RT-PCR. A : Slc39a10 mRNA levels in rat liver ( lane 2 ), brain ( lane 3 ), pancreas ( lane 4 ), testis ( lane 5 ), small intestine ( lane 6 ), kidney ( lane 7 ), human kidney ( lane 8 ), and intestine ( lane 9 ); lane 1, 100-bp DNA molecular weight marker. B : -actin expression using specific -actin primers as a control was found to be similar, ensuring that all reactions were performed in a linear range with respect to template DNA. C : total RNA was visualized on 1.5% formaldehyde-agarose gels after ethidium bromide staining. D : histograms were obtained by densitometric measurement of band intensities of Slc39a10 that were normalized with -actin band intensities.
`9 g" q! t5 {( v! w/ S# j9 n5 W7 ?# U
DISCUSSION0 I% [* } X5 x
, p6 c5 B% G( `* o( N1 T0 \Zinc homeostasis in mammals is primarily regulated through the control of zinc absorption in the intestine and the loss of endogenous zinc through both pancreatic and liver excretion. Reabsorption and excretion of zinc through the kidney is also a contributing factor to zinc homeostasis. To date, genetic and genomic studies have identified several ZIP proteins involved in zinc intrusion in mammalian cells ( 15, 19, 27 ). All these proteins share the hallmark features of the ZIP family of transporters. Zip1 is localized to the plasma membrane in erythroleukemia cells and intracellular vesicles in adherent cells ( 12 ). Zip2 is localized to the plasma membrane only ( 11 ), while Zip3 is localized to the plasma membrane and perinuclear compartment of mammary epithelial cells ( 20 ). ZIP 1 and Zip4 are present on the BBM, whereas Zip5 is localized to the basolateral surface of renal epithelial cells ( 7, 49 ). Zip6 is localized to the plasma membrane only ( 47 ), and Zip7 is localized to the Golgi apparatus and is ubiquitously expressed ( 17 ). Numerous approaches have been directed toward defining the characteristics and mechanisms associated with zinc absorption by the small intestine. Another metal transporter, DCT1/DMT1/Nramp2, is a member of the Nramp family of transporters and is structurally unrelated to either ZIP or ZnT members. In addition to the efficient transport of iron, DCT1/DMT1/Nramp2 has the potential for zinc transport activity ( 16 ). wtDMT1 transported zinc but at a much lower V max and with lower apparent affinity than wtDMT1-mediated iron transport ( 30 ). Recent reports have provided counterevidence to this activity ( 39, 46 ). DCT1/DMT1/Nramp2 is responsible for iron uptake in the intestine ( 3, 46 ). While zinc is not transported via DMT1, it does directly influence the function and expression of the transporter, elevating both the protein and mRNA levels and increasing pH-dependent uptake of iron ( 50 ). Although information on zinc transporters is amply documented, we are still far from a full understanding of the molecular mechanisms that control zinc metabolism. Transport proteins involved in reabsorption of zinc in the renal tubular system have not been well characterized. In lieu of this, a 40-kDa zinc binding protein has been purified from rat renal BBM and physicochemically characterized ( 24, 25 ). Immunofluorescence staining localized the protein mainly in proximal tubules, indicating its role in zinc transport. Functional characterization of purified zinc binding protein was carried out by reconstituting it into proteoliposomes. The findings suggested that the purified 40-kDa zinc binding protein is a zinc transporter in renal tubules, involved in the influx of zinc into epithelial cells. In this study, we describe the cloning and characterization of the gene encoding rZip10, a novel zinc transporter, from renal BBM to further understand the molecular mechanism of zinc transport across the biological membranes. Sequence analysis of Slc39a10 cDNA and Zip10 protein using BLASTn and BLASTp, respectively, premises it within the ZIP family of zinc transporters involved in metal ion uptake and includes nine putative transmembrane domains in the rat renal BBM as predicted by using Gene Runner (version 3.02). The multiple histidine residues in the loop region between transmembrane domains III and IV in the Zip proteins have been hypothesized to act as zinc binding domains ( 19 ). However, our data indicate that multiple histidine residues are present in the loop region between transmembrane domains VI and VII. A histidine stretch (HSDHSH) between transmembrane domains VI and VII is not a common motif. The other Zips do not have a HSDHSH stretch between transmembrane domains VI and VII. Although human and mouse Zip4 share a significant amino acid similarity throughout the protein, the eight predicted transmembrane domains are the most highly conserved and many of the mutations found in Acrodermatitis enteropathica are in these domains. These domains may form a channel through which zinc must pass ( 8 ). From mutagenesis studies of Arabidopsis IRT1, an iron transporter, revealed that conserved histidyl, serine, and glycyl residues in spanning domains are essential for all uptake activity ( 9 ). Thus we speculate that the HSDHSH stretch between transmembrane domains VI and VII must play a paramount role in rZIP function.
8 g9 T& n- ~: L/ ?5 x9 k Y) v& J# V |2 E. g0 s8 y* S0 S. I9 Z
Regulation of the expression of mammalian ZIP members is not well understood. The expression levels of some mammalian ZIP members are regulated by zinc; mRNA levels of hZip1, hZip2, hZip4, and hZip7 augment during the zinc-deficient state, but it is unknown whether this elevation results from transcriptional activation or stabilization of mRNA ( 5, 4, 26 ). Yeast ZIP members ZRT1 and ZRT2 are controlled at the transcriptional level ( 51, 52 ). In addition, ZRT1, with a high affinity to zinc, but not ZRT2, with a low affinity, is regulated posttranslationally. When cells are exposed to high levels of extracellular zinc, ZRT1 is rapidly inactivated through ubiquitin-mediated endocytosis and degraded in vacuoles ( 13, 14, 53 ). This type of regulation may be a cell-protective device that serves in response to extreme zinc excess. In our study, we observed that an increase in extracellular zinc concentration from 5 to 50 µM resulted in upregulation of Slc39a10 mRNA levels in LLC-PK 1 cells expressing Zip10. However, Slc39a10 mRNA levels in LLC-PK 1 -Zip10 cells were downregulated at higher zinc concentrations. Also, endogenous Slc39a10 mRNA levels were found to follow the same trend as the transfected Slc39a10 mRNA. Furthermore, the levels of Zip10 protein in LLC-PK 1 -Vec and LLC-PK 1 -Zip10 cells in response to varying extracellular zinc concentration were found to be consistent with levels of Slc39a10 mRNA. Therefore, it can be speculated that a change in the expression of Slc39a10 mRNA and Zip10 protein in response to zinc indicates its effect at either the transcriptional or posttranslational level that deserves further investigation.
/ r" {& r/ ]4 R5 @% j3 G
% E! f6 l1 `8 G# @$ B7 @% _Zinc uptake mediated by hZip1, hZip2, mZip4, and mZip5 is time, temperature, and concentration dependent and saturable ( 8, 12, 11, 49 ). Similarly, in our study zinc uptake by the endogenous system as well as rZip10-expressing cells was found to be time, temperature, and concentration dependent and saturable. It is not known whether rZip10 is diffusive, electrogenic, or electroneutral; earlier experiments on zinc uptake in isolated monkey renal BBM using 1 mM zinc in incubation buffer containing either 300 mM mannitol, 1 mM Tris-HEPES (pH 6.8), or 150 mM Nacl, 100 mM mannitol, 1 mM Tris-HEPES (pH 6.8) for different time intervals showed no significant change in Zn uptake ( 34, 35 ). Therefore, we used high glucose/high KCl in kinetic studies. The apparent K m for zinc uptake by rZip10 (19.2 µM) was not significantly different from that of the endogenous uptake system (19.6 µM). However, there was an approximately twofold increase in V max in LLC-PK 1 -Zip10 cells compared with LLC-PK 1 -Vec cells. This increase can be attributed to the expression of rZip10 in cells transfected with rZip10.+ p( q0 F2 }/ G; ]
0 _7 P4 H+ P6 q5 J- `
Apart from zinc, other metals such as iron, copper, cadmium, nickel, manganese, and cobalt may be substrates for some members of the ZIP family such as Zip1, Zip2, Zip4, and Zip5. However, the molecular mechanism of broad specificity and its physiological significance are yet unknown ( 8, 11, 12, 49 ). Cadmium is a toxic and carcinogenic nonessential metal ( 18 ), which can enter the body through the intestine, skin, and lung and accumulates in the kidney ( 18, 43, 44 ). Therefore, the kidney is its most important target organ where cadmium accumulates mainly in the renal cortex ( 32 ). Cadmium strongly interacts with essential trace elements such as zinc, both at the absorption level in the intestine ( 10 ) and kidney ( 34, 36 ). Cadmium-induced nephrotoxicity has been reported in rhesus monkeys subjected to protein calorie malnutrition ( 36 ). Recently, mouse Zip8 has been identified as the transporter responsible for cadmium-induced toxicity in the testis ( 7 ). In our study, zinc uptake activity of LLC-PK 1 cells expressing rZip10 was competitively inhibited by cadmium but the presence of calcium did not interfere with the rZip10-mediated zinc uptake.
9 }5 ^4 M @2 Y' g
. g: x4 X4 y. P5 TThe mechanism of transport used by Zip proteins is still unresolved. This is largely because of the nonconformity of results when the properties of different transporters have been analyzed. In yeast, both Zrt1 and Zrt2 are dependent on energy for zinc transport ( 42 ). In contrast, neither hZip1 ( 12 ) nor hZip2 ( 11 ) requires ATP for activity. Thus it remains unresolved whether ZIP transporters use the same or different transport mechanisms. Furthermore, sulfhydral groups have been shown to be involved in Ca 2 transport and Na -phosphate cotransport in the intestinal and renal BBM ( 28, 29 ). However, in our study zinc uptake by the endogenous system and Zip10-expressing cells was not affected by the presence of sulfhydral group-blocking agents such as iodoacetate, thereby suggesting that cysteine residues are not involved in the zinc transport process. However, sulfhydral-containing compounds such as -mercaptoethanol resulted in a significant inhibition of rZip10-mediated zinc uptake, demonstrating the prevention of sequestration of zinc to the zinc carrier protein. It was found that rZip10 contains a high content of COOH group-containing amino acid residues, i.e., glutamic acid and aspartic acid, in the rZip10 protein. In view of this, zinc uptake was studied in the presence of COOH group blockers. Interestingly, rZip10-mediated zinc uptake was inhibited by COOH group-modifying agents such as DCC.5 k" X6 s' I- \, ~0 \8 b
+ h1 D5 @# T; vIntracellular zinc homeostasis is maintained by the physiological processes that include zinc uptake, subcellular organelle zinc sequestration and restoration, and zinc export. The members of the ZIP family have been demonstrated to be involved in zinc uptake and in the release of stored zinc into the cytoplasm of cells when zinc is deficient. In yeast, ZRT1 and ZRT2 and in mammals Zip1-5 proteins have been reported to function as zinc uptake proteins. The cellular location of ZIP transporters is therefore presumed to be at the plasma membrane, where zinc uptake must necessarily occur, and has been shown for K562 erythroleukemia cells ( 11, 12 ), enterocytes, Madin-Darby canine kidney cells, human embryonic kidney cells, and mice pancreatic acinar cells. As rZip10 is a transporter protein involved in zinc uptake across the plasma membrane, it therefore should be localized on the plasma membrane. We confirmed the localization of rZip10 on the plasma membrane of LLC-PK 1 cells by immunofluorescence microscopy. Less fluorescence was observed in LLC-PK 1 -Vec cells.
" o5 S" o5 H& B- @( H2 @0 {3 b' b" D$ P
Our study demonstrates that the Slc39a10 gene was abundantly expressed in rat tissues such as small intestine, pancreas, testis, brain, and liver and in human kidney and intestine. The expression of Slc39a10 in these tissues might help fulfill their particular needs for zinc metabolism. However, the levels of Slc39a10 mRNA varied among these tissues. The highest levels were detected in the small intestine, an important organ involved in the regulation of mineral metabolism. The role of rZip10 as a zinc transporter in relation to other Zips or DMT1 in controlling the overall zinc homeostasis at the cellular level still remains to be elucidated
" j o! y+ R. t( e/ z/ w% I# F& W. J
0 {+ X, J# J$ i' P8 gTaken together, in this study we report the cloning of a 40-kDa zinc transporter protein purified from renal cortex by enriching BBM. The nucleotide and amino acid sequences place it within the ZIP family (Zrt- and Irt-like proteins) of zinc transporters. The regulation of Slc39a10 mRNA expression was found to be zinc dependent. The functional data we report confirm that rZip10 can import zinc across the renal BBM. We found that the Slc39a10 gene is widely expressed in rat and human tissues. Further research is in progress on cloning of a homologous gene from human kidney and its expression under various pathophysiological states as well as the molecular characterization of the regulatory site of Zip10.3 _$ }; p6 e9 L
& h+ t$ W# x v, Z
GRANTS
2 H/ L" B" T% k3 u7 B, Y: M# r+ U, r3 ~7 i7 z
This work was supported by the Council of Scientific and Industrial Research (CSIR), New Delhi, India [no. 37 (1114)/02/EMR-II].
; z6 r* F3 I% k f: k/ p- \' `% p. |4 Q+ x# U& a2 w
ACKNOWLEDGMENTS
4 y, `3 I0 f( v( @9 l: v; \
* Z" q8 S* x6 u h2 G' q: sWe thank Prof. R. K Ratho (Dept. of Virology, PGIMER, Chandigarh, India) for providing the use of an immunofluorescence microscope for localization studies.
8 O F( e ] F- v3 z' P: U% m 【参考文献】
; w2 ]! M V& K& o5 L1 R g Bergmeyer HU. MVC. In: Methods of Enzymatic Analysis. New York: Academic, 1963, p. 783-785.* ]2 O7 F5 {4 L. `& ]7 r4 y
7 [9 B- P0 X+ m4 L8 O* ]9 _5 M. {
' x" V# E2 x9 s" l2 k
' M8 t8 v: L; m& EBradford MM. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein dye binding. Anal Biochem 72: 248-254, 1976.
& x0 U0 W5 \( v7 U3 B r, ]7 L+ D% y4 o" v
3 k; v) S- X0 }2 ~
7 U: R4 t ?, s" }* ]+ c: }
Canonne-Hergaux F, Gruenheid S, Ponka P, Gros P. Cellular and subcellular localization of Nramp2 iron transporter in the intestinal brush border membrane and regulation by dietary iron. Blood 93: 4406-4417, 1999.7 O2 T2 l2 `8 _1 f
+ z3 C- A( Z2 g2 l v, {4 P' _/ C9 A2 W2 ~, |
4 p9 R8 E2 U* p% M% A A- w
Cao J, Bobo JA, Liuzzi JP, Cousins RJ. Effects of intracellular zinc depletion on metallothionein and ZIP2 transporter expression and apoptosis. J Leukoc Biol 70: 559-566, 2001.
( u' k5 M' @8 M, S8 {3 l
5 s; M+ D& I) l( D3 ], ~+ A9 S7 ^
6 ]( a$ H( j' i0 K* m4 f `
Costello LC, Liu Y, Zou J, Franklin RB. Evidence for a zinc transporter in human prostrate cancer cells which is regulated by prolactin and testosterone. J Biol Chem 274: 17499-17504, 1999.
c. X; \9 a! f, n
7 I$ \9 A5 _; k/ J9 ]7 |- M
% A! U) Y9 E' J" I5 @. B) ]5 _3 o9 v( e
Dahlqvist A. Method for the assay of intestinal disaccharidases. Anal Biochem 7: 18-25, 1964.
7 K- S" o7 H' D' c' I; ]! x$ q4 D+ m: c1 o4 ~2 j2 U9 ^: A0 [, x
, U, C% n) u/ u# t" S A
& X& h0 A5 B, `$ e: N5 _$ nDalton TP, He L, Wang B, Miller ML, Jin L, Stringer KF, Chang X, Baxter CS, Nebert DW. Identification of mouse SLC39A8 as the transporter responsible for cadmium-induced toxicity in the testis. Proc Natl Acad Sci USA 102: 3401-3416, 2005.
( F9 Z1 k4 y, k3 z
& k5 H) _5 J+ T5 i0 s O" L9 \0 V- c9 p- L
; {3 e7 t* s/ Y: K9 {9 [
Dufner-Beattie J, Wang F, Kuo YM, Gitschier J, Eide D, Andrews GK. The acrodermatitis enteropathica gene ZIP4 encodes a tissue-specific, zinc regulated zinc transporter in mice. J Biol Chem 278: 33474-33481, 2003.
& H. V% ^ {2 d, c" w: D' J- ~+ r7 ?( Y, l8 o4 t$ i+ X% n; k
3 V2 Y/ l" x) |3 l- R: o: F8 E+ j, ^6 L: o3 C- b% T
Eide D, Broderius M, Fett J, Guerinot ML. A novel iron-regulated metal transporter from plants identified by functional expression in yeast. Proc Natl Acad Sci USA 93: 5624-5628, 1996.& i* C9 s2 h t$ D9 U+ r( S8 m
4 s# D! R- Q# V% `
6 T0 U7 f, V1 D% ~
/ ^! f2 O: m) y1 ^# ]9 b$ {& \' l
Foulkes EC. Interaction between metals in rat jejunum: Implications of the nature of cadmium uptake. Toxicology 37: 117-125, 1985., Y( x8 l8 D7 |* n5 P; s( ?
- ~% D+ @2 `2 w, z- F: i! }0 x/ L# }! x' Y1 C/ @
9 d+ ?" O' m4 Q: N; I: G
Gaither LA, Eide DJ. Functional expression of the human hZIP2 zinc transporter. J Biol Chem 275: 5560-5564, 2000.
8 }5 h* u7 T5 S$ m1 c. s7 N3 S8 _5 m& F/ Y* d
2 a0 ~8 U+ M* z( C
' ?& `" S0 x4 I u9 |Gaither LA, Eide DJ. The human ZIP1 transporter mediates zinc uptake in human K562 erythroleukemia cells. J Biol Chem 276: 22258-22264, 2001.
% O& W2 E- D; [8 G* s& v7 ?/ n1 u4 l& d9 F$ d" p
& F2 j- y. h9 U1 ]$ R% P' O9 g
4 X; T) l* l* pGitan RS, Eide DJ. Zinc-regulated ubiquitin conjugation signals endocytosis of the yeast ZRT1 zinc transporter. Biochem J 346: 329-336, 2000.
+ Y$ A( Q' m' c& H; l
3 g2 l7 l' n& g( q& w7 ^+ ]6 Q) o+ l
0 i) P7 v2 W: B& g E# T
Gitan RS, Luo H, Rodgers J, Broderius M, Eide D. Zinc-induced inactivation of yeast ZRT1 zinc transporter occurs through endocytosis and vacuolar degradation. J Biol Chem 273: 28617-28624, 1998.
/ r$ Z! Y6 I* V, f- o" f& Q- ~" y! u2 W* O
+ R' T& V/ S+ ^. i$ l. G& u8 {: [) {: A
Guerinot ML. The ZIP family of metal transporters. Biochem Biophys Acta 1465:190-198, 2000." T+ Q+ z5 @$ w8 Q( K S7 r
U- I# |; I. j: |% S/ _4 @# Z
/ l/ e' I& i d) Z0 i
- C: z- |2 {5 Z: r
Gunshin H, MackenzieB, Berger UV, Gunshin Y, Romero MF, Boron WF, Nussberger S, Gollon JL, Hediger MA. Cloning and characterization of a mammalian proton- coupled metal-ion transporter. Nature 388:482-488, 1997.
& g) R9 X, U$ S5 y6 l7 W
( T& r# o* y( A9 C7 d* T8 ?! y' v2 w. R0 e* f% L/ j
o( w7 m; F0 [3 c$ h/ H6 x$ h7 Q
Huang L, Kirschke CP, Zhang Y, Yu YY. The ZIP7 gene ( Slc39a7 ) encodes a zinc transporter involved in zinc homeostasis of the Golgi apparatus. J Biol Chem 280: 15456-15463.
! R4 ~ v8 m( K' ]3 Z
' F6 p! K- i5 d: v+ F; a. V. Y4 e, X: R, Z; O, V
& S& z+ R4 k4 Z
Järup L. Hazards of heavy metal contamination. Br Med Bull 68: 167-182, 2003./ K: h/ x: G* u! E6 o9 ?% B
& O; o7 H9 o* j4 F4 l
7 w! t5 o8 ^- J: k% `
7 O9 N9 Q& c+ ]" {# v* s; L
Kambe T, Yamaguchi-Iwai Y, Sasaki R, Nagao M. Overview of mammalian zinc transporters. Cell Mol Life Sci 61: 49-68, 2004.9 w, X0 W- r1 I
7 m7 M- |4 n2 K0 ?* D$ F1 q) L6 x
4 `" y1 {5 L% r. `5 c0 v0 T$ T
2 q! A @2 M6 T( k5 t2 ~3 oKelleher SL, Lonnerdal B. Zip3 plays a major role in zinc uptake into mammary epithelial cells and is regulated by prolactin. Am J Physiol Cell Physiol 288: C1042-C1047, 2005.3 X4 q. w( ~1 Y" C7 T+ e1 g
% e! s. k# H; w! l( Y: x
% u) u. N' _' I* O& `( Z
+ {! W6 l- O; ]! w! d0 xKimball S, Chen S, Risica R, Jefferson L, Leure-duPree A. Effects of zinc deficiency on protein synthesis and expression of specific mRNAs in rat liver. Metabolism 44: 126-133, 1995.
0 \/ `5 y8 X+ ]" I
" h" }" q$ ^. Q" O! V' I9 T. ?6 k! z+ y6 v" e( Q
. w% o1 k' c/ I% n2 IKraus JP, Rosenberg LE. Purification of low abundance messenger RNAs from rat liver by polysome immunoadsorption. Proc Natl Acad Sci USA 79: 4015-4019, 1982.
- G! G) s) Y( I6 w" Z" g
/ C+ s* U4 I/ {6 ?+ ?- N: _+ Q4 U% M7 h
- Z3 X# g4 [2 A& [, R- j/ W1 E @- ]3 K6 W
Krebs NF. Overview of zinc absorption and excretion in the human gastrointestinal tract. J Nutr 130: 1374S-1377S, 2000.( J N. o. E8 o8 X' { F+ O6 C
% j% z" S; p+ [: H
4 s. |1 ~4 i8 F: T7 C% `' T" w; P- }7 X9 w
Kumar R, Prasad R. Purification and characterization of a major zinc binding protein from renal brush border membrane of rat. Biochim Biophys Acta 1419: 23-32, 1999.
* V( d$ U$ U% r7 {, F% L: K& O4 F- s$ U( {& K
$ q" P9 @! ?& b
4 Z' n5 I3 W- `- {0 C/ WKumar R, Prasad R. Functional characterization of purified zinc transporter from renal brush border membrane of rat. Biochim Biophys Acta 1509: 429-439, 2000. P7 b1 t# X1 S H+ {* _/ y: d0 o
" ^ b' S6 m& b7 I7 X- K8 [& |0 I1 N8 H* {+ m7 }+ J
( S! P9 C) R' ^# c2 E* y) eLee R, Woo W, Wu B, Kummer A, Duminy H, Xu Z. Zinc accumulation in N -methyl- N -nitrosourea-induced rat mammary tumors is accompanied by an altered expression of ZnT-1 and metallothionein. Exp Biol Med 228: 689-696, 2003.2 l, r( t8 N4 _: a7 Q6 n. l9 l
9 \" ]( n8 G) s4 f" r6 h
" u) s- n1 B, ?0 y3 S, w8 G" I- H3 K9 _4 w6 z w
Liuzzi JP, Cousins RJ. Mammalian zinc transporters. Annu Rev Nutr 24: 151-172, 2004.# s4 x& a% ^8 R1 Q. R
" k2 |8 q' Y7 H& R8 ?
/ T" F7 T$ ]2 \) S4 E- _
" K) c6 B& l, V; X+ H$ e( r- DLoghman-Adham M, Motock GT, Wilson P, Levi M. Characterization of Na -phosphate cotransporters in renal cortical endosomes. Am J Physiol Renal Fluid Electrolyte Physiol 269: F93-F102, 1995.& `8 g3 `# D- G/ k- o, t
! |) f6 }1 R K7 e. p0 j& P; S
0 O/ J& a$ R1 c0 ^/ _. [! X" Y
2 X- v9 H3 Y1 r5 j- XLoghman-Adham M. Characterization of essential sulfhydryl groups of rat renal Na -P i cotransporter. Am J Physiol Renal Fluid Electrolyte Physiol 260: F874-F882, 1991.
$ Z& j5 @: S. Z2 Q. F4 ~) i7 P l& Y' Z! ]2 k# A* c* b7 f
# O0 k( G+ ]7 M- i. Q
0 G# z; H+ q+ r. s& TMackenzie B, Ujwal ML, Chang MH, Romero MF, Hediger MA. Divalent metal-ion transporter DMT1 mediates both H coupled Fe 2 transport and uncoupled fluxes. Pflügers Arch 451: 544-558, 2006.' Z6 C4 M% P2 ?. u8 S
* D) p+ O8 v% i( N3 Q& L
! i- G( \6 D( b6 n2 ]% O
. Y7 M6 Q$ J% ^$ U2 F" TMoynahan EJ. Acrodermatitis enteropathica: a lethal inherited human zinc-deficiency disorder. Lancet 2: 399-400, 1974.( M% v; h, Q, K6 S* R3 _( h5 n6 u( d
0 H" Y' D" i0 h7 w! j
* W6 `: b9 i2 f& a$ o
" q* N7 P/ ]/ {! ]
Nath R, Prasad R, Paliwal VK, Chopra RK. Molecular basis of cadmium toxicity. Progr Food Nutr Sci 8: 109-163, 1984.
! B6 ?" N2 V) y$ y" n5 y% g9 n! K5 D' q; _
& h) s3 n! o, s: ?3 `; N) O& T$ g3 Q' p
Prasad AS, Schoomaker EB, Ortega J, Brewer GJ, Oberleas D, Oelshlegel FJ. Zinc deficiency in sickle cell disease. Clin Chem 21: 582-587, 1975.
+ ~* C! U3 d3 V& R/ R
' B3 P% g# z G5 [( X, K- u7 k1 T) F. Q! @5 e' R6 _+ |# P
& J% w) H2 b9 C; \) ?9 Z6 j' e2 bPrasad R, Nath R. Cadmium induced nephrotoxicity in rhesus monkeys ( Macaca mulatta ) in relation to protein calorie malnutrition. Toxicol 100: 89-100, 1995.! e7 q) {: p$ H {5 u. J4 f( R
/ j M q G- K. W" l
n. \! R; R! a0 |/ \% V
. w( z# A* H8 C; [8 }Prasad R, Nath R. Zinc transport in monkey renal brush border membrane vesicles and its interaction with cadmium: a kinetic study. J Trace Elem Exp Med 6: 95-107, 1993." S- Q3 k( U" J0 ]
6 @2 c! H7 Q* R1 H4 G0 r5 O- n# \0 T7 b4 S* A+ F6 @& W
/ |4 }6 T# G/ I r! d/ v7 e9 x) B
Prasad R, Kaur D, Kumar V. Kinetic characterization of zinc binding to brush border membranes from rat kidney cortex: interaction with cadmium. Biochim Biophys Acta 1284: 69-78, 1996.
# t$ B8 q) c" Z1 T' B c
m% P5 }$ S# G! K9 d% t; R
8 M" s; R" I, U2 C2 ?% j. q% c9 \% a0 Y: H% q) L
Prasad R. Purification, physico-chemical characterization and reconstitution of the zinc transporter from renal brush border membrane. In: Methods in Molecular Biology: Membrane Protein Protocols, edited by Selinsky BS. Clifton, NJ: Humana, 2003, vol. 228, p. 195-221.2 a4 f' a# {1 o
1 A$ I$ D! K+ H
8 x8 d _5 M3 r/ N9 ?! |. k! m& P# F$ I. Y' W2 n
Quigley JP, Gotterer GS. Distribution of Na /K stimulated ATPase activity in rat intestinal mucosa. Biochim Biophys Acta 173: 456-468, 1969.
q# ^' Y% O4 q. X2 Q' @' Y6 R
6 i9 j# @7 T0 S: R$ {# c
( C9 Z2 X0 h+ P- S" {2 ?) q9 t: j) o; i9 i
Sacher A, Cohen A, Nelson N. Properties of mammalian and yeast metal- ion transporter DCT1 and Smflp expressed in Xenopus laevis oocytes. J Exp Biol 204: 1053-1061, 2001.
) ?1 l5 U2 Q' L r
! a+ W. w4 P S. T7 q: i$ a8 {$ W9 e6 r4 t
7 b- ]: r) ^0 ~) r* M
Sambrook J, Russell DW. Molecular Cloning: A Laboratory Manual (3rd ed.). Cold Spring Harbor, NY: Cold Spring Harbor Laboratory, 2001.
: N% t5 l6 Z0 H I! K( p" Y* n. q0 }- x+ ?% z9 b( z
7 W1 z* D: P$ W5 k9 K' H. P
$ M" ^, N7 l* M5 Z; ~$ g0 X: gSandstead HH, Rinaldi RA. Impairment of deoxyribonucleic acid synthesis by dietary zinc deficiency in the rat. J Cell Physiol 73: 81-83, 1969.* `8 x% I" |$ [: [9 ]9 K
) e1 o/ V1 V- G, B) j. p9 ?
/ s' B2 M; m* t& Q7 e6 R5 S, n& _) d8 ]- E, a8 _3 w
Singh RP, Kumar S, Nada R, Prasad R. Evaluation of copper toxicity in isolated human peripheral blood mononuclear cells and its attenuation by zinc: ex vivo. Mol Cell Biochem 282: 13-31, 2006.3 F# W& z- B# i9 k
1 w9 M3 z- t& w4 z1 T% H& b, S- B; x+ Z7 X5 z7 M, }- x& U6 u
+ S3 V* g7 D* G) C
Swiergosz-Kowalewska R. Cadmium distribution and toxicity in tissues of small rodents. Microsc Res Tech 55: 208-222, 2001.& O2 d" n# `8 E" g; z7 n. @
% f! X4 D3 _2 A, Z( ]8 Y9 E! U& K. x) F$ c
9 Y' @0 m! d9 b' X+ f+ H- UTakebayashi S, Jimi S, Segawa M, Takaki A. Mitochondrial DNA deletion of proximal tubules is the result of itai-itai disease. Clin Exp Nephrol 7: 18-26, 2003.3 s+ _! g! F7 [: Y: G0 T1 {) R
8 S4 h* e' g; {7 {5 e
* i; y4 W3 N: `5 l- m1 A
3 {" {9 M1 F6 D" w: b% o8 `9 k) N
Talwar GP, Gupta SK. A Handbook of Practical and Clinical Immunology (2nd ed.). New Delhi: DBS, 1997, p. 68-140, 1997.% d6 ^( R$ p1 D; u
0 x7 }; @3 K N! D, }0 Q8 ~$ J* d3 |" z
& }' U& ?6 c6 N* [Tandy S, Williams M, Legget A, Lopez M, Dedes M, Ramesh B, Srai SK, Sharp P. Nramp2 expression is associated with pH-dependent iron uptake across the apical membrane of human intestinal Caco-2 cells. J Biol Chem 275: 1023-1029, 2000.
5 w1 M8 |- d1 b6 w' `
- [' K0 h: h5 d O( o; X+ ?2 {1 h) k# f; j
3 W% @5 W9 K; |5 h7 XTaylor KM, Nicholson RI. The LZT proteins; the LIV-1 subfamily of zinc transporters. Biochim Biophys Acta 1611: 16-30, 2003.# P1 I2 R6 x6 E
& V" c% y9 i% i3 s( ?% a+ _
( X7 A4 \; k3 c( Y- w& w6 I. X q) }* a# H; j/ W
Terhune MW, Sandstead HH. Decreased RNA polymerase activity in mammalian zinc deficiency. Science 177: 68-69, 1972.
- k8 z* L* Y/ Q0 D! K# W+ n. ?5 c5 ]
* j/ b4 n( C/ M: t4 Q' ~' j$ t. P4 g$ P: Q. Z8 ]
Wang F, Kim BE, Petris MJ, Eide DJ. The mammalian Zip5 protein is a zinc transporter that localizes to the basolateral surface of polarized cells. J Biol Chem 279: 51433-51441, 2004.
) b1 l# ^# Y4 `8 F" u; W) v! q# X0 }6 ~ u$ U
' B' V- u0 b2 F7 s& b) H! {( V% H: l7 l6 r
Yamaji S, Tennant J, Tandy S, Williams M, Srai S, Sharp P. Zinc regulates the function and expression of the iron transporters DMT1 and IREG1 in human Caco-2 cells. FEBS Lett 507: 137-141, 2001.7 |9 k# a* y! X. X2 j% C. I5 N& \
) C) J8 ]" O6 K5 i+ e1 L
J( p" y7 M/ S; w+ u. i6 s$ T1 P5 C" L
Zhao H, Eide D. The yeast ZRT1 gene encodes the zinc transporter of a high affinity uptake system induced by zinc limitation. Proc Natl Acad Sci USA 93: 2454-2458, 1996., e+ O" J0 W2 |" h& z$ K3 k* x5 b
7 R4 g% Z! ?+ L
# L$ P0 c6 h f3 N' k* q( g9 s n" `/ m, u
Zhao H, Eide D. The ZRT2 gene encodes the low affinity zinc transporter in Saccharomyces cerevisiae. J Biol Chem 271: 23203-23210, 1996.2 D! U* T' B/ I; t$ e7 M6 O7 {8 _ j2 p
* v0 K) f4 G0 G5 B+ {5 Y2 K
i& ^' K; W6 D6 ~! \" i4 P0 g
2 {) S5 y" P8 E' k/ ]0 j+ N
Zhao H, Butler E, Rodgers J, Spizzo T, Duesterhoeft S, Eide D. Regulation of zinc homeostasis in yeast by binding of the ZAP1 transcriptional activator to zinc-responsive promoter elements. J Biol Chem 273: 28713-28720, 1998. |
|