|
  
- 积分
- 731
- 威望
- 731
- 包包
- 1397
|
Isolation of a cellular factor that can reactivate latent- K( V: |- h( U
HIV-1 without T cell activation
: z5 }7 K# A+ i3 T7 {/ k- \Hung-Chih Yanga, Lin Shena, Robert F. Silicianoa,b, and Joel L. Pomerantzc,d,1
7 j+ F! o( m; S, W9 FDepartments of aMedicine and cBiological Chemistry, dInstitute for Cell Engineering, and bHoward Hughes Medical Institute, Johns Hopkins University0 O5 Y' G0 o: a( t: o
School of Medicine, Baltimore, MD 21205) T" \7 n0 p* ~" L4 @, ^+ n
Edited by Diane E. Griffin, Johns Hopkins Bloomberg School of Public Health, Baltimore, MD, and approved February 6, 2009 (received for review K5 J0 L9 y: M6 t1 X `3 h
September 23, 2008)
4 B5 w& i5 }8 R/ a9 NHIV-1 latency in resting CD4 T cells represents a major barrier to4 X9 F! ^( o$ L( F
virus eradication in patients on highly active antiretroviral therapy* |, A4 d$ L# {# X! o
(HAART). Eliminating the latent HIV-1 reservoir may require the G' Q* }6 w3 l5 a& j
reactivation of viral gene expression in latently infected cells. Most7 w! f* y* ~2 P% i* M/ F. ^6 |! [
approaches for reactivating latent HIV-1 require nonspecific T cell
. }3 P# D8 ^! _2 y7 j5 Y" Uactivation, which has potential toxicity. To identify factors for* e" c2 [$ P* ?4 |1 J3 T& A
reactivating latent HIV-1 without inducing global T cell activation," y+ ]/ ?5 p& r) {9 q& ?; N5 _$ e b
we performed a previously undescribed unbiased screen for genes+ ?9 C A7 J0 y5 V! i
that could activate transcription from the HIV-1 LTR in an NF-Bindependent
9 `, A, @$ q2 L6 [manner, and isolated an alternatively spliced form of/ l+ b% A, `0 D( c Q, [/ ]
the transcription factor Ets-1, VII-Ets-1. VII-Ets-1 activated HIV-1; c$ J7 H2 Y6 x( ?, Q- B( t: p
transcription through 2 conserved regions in the LTR, and reactivated6 Y0 `/ L5 V: F9 k* M
latent HIV-1 in cells from patients on HAART without causing: ?; y) Z( L0 s1 z6 t- h
significant T cell activation. Our results highlight the therapeutic
2 c7 `( o! {: h' upotential of cellular factors for the reactivation of latent HIV-1 and3 |! D: J3 K5 ]6 M5 Q) j& B
provide an efficient approach for their identification.
1 z% k# j9 N; q# F1 n- |# N3 Aantiretroviral therapy VII-Ets-1 expression cloning
" R; m/ ~2 ~) T; Q0 Glong terminal repeat viral reservoir+ R- d% ?" W% \, i/ {7 [- q
Advances in antiretroviral therapy have dramatically reduced
# N+ K6 p% \( C( R. @+ emortality among patients with HIV-1 infection (1). However,
% S+ s5 s% V4 u# c2 C6 @# T6 Gthere is still no therapeutic regimen to cure chronic HIV-1
% G; `3 K8 `8 m, s! Vinfection. Although highly active antiretroviral therapy
* O& P6 e- j% `(HAART) can suppress plasma viral load to undetectable levels,0 S5 S' m5 i+ w) K+ B% O, q
viremia rebounds within weeks after discontinuation of0 ^: Y- P- {3 g' i4 ^% F
HAART. The major barrier to eradication of HIV-1 infection is
2 S& F% \7 q: R3 kthe existence of viral reservoirs. Among them, the best characterized6 i4 z" V1 l) m0 j" P$ G
is a small pool of latently-infected resting memory CD45 E# D. N$ X* [! r2 R
T cells harboring an integrated provirus (2–4). Previous studies' [4 I1 C; ?; a
have demonstrated the stability of this latent reservoir in patients
# b: X' A# E" L5 Gon HAART (5). The half-life of this reservoir was estimated to' p; C6 Q4 O; N t! P7 _
be 44 months. At this rate of decay, it is expected to take 60
$ g/ I# ~* Y5 J3 i6 oyears to purge HIV-1 from infected patients on HAART. Thus,. D- m! J" L4 m! n- @) b% \
this reservoir necessitates the lifetime use of HAART, and; |5 {* b1 r) ^
strategies are needed for eradication of latently infected
. S3 F) c5 L+ y7 t7 T8 hcells (6, 7).+ N- o- M: `" s* p; i
Recently, reactivation of latent virus has gained wide interest
) S( I1 G+ ` J. q( ?' S5 sas a potential strategy to eradicate the viral reservoirs (8–11). It
2 s9 q* V7 Y3 x! sis assumed that latently infected cells can be killed either by- P8 b0 F* N B5 s* \' P: l
immune attack or direct viral cytopathic effects after reactivation
7 B% X" ^+ r6 r. J. \of latent HIV-1. A reactivation strategy, along with simultaneous' \- W$ e. k+ W" X4 o# E2 m7 d
efficient suppression of viral spread by HAART, might
, k# p8 n! q" g m. g) qreduce and ultimately eliminate the latent reservoirs (6, 7).
$ Z' C) m) R4 R* u/ aAlthough logical, this approach has practical limitations. Because
7 o P% d' I2 a* c. p1 Osignals that cause T cell activation also activate HIV-1
5 e4 l0 D0 ]# \& }5 i3 \4 |replication, some studies have focused on strategies to induce
7 u7 l5 O2 m2 ?# F' s. P. F5 v! c, L5 ksome level of T cell activation as a means of reactivating latent# r& b6 |1 ^& D7 r. P
HIV-1 (10, 11). Unfortunately, the potential toxicity of such" z1 X, d6 G" T) t7 M/ ^+ \1 R
nonspecific T cell activation has severely complicated this approach" Y5 N8 T6 }, j, @( f* P3 J
(10, 11). For example, patients treated with agonistic
6 ]9 S. B2 t) G' ]& y- wanti-CD3 monoclonal antibody and IL-2 suffered from severe
1 C: x6 i/ ^$ y. `$ k# vside effects, transient renal failure, and seizure. An ideal reactivation
$ D* s m) J, ^$ l% }strategy for virus eradication might allow activation of1 [ Z3 C* n1 A
HIV-1 without inducing global T cell activation.
* I2 j* y s6 dThe HIV-1 provirus responds to various extracellular stimuli,
2 {+ i3 \0 W0 dincluding T cell activation signals and some proinflammatory, `, \; {7 V1 B5 ]9 t+ }% v
cytokines (12–14). The HIV-1 promoter, located within the U3
2 d3 m& X( n/ [& m# Y0 X+ kregion of the LTR, contains an array of cis-acting transcription9 \+ j- k% G! W, K; F
factor binding sites (15). The interaction between these diverse
* X! K% z. r% u S! r% G i. qsignals and the various binding sites in the LTR forms a complex) l+ {3 _( ]/ z' f/ I% Q
regulatory network. In particular, the host transcription factor
# @5 V0 N& `7 h: jNF-B is important for activating HIV-1 gene expression
( Y9 T. ]% q0 l- x' I/ l; pthrough 2 conserved B sites in the core enhancer region of the. l* l E, N& ^. L+ V s
HIV-1 LTR (12, 13). However, HIV-1 can replicate in the& {' f+ u/ |% M* F
absence of B sites in the LTR (16), consistent with the existence2 {4 v2 m4 ~. G
of NF-B-independent pathways in the activation of HIV-1 (17,
; q( j; Y/ G: K* ?5 j+ T* ^( m18). NF-B also has a critical role in innate and adaptive immune# b! A/ S9 n& l/ K7 X* Y6 i# q
responses, and regulates genes that have important roles during' E& y1 d& C& v# q8 K3 {. I
T cell activation (19). Because of the central role of NF-B in T* Y# c6 X) t2 }! t
cell activation, we reasoned that to find genes that could& Z7 i+ t+ |* a6 R
uncouple the activation of latent HIV-1 from T cell activation it- ?. n J3 b. \" W' G
would be desirable to identify factors that could activate the
3 }: G1 A, W0 ~. G5 z* vHIV-1 LTR in an NF-B-independent manner.# b' h4 \ Z! v+ j8 O' N
To systematically search for NF-B-independent pathways for" h) Z, U* u/ T( T, d4 \& j
the activation of HIV-1, we performed an expression cloning; Z! _- h1 y( b, f
screen using a reporter containing mutated NF-B sites in the5 I, @* \3 j" C) w( G$ c' h
enhancer region of the HIV-1 LTR. By screening a human' S; J& B0 C3 \( X3 T
splenocyte cDNA expression library, we isolated an alternatively! F- X8 i" M7 ?+ m. }
spliced form of the Ets-1 transcription factor, VII-Ets-1. VIIEts-! P+ _4 E: n, j; s4 z4 U
1 was able to activate the NF-B site-mutated HIV-1 LTR* Q+ y3 a& D: Z0 Z- Y: a, W
without stimulating T cell activation and could activate latent
% x2 B+ {/ ^- l( W8 |HIV-1 from resting CD4 T cells isolated from patients on# u' }- U; |' r4 _9 h9 P y9 p" q) L
HAART. Our results identify a cellular factor that can reactivate8 a- C. l* Q. O7 F3 G
latent HIV-1 without inducing T cell activation, and illustrate the
% |! j" Q4 `4 e$ B0 O& rpotential of this expression cloning strategy to yield novel
9 y# [5 v8 b8 f( k! Rapproaches for eradicating latent reservoirs of HIV-1.: x8 G/ Q) i# k; v
Results# T X% Q& x+ f
Expression Cloning Screen to Identify NF-B-Independent Pathways9 v' V# c/ K8 {& G
for the Reactivation of Latent HIV-1. To facilitate the identification; V7 @3 d% G2 u) C9 g
of NF-B-independent pathways that could activate the HIV-1' }. i9 R/ P2 h% P$ k, o* \+ `+ p
LTR, we generated a luciferase reporter, mB-LTR-Luc, which! F9 ^' Y4 y9 j. @/ u) M
contains the HIV-1 LTR from reference strain NL4-3 with9 A2 @) g6 g& {/ U3 ]5 ?% ^2 y
mutated B sites within the core enhancer region (106 to 83)
* z z6 N3 }. W. n2 c3 U" `(Fig. 1A) that have been shown to abolish the activity of NF-B) t- z% s8 h* G! c Q
on the HIV-1 LTR (13). We then screened a human splenocyte
: K/ z% D- y: e) ~, H5 jcDNA expression library for the ability to stimulate the mBLTR-
( F% y8 p9 u9 B. o; mLuc reporter. To maximize the number of the cDNAs that1 O; y' O6 P2 B
could be assayed, we generated cDNA pools with 100 cDNAs
, F) H/ r* r- S) o. t6 C$ YAuthor contributions: H.-C.Y., R.F.S., and J.L.P. designed research; H.-C.Y. and L.S. performed0 {( c8 K) l3 R8 H
research; H.-C.Y., R.F.S., and J.L.P. analyzed data; and H.-C.Y., R.F.S., and J.L.P. wrote
9 q2 y& N5 C P0 _. p: u7 Z/ rthe paper.% e$ D1 t: j# w! r+ p8 E! w" R: Q
The authors declare no conflict of interest.+ E8 g; D( G% c: L1 [# @7 n; ]
This article is a PNAS Direct Submission.
n: M4 n8 R' r; L5 Q; ?Freely available online through the PNAS open access option./ ~) {* P: t/ O( x Y
1To whom correspondence should be addressed. E-mail: joel.pomerantz@jhmi.edu.3 l5 K3 u1 u* W
This article contains supporting information online at www.pnas.org/cgi/content/full/
0 Q7 h: ?: c, x0 l; x1 b$ ^0809536106/DCSupplemental.$ N% _4 [( `$ e$ Q( A# c+ b
www.pnas.orgcgidoi10.1073pnas.0809536106 PNAS Early Edition 1 of 6
$ D# r, _7 m, \MICROBIOLOGY' U: F0 A: z( ?' b) v9 w
per pool (20). Each pool was transfected into HEK293T cells
. l I1 N! Y7 v% n8 r3 ewith the mB-LTR-Luc reporter and pCSK-lacZ, an NF-Bindependent5 a8 F6 I. c: A- C: @
-galactosidase expression vector used for normalizing
* @! T. V6 {/ G Ntransfection efficiency and extract recovery. A pool was
4 f9 v* O1 J+ F" O# n$ ~considered positive if it activated the mB-LTR-Luc reporter by
+ H0 s$ c) ~$ I' j2 l2 o3-fold or more, as compared with an empty expression vector. In, F9 i7 J+ Z" T" H- j
all, 477 pools were screened (Fig. 1B), and 7 positive pools were3 N6 X6 G7 N% a6 X: {
identified.! B: }2 S7 B1 `5 \3 \ M
To verify that each positive pool activated the HIV-1 LTR in
& b8 m7 r' x5 T2 M# n' han NF-B-independent manner, we tested each pool for its
+ V A- v% L, z: j. K+ z- Wability to activate the NF-B-responsive reporter Ig2-IFN-GL4,
4 p# V. S* S8 J @# |- Lwhich contains 2 NF-B sites upstream of the IFN- minimal
" D1 g o- k2 e) o3 {. Vpromoter and the luciferase gene (20). Four of the seven positive( D; i, B2 P- p7 Q4 K% ~
pools did not activate the Ig2-IFN-GL4 reporter. For example,7 Q0 C% f5 C; \. _7 ?; `
although pool 50 activated the mB-LTR-Luc reporter by 3.4-( }, V9 b# a% w$ g+ u+ }. O; {% C; _
fold, pool 50 did not activate the Ig2-IFN-GL4 reporter at all Q0 [8 ^: K- j& L
(Fig. 1C). We purified the activity of 1 pool (pool 50) for further/ ?$ S9 R- ^2 B9 L
study.
+ D& j$ [' d) E# OIsolation of Human VII-Ets-1 from a Human Splenocyte cDNA Library.7 O+ }# q# F6 K- O
To identify the cDNA responsible for the activity of pool 50,) ~$ N0 r. f( L( J4 B$ K
DNA from pool 50 was used to retransform bacteria, and6 I: N5 Y$ ^2 U1 {# |; s2 l
individual colonies were amplified in wells of 24-well plates.
! }6 s8 k; M5 x/ dEach 24-well plate was screened as a subpool after preparing" J$ `6 c# l* p3 x+ z- X* D
DNA from pooled aliquots from each well. Once a 24-well plate, H# z! k( _3 ]3 m* p- p( k! [+ R7 y
was found to exhibit the activity present in the original pool 50,3 R4 m+ T+ D# @* o t9 ^* {
a conceptual matrix (4 row 6 column) was used to identify* B1 e( g& p# o: R
the coordinates of the positive clone within the 24-well plate
- p0 H3 X- g) K$ o: C2 w i' k2 J(Fig. 1D). Sequencing revealed that this clone was a previously" v9 T! c2 P) O% n8 h: o
described spliced variant of the transcription factor Ets-1,
4 @* ?; \- r) P9 X1 p3 }9 k% ~VII-Ets-1.
! O) q) o/ ^" N5 s, wEts-1 is a member of Ets family of transcription factors that' P s5 E# T% r
share an 85-aa conservedDNAbinding domain, the ETS domain
7 G" b: ]1 x, e) i/ X7 Q6 R(21, 22). Ets-1 is highly expressed in T cells, and has an essential* z8 @: r6 [" T9 w; _/ {+ s
role in their proliferation and survival (23). Two isoforms of/ ]# ?9 A; u+ R5 t
Ets-1, full-length (fl)-Ets-1 and VII-Ets-1, which lacks the
5 X. }' F( W( O! d" nregion encoded by exon VII, can be detected in T cells; however,
" k; P1 q+ f7 K% V* `! ~fl-Ets-1 is expressed at a much higher level (21, 22). The: X8 h- H& \. V8 l; B5 h
functional domains of Ets-1 are shown in Fig. 1E. Previous
& ?, v3 i* q" u; Q1 { q ostudies have revealed that exon VII encodes an autoinhibitory
+ b" f0 x) v1 [domain that regulates the DNA binding activity of Ets-1 (24).5 Z0 ~, ?# ]* v$ V
The C-terminal portion of the exon VII-encoding region contains: K9 ^4 F$ {. F1 S/ }
helices that inhibit the DNA-binding domain in concert
' ]$ b& \$ ?$ a9 f! d4 lwith helices encoded C-terminal to the DNA-binding domain of
) B. ~. h; o& T1 D6 b. ]* D. DEts-1 (ETS). The N-terminal portion of the exon VII domain is2 @6 m( a6 I" O; q+ n: T
phosphorylated in a calcium-responsive manner, and phosphorylation
" d N J2 R5 j' Iin this region further inhibits DNA binding and transcriptional6 z$ V, v9 h) _$ y: P8 u
activation (25). Because VII-Ets-1 lacks the exon
- C! M/ @ S- Z0 G" V4 Z4 FVII-encoded region, its DNA-binding affinity is significantly- K- p* L7 K$ D4 ~- m
enhanced. The role of fl-Ets-1 on HIV-1 gene expression has H# w. r0 S) j' I9 I& \
been studied before (26, 27). Full-length Ets-1 binds upstream to; p# t8 K: [. d+ ` a3 s
the core enhancer of HIV-1 LTR, and stimulates viral gene
5 Y; S7 v! k+ r8 q! A" |3 Kexpression by interacting with other transcription factors, such as
6 B0 M" r% V: t( X7 bNF-B, NFAT, and USF-1. Because HIV-1 replication is closely
( c# z& b1 h/ O; A2 E8 p2 Olinked to the activation state of the T cell, we determined the( p w! g, T: Y0 P( Z Z! x
expression of fl-Ets-1 and VII-Ets-1 in resting and activated
# N2 v# m3 n7 A( XCD4 T cells. Both fl-Ets-1 and VII-Ets-1 were readily detectable+ i2 q. v7 b. ^2 s
in resting and activated CD4 T cells; however, the d- ]! F" \ _9 x+ H* H
expression of VII-Ets-1 was less than that of fl-Ets-1 (Fig. 1F).+ J3 q' ]0 V! P
Specific Activation of the HIV-1 LTR by VII-Ets-1. We verified that
. f0 I% e( J6 ]0 _9 i" R' B, W7 K- I. zVII-Ets-1 was responsible for the activity displayed by pool 50.- l' T M2 \/ K2 f6 U( j6 H
Overexpression of VII-Ets-1 in HEK293T cells activated the; z$ T# U( K1 g2 i4 f0 j% {* k7 Q
wild-type HIV-1 LTR (wt-LTR-Luc) and the LTR with mutated
; o1 w& l/ q, Q* R- d/ rNF-B sites (mB-LTR-Luc), but did not activate the NF-Bdependent* ~3 s% B' r1 v6 Q1 F
reporter (Ig2-IFN-GL4) (Fig. 2A). Thus, VII-Ets-1
( N) T8 Q G, E+ R& \$ J. e# _was able to specifically activate the HIV-1 LTR without activating1 b \; g I, T5 |
NF-B. Compared with its effect on mB-LTR-Luc,. v2 M; N) s! w4 K* \0 y
VII-Ets-1 showed a higher level of induction on wt-LTR-Luc,/ I" |2 R, Z+ I0 M+ T
suggesting that, although VII-Ets-1 did not require NF-B for, J- G& }+ s, x+ f
transcriptional activity, it does act cooperatively with NF-B in+ N. ^( X2 a8 I9 u: t
the context of the HIV-1 LTR. This finding is consistent with a, c- L- k: x1 @- `* w/ j
previous report demonstrating the cooperative activity between/ k1 p. \4 `' k9 s- _
Ets-1 and NF-B on the HIV-1 LTR (26). When directly
( V& l$ ~, G& cGGGACTTTCCGCTGGGGACTTTCC
+ f: v9 _3 x I, v-106 -83
5 b7 F4 Y' i7 o0 V' X0 |CTCACTTTCCGCTGCTCACTTTCC
4 g0 I9 ?6 ^# k0 {8 {4 D% F3 Z􀉅􀉅􀀨􀀨 􀉅􀉅􀀨􀀨; z4 q4 J7 k4 z2 p4 ?
R U5 GLS Luciferase% @$ v8 B" s& g e
-4552 Z0 K7 o% B7 |3 A
U33 h) m& l* Z# l( ]+ ] L
+1 +334
0 g( L+ e: R, l/ n% H0 V- _site directed mutagenesis
. T& M& t. w. y9 e: F _0
* z2 H( A$ j1 E8 o! U7 A22 I$ _. q7 f6 P8 Q9 R' H
4
% v$ ?7 _5 w- l) n6) r2 t- q' N) y+ O {! B, a
87 j% y( f! N7 d' z
10" |8 Y# G1 F; O+ _, T
12
9 S2 L v" C6 X, k7 G. D! x14
4 ? q$ Z% z$ N% DPool number
" p% m. T E u0 A/ r8 h8 ^0 v0% S, `# T9 ]) d2 t) d2 N
1. `4 C3 A* C6 @: f0 ~
2
# }; F# o1 o( J7 j& i# ~* s3) ^! I+ V7 R9 i5 q8 q
4
3 f# W- }3 D% b9 H7 T7 w7 s9 ]& H2 X􀉅􀀨; z6 z! v ]- d# Q. U9 n: g
3 X Sp1
! Z7 A- _& K) [( Q1 O8 XTATA/ B0 c5 t O) ~( A' W" U+ W5 r
Igκ2-, \. K6 R5 s8 K/ K% D
IFN-GL4) A+ L1 s. N4 z/ i9 u& Z* X+ G' P' k
R1 R2 R3 R4 C1 C2 C3 C4 C5 C6
; n4 W: R+ G4 V* N7 ~" `+ uFold Stimulation, }, ]' e! f1 l- l* ? p
Fold Stimulation# O; z5 |3 U- U) H. v
Fold Stimulation4 Z/ F+ s& n: a D
5
4 S! n" P- j8 k; c' G- P4; M6 @# D$ C: R$ d
3
. a; o! w8 D; P d27 }4 q3 z( W# R! \* [
1
* B3 y6 A# Z0 w4 M0
. C# F) M5 J" c5 ]! H* jSubpools( M: J: B3 d6 {( s8 e
Pointed TAD Exon VII ETS. a, B# Y0 P r) y
1 54 135 243 331 415 441
" K+ e" d6 Z: s: d% k/ TPointed TAD ETS% u! V/ i& D% \8 L
fl-Ets-1, g2 t5 J1 i4 m+ D* J, ^- Y4 S
1 54 135 243 244 328 354 N$ z3 l2 y: s7 J- c, ~4 }
β-actin
; x8 y% v; \4 {0 @/ ZVII-Ets-1
# V& C5 L- ?% ]" V IVII-Ets-1* Y4 N4 b. D- w! y$ U$ \* {3 ?
fl-Ets-1( h2 w' g+ o9 \. M
Resting Activated
& D4 P1 A G6 ~0 j# o1 50 100 150 mκBLTR-4 P+ J! U3 U- i' l
Luc* f. b) I5 A D, j6 Y% G/ \# u: J
A B C5 W* J: O& ^( i
D E F4 t% |/ U g1 {& ]3 Y
Fig. 1. Strategy for expression cloning and isolation of VII-Ets-1. (A) The structure of wt-LTR-Luc andmB-LTR-Luc reporters. The wt-LTR-Luc reporter contains- |2 Z2 D" l* t) Q& t; D" b- O
the 5 LTR and the untranscribed region of Gag (GLS) derived from NL4-3 upstream of the luciferase gene. Two tandem NF-B sites (2x B), 3 Sp1 sites (3x Sp1)$ ]& A; v1 s! V; ^
and the TATA box (TATA) in the U3 region are shown as boxes with indicated colors. The NF-B-binding sites were mutated as indicated. Numbering above the8 E/ K1 y9 n/ m0 G( x, j
boxed regions is relative to the transcription start site (1), based on the sequence of the reference strain HIVHXB2. (B) Example of primary screening. Pooled cDNAs
$ `0 L$ W9 Q9 x5 I2 [were transfected into HEK293T cells with the mB-LTR-Luc reporter and the pCSK-lacZ control vector, and the fold stimulation was determined as described in
2 p+ v6 n! [. V1 ZMaterials and Methods. Only 150 out of 477 pools screened are shown. (C) HEK293T cells were cotransfected with pool 50, Ig2-IFN-GL4 and pCSK-lacZ. The fold
. m& V* c p3 ~ c+ u; T" a1 Bstimulation of pool 50 is shown relative to reference control pcDNA3.1(). (D) Identification of the positive clone from pool 50 in a 4 row (R)6 column (C) matrix* H5 b" a5 k# b' g, p$ e7 ]
of subpools. The well in R 1 and C 5 contained the positive clone. (E) The functional domains of fl-Ets-1 and VII-Ets-1. The exon VII, originally designated in8 V: J) L8 O6 U3 e' K, h# y
alignment with chicken c-ets gene, is actually exon 6 in the human ETS1 gene (22). (F) Western blot of fl-Ets-1 and VII-Ets-1 in 10 g of lysates of primary resting. J i1 I' c e8 C# r1 K
CD4 T cells and CD4 T cells activated with 2.5g/mL anti-CD3 and 1g/mL anti-CD28 antibodies for 3 days. The indicated -actin levels serve as loading control9 Q: G- v- A+ e% k( c4 X) u9 M
for the T cell lysates.
) n4 E% v7 {) M( v( g2 of 6 www.pnas.orgcgidoi10.1073pnas.0809536106 Yang et al.
* D' `+ V" j5 e# Ncompared in this assay, VII-Ets-1 showed a greater ability than2 Y s* U1 [3 s" r' M& G. o
fl-Ets-1 to activate the mB-LTR-Luc reporter at comparable' e2 l# }" X$ Z" b0 Q8 M+ B' w
expression levels (Fig. 2B). To confirm that VII-Ets-1 could
- f2 y6 H( g/ Cactivate the HIV-1 LTR in T cells, we also assessed its ability to6 y" p& j" L. l" W* E: U. a
activate the mB-LTR-Luc in the Jurkat T cell line. Overexpression
G1 m( A* O6 I+ y; `, zof VII-Ets-1 in Jurkat T cells did induce the mBLTR-
2 y$ Z$ R7 E+ a1 b( x$ p* e. ULuc reporter, but to a lower degree than in HEK293T cells7 A3 i9 A* W- y* l3 N4 G
(Fig. 2C). As in HEK293T cells, VII-Ets-1 displayed more
+ c& n/ ]" _* W8 U1 q- Dactivity than fl-Ets-1 in Jurkat T cells (Fig. 2C). L. f/ ]; I7 Q, V
The DNA-Binding Domain of VII-Ets-1 Is Essential for Activation of
* p6 e, h3 q, q6 J6 w+ YHIV-1 LTR. VII-Ets-1 contains an N-terminal transactivation' @3 A+ }+ x. Y8 [
domain and C-terminal DNA-binding domain (Fig. 3A). To% k" I' g9 r1 F" g
investigate the functional domains that are responsible for the
9 K( y- p( J1 \8 Hactivation of mB-LTR-Luc, we generated 3 FLAG-tagged: p' \) x2 j" ^9 L. g4 ^/ w1 Z! I
mutants: TAD-VII-Ets-1 (transactivation domain of VII-Ets-) ^& o$ A1 S3 ~& E2 `& f
1), DBD-VII-Ets-1 (DNA-binding domain of VII-Ets-1), and: h% ]$ v- J8 ?6 R- S* x/ j
mDBD-VII-Ets-1 (R304A, R307A mutant of VII-Ets-1).0 z- s$ Q' \0 f. o; W
R304 and R307 of VII-Ets-1 are equivalent to R391 and R394
( F- ^* o- h8 ?8 D2 b! eof fl-Ets-1. These 2 arginine residues are critical for the DNA- U- r( u. m: t! d* j% `8 K
binding of Ets-1 (28). Cotransfection of mB-LTR-Luc and each
/ U6 R8 m1 Q5 u) n% I& H4 ~: sof these variants revealed that TAD-VII-Ets-1 alone could not' W9 n1 x( t8 U2 q$ Q( {& }. Y7 h
activate the mutant HIV-1 LTR, whereas DBD-VII-Ets-1
' ?; L) B. w8 L- a6 a1 i) kalone had a moderate effect (Fig. 3A). Also, mutation of the 2
) V! N. n1 l1 N! i; Eessential arginine residues (R304 and R307) in mDBD-VIIEts-8 J- l9 P* _- O8 V! n* O) {3 N- T
1 abolished the stimulatory effect of VII-Ets-1, indicating( I9 n x2 U* W8 p7 _
the necessity of the DBD-VII-Ets-1 in activation of the HIV-1
9 \0 i8 A% H7 B3 \- OLTR (Fig. 3A). The expression of these VII-Ets-1 variants in+ j8 v7 g/ i" z
HEK293T cells was confirmed by Western blotting with anti-
6 }/ J+ K5 O) m; YFLAG antibodies (Fig. 3B). These results demonstrate the
7 o# ]( e( m4 P! x# [essential role of DNA binding in the activation of the HIV-1
- z! q0 g1 g0 [& t+ L/ F3 xLTR by VII-Ets-1.4 N2 q* r4 o' J% a# w4 T! |' G1 h
Mapping of the VII-Ets-1-Responsive Elements in HIV-1 LTR. We% t' X' @ h8 ?, s
assayed a panel of LTR mutant and deletion constructs to# |$ g6 Q" r$ Z- u, P
determine which DNA elements in the LTR are required for- a: ]: l' _7 V% }' T: w
VII-Ets-1-mediated activation (Fig. 4A). Previous studies revealed5 N& c6 i) x. u2 y/ [. q, ^
that Ets-1 can bind to the Ets-binding site (EBS) in the
, P7 s1 |' N: ]& V7 M, b! Z/ wdistal region (150 to 145) of the LTR (27). Also, there are6 }8 [! e8 O( w$ O9 f$ Y
B
$ x( o, V1 ?/ P8 Z/ ^# G04 z3 N& ]; j; E2 i/ G
2: _+ B( \ ?# Q0 U# ?) D V: d
46 T5 I4 x5 j; F& c, n3 R- |9 |
6
" q# t4 m, v9 t& G8
1 f8 y7 Y! R6 |6 B/ J/ M( f10% H2 B/ j" e: m( I2 \8 N' G
12
]! ~: y4 f8 p/ w2 w) \; N0 10 20 30 40 50 60 70 80 90 100. M; ^2 R8 g2 p& ]6 N" X
fl-Ets13 a/ X8 S6 I7 ^
ΔVII-Ets-1
2 U1 _1 i. |$ sDNA (ng)
4 S& T: ?& p6 L* o# q% a1 sFold stimulation" b0 P# F/ K ~/ M8 N; i! }0 t: n
100 50 25 12.5 100 50 25 12.5
. _/ S7 X* v) D0 }% x9 b2 tfl-Ets1 ΔVII-Ets-1$ a) D; A# v) q# k
(ng). n8 y, F/ r# c
C
& f! v) m3 ]& v5 }1 k$ n0
! W3 O/ X; A7 l' W/ d7 p, {1
" @7 R5 m" z- L, w/ d6 g2 C5 J* Q- I$ u% j4 ~2 b7 b
3
8 S* I5 V" @, ~& a1 D9 X( L4& A; z! p+ [, n" V/ q
5
- G$ ~: [5 V# Z! _2 B0 0.5 1 1.5 2 2.5 33 k6 Z; ]* W+ @4 U' S
fl-Ets1
( L' N9 d: ~ K V( Z* oΔVII-Ets-1
3 t- X* N {) C0 x; u* w1 iDNA (μg)- {$ r/ u' E: X8 S' m1 r
Fold stimulation! J; l: V- m1 W7 ~1 w5 m
0% t6 W# h% r( c7 w+ u1 H% ^
2
, e) m2 f1 H9 f d. C( l5 i4% x0 c/ @4 b' i: m- w
65 q% p7 i7 H c- [" `0 e% n
8
* k. }6 S1 `$ O( `# {10* M8 [, x, A. G4 o- B5 ^5 d
12; v7 M( r. {3 S$ q
14
' D. H" ~4 f0 `Fold Stimulation S& x5 k2 z" q
0 10 20 30 40 50 60 70 80 90 100
; {7 l; j& x1 ]( FVII-Ets-1 (ng)0 q& s8 p1 G, ^. ?
wt-LTR-Luc: D; k6 i7 N7 ^* v
mκB-LTR-Luc, n% A4 v+ s9 A. n/ M
Igκ2-IFN-GL4
8 {$ t) P" A- \- K, \* `0 I7 y4 NA
6 M5 K5 N6 S* n+ G2 ]' i9 p6 sFig. 2. VII-Ets-1 specifically activates the HIV-1 LTR. (A) Titration of& n/ d( z) {9 Y8 U) E" s9 i
VII-Ets-1 expression vector in the presence of 0.5 ng of the control vector
- V- |: n2 y6 l8 C; FTK-RLuc plus 1 of 3 different reporters: 4 ng wt-LTR-Luc, 4 ng mB-LTR-Luc,9 L" y5 N+ U9 ]$ ]) T0 Y; l
or 10 ng Ig2-IFN-GL4 in HEK293T cells. The fold stimulation is shown
; X3 q/ h. Q+ n# y% V9 B+ nnormalized to that observed with the reference control vector pmax-$ A* z6 V0 N2 h, r# G8 U: K2 `
Empty. Data are means SD of triplicate transfections, and represent 2
i, X6 c- s/ L3 C( \, V2 Windependent experiments. (B) Titration of fl-Ets-1 and VII-Ets-1 expression* g3 M) }2 H2 m5 l* |
vectors in the presence of 4 ng mB-LTR-Luc and 0.5 ng pTK-RLuc in
5 r1 I% q- l8 q6 c' I+ w5 sHEK293T cells. (Upper) Fold stimulation, normalized to that observed with
6 q6 e1 j. m) c3 k& Qpmax-Empty. Data are means SD of triplicate transfections, and represent6 X# ], r) L2 [1 N) y6 y/ I- b" y) T
2 independent experiments. (Lower) Western blot analysis of the+ l# X1 g' Q, Z2 Z( F' O/ B3 J, {
relative expression level of fl-Ets1 and VII-Ets-1 using the lysates analyzed$ t. `& E( u. ~- {" R
in the Upper. (C) Titration of fl-Ets-1 and VII-Ets-1 expression vector in the" H4 G% X$ i/ f4 u) P1 C& D* u
presence of 100 ng mB-LTR-Luc and 50 ng pTK-RLuc in Jurkat T cells. The5 k' d+ \, N" h& @; Y& Q1 I4 T, l
fold stimulation is shown normalized to that observed with pmax-Empty.! p( A, [- Y2 h) P
Data are means SD of triplicate transfections, and represent 2 independent4 z& I" v. @7 {
experiments.! i, E6 o! E6 _7 l
0
5 _2 v1 |: w% D& W4 C28 N* T+ t. a% W/ `0 V1 J
4
. Y% [. f( L r) B( ^: T6
2 d+ `! h1 X8 x4 s3 v4 f& ^. I8+ U O$ r4 T. u5 Q8 D
10& P A4 X8 }- c0 W$ A8 Y+ k
126 v1 ]+ Q7 B1 N+ i, ?
14* f( y* N: ?6 T
Fold stimulation" U' C- y6 {; ?1 ~' L. J
1 135 243 244 354
& [6 b, O5 U& T$ R5 IR304A R307A
' t1 E9 X; |6 u% t8 ?" `0 b2 @' GVII-Ets-1$ Q/ u$ V7 p6 h% M( p
VII-Ets-1
6 U& a9 c1 h- t% |& _- kVII-Ets-1; _. d: w( [3 y
VII-Ets-1
# k! q- b/ E) }( x2 o$ e7 j5 K/ G1 s6 RTADDBDmDBDTAD0 _( e! c4 `, |- Y
ETS VII-Ets-1
0 q! L* J( p, r- `VII-Ets-19 f1 Z7 D# g3 N7 N
TADVII-
5 s+ e. i) l. P% X5 ?Ets-1
6 l8 y8 d* k; f9 wDBDVII-9 B$ w) ^2 i- n* M# N
Ets-1. ]/ W5 }- }6 P/ r4 j
mDBDVII- ~ h# Z6 p( s7 Y( }: p0 s0 `) _
Ets-1' }3 H6 _+ t; ^+ s( o, F: Z
VII-Ets-1
" C8 s3 {0 l% I" S$ wVII-Ets-1
6 Q/ w" P$ g) bVII-Ets-1
/ h+ y. ] C: M1 uTADDBDmDBDMock
/ T1 b# ~# E2 \A
: B1 u; W* y5 V) |5 g% oB) i3 @: p) b3 M5 P. S
244 3548 B3 }. c+ I: p/ Y* T! o
ETS& z! q( A& n' E4 u9 ^: \
1 135 243' n O; p5 H4 k
TAD9 u# I B, U# r1 `9 C
1 135 243 244 354
) h( }5 r) r5 _; Q H3 cTAD ETS
6 q! B: m; d0 x! I) b. D2 A& IFig. 3. Mapping the functional domains of VII-Ets-1. (A) Cotransfection of1 @! k. O7 A0 s! g/ ?
HEK293T cells with 100 ng of FLAG-tagged VII-Ets-1, TAD-VII-Ets-1, DBD-* ^5 o+ K! v+ w+ f; r$ E# W! w; I
VII-Ets-1, or mDBD-VII-Ets-1 with 4 ng of mB-LTR-Luc and 0.5 ng of TKRLuc.
* _, F' g: H) n: ?0 B3 L7 k(Left) Displayed are the constructs assayed. (Right) Fold stimulation is5 J1 A# R9 y2 y( ?* J$ x. @2 v/ j8 Y' t
shown normalized to that observed with pmax-Empty. Data are means SD! q" `' F, U% }! v2 O/ u
of triplicate transfections, and represent 3 independent experiments. (B)
9 y" x/ s T3 y" `. G0 qWestern blot analysis of the relative expression level of FLAG-tagged VIIEts-
3 X6 K6 H7 V/ ~/ f( u4 Z1 variants using the identical HEK293T cell lysates analyzed in A.1 R% d. M9 [6 \
Yang et al. PNAS Early Edition 3 of 6& Q5 z l$ a2 A& h6 e5 {
MICROBIOLOGY* i! I' y8 p3 d' ~
another 2 EBSs that bind the Ets family transcription factor8 Z1 s, h# `) J3 V% f7 M( W
GABP within the HIV-1 core enhancer (106 to 83) (29).4 _' l5 j: I7 m
These 2 EBSs are located in the 3 half of B sites with the core1 A+ W. ^, c0 ?4 B) g! r
sequence 5-GGAA-3 (Fig. 4A). Mutation or deletion of the
6 P2 w" q9 Z( E1 L2 YEBS in the distal region (150 to 145) (mEBS-mB-LTR-Luc
/ N- L0 A+ E6 W- zand delEBS-mB-LTR-Luc) reduced VII-Ets-1-mediated activation/ w# n/ B+ v' g/ f S7 B8 [- _6 I& r
by 40%. However, deletion of the enhancer region of
# h( X, V, w6 i' u- ILTR (delEnh-LTR-Luc), which contains binding sites for NF-
9 E5 S: L6 a6 k6 a: mB, NFAT and GABP, did not significantly reduce VII-Ets-6 o R& }* X. @+ V0 x) F( |( e
1-mediated activation, either in the context of mB-LTR-Luc or
9 D2 {% x& ^* G1 VmEBS-LTR-Luc, indicating that the 2 defined EBSs in this core
0 {! c- P! ?5 J7 H" X1 b+ o' ^enhancer region are not required for VII-Ets-1 activity. A
1 `) t3 J- |( A# S/ D* O8 ?construct containing only the 3 Sp1 binding sites and the TATA
4 i% O; ]3 d1 d3 O( ]4 I' W) ]box (Sp1-TA-LTR-Luc) displayed 60% of the activity of the
, x3 Q% b: a! ~( G; n! M+ dmB-LTR-Luc. Deletion of the Sp1-binding sites in the context) B* |: g& ?6 s) b, k- ~4 X( R
of Sp1-TA-LTR-Luc destroyed the activity of VII-Ets-1, indicating
8 K2 J' w" T h0 x! y* athat this region is as important for VII-Ets-1 responsiveness
1 M5 y. J" ^+ j6 Tas is the EBS between 150 and 145 (Fig. 4B).
2 T: m0 Y# _! ]- Z# g$ tInterestingly, the VII-Ets-1 mutant that could not bind DNA
" ]+ G, p- c4 |; E7 o(mDBD-VII-Ets-1) did not display any activity on any of these
- O x' @. i4 v$ s6 z9 T/ |reporter constructs, indicating that the DNA-binding activity of5 F4 t, _2 `8 ^# Z
VII-Ets-1 is required for transactivation through the elements8 ]. n' L* ~! u# o9 D2 b" @
between 150 and 145 and between 82 and 44.8 l, f9 n) p. H |
Overexpression of VII-Ets-1 Does Not Induce Full Activation of
4 Z# X/ q& z X2 h. ^- |Primary CD4 T Cells. Because our goal was to find a way to5 P' G. I$ t0 M$ X/ t- M9 W
reactivate latent HIV-1 without inducing global T cell activation,
: e" F) o! [4 x( ?we next determined whether overexpression of VII-Ets-1 could3 s% D, g. p) H/ Z& D6 ?
activate resting CD4 T cells. We isolated resting CD4 T cells V- B) p# |! }. D
with high purity from HIV-1 negative donors, and then transfected
1 S( }; B, @) O, I( |& s, hthe cells with either a mock vector or the VII-Ets-1-% F3 |. t, \5 a6 W& N" P1 P! g1 j5 ?$ g
expression vector under conditions that achieved 50–70% transfection9 U* ~% B: t& k- V, n
of cells. Overexpression of VII-Ets-1 in resting CD4 T* S o A9 V' M- @
cells did not cause the up-regulation of the T cell activation
; t9 h4 D3 b( S: _markers CD69, CD25, or HLA-DR, when compared with the
8 p; ~; N, C" j" Y+ C9 imock vector. In contrast, very strong up-regulation of these
/ i1 j& G! I5 E: \proteins was observed in cells activated with agonistic anti-CD3
: g" F5 U9 m; Q. t4 G' Rand anti-CD28 antibodies (Fig. 5A). We also compared the
# p- r: v0 D% u5 U9 \0 m" cexpression of IFN- and IL-2 in these cells. The cells transfected/ B0 ]4 }( X* [' x6 R
with either mock vector or VII-Ets-1 had very low levels of: u3 t! U# R; V) u
mRNA for IFN- and IL-2, whereas the transcripts of IFN- and
8 o+ J( |- \: dIL-2 in PHA-activated cells were significantly up-regulated by
$ C* X4 r, Y2 C7 _ K5 g" k147- and 10-fold, respectively (Fig. 5 B and C). We first assessed r# j- E4 r; @, l. b
cell proliferation by staining the cells with propidium iodide. A
+ f6 }, g! ^, [; Q0 ^7 Z/ ^low fraction of cells transfected with either mock vector or. ~% ^, `+ g0 ?; Y8 ~3 U
VII-Ets-1 had entered S phase ( 5%), whereas 34% of cells
( a# `5 e/ b: @: V/ H( Ocostimulated by anti-CD3 and anti-CD28 antibodies entered S
# B; X* a8 U- z; C2 Mphase (Fig. 5D). To independently assess proliferation, we
: b( j. m* i7 N0 Y% m4 A0 nstained resting CD4 T cells with CFSE before transfection;
* P) S6 R/ Q. L+ k, u' V" O5 R 2% of cells transfected with either mock vector or VII-Ets-1
) A: S( V9 w+ V6 F5 C1 sproliferated, whereas almost 18% cells treated with anti-CD3
s+ E7 J- t; ]! R+ y3 H$ [) hand anti-CD28 for 3 days proliferated (Fig. 5E). These data3 x' ?5 `! [, K8 z/ x2 t: e6 W
indicate that overexpression of VII-Ets-1 does not induce
( ?9 `8 y/ k9 [) v9 q( V) T9 ^significant T cell activation.
% I& n: i- U" |" h' EAbility of VII-Ets-1 Overexpression to Stimulate Virus Production by
4 t$ m1 U3 D, o$ HResting CD4 T Cells from HIV-1-Infected Patients on HAART. The
6 G5 n1 S- p! }7 O/ |; ~results of our transient reporter assay demonstrated that VIIEts-
% R' w5 v: B% F# b. t: c1 can activate the HIV-1 LTR without the involvement of/ g9 ~. T" a( ], X" A: z2 i
NF-B. We extended this result by determining whether overexpression% `2 C/ z J) I% |. X) M/ D2 J
of VII-Ets-1 could reactivate HIV-1 from the latent
# V- N s: T+ t- ureservoir in patients on HAART. We isolated highly purified
& N* S! f M; y) |0 k# ^2 Rresting CD4 T cells (99%) from 6 different patients whose
3 \% E" v7 R* w- J k' Vviral loads were below the limit of detection ( 50 copies/mL of
' v Y% C( o. Z( uHIV-1 RNA), and then transfected these T cells with either a/ r# i& T/ c7 T2 p+ F
GFP-expressing or empty expression vector to serve as a negative3 c& s4 b/ {" A
control, a VII-Ets-1-expression vector, or a positive control( \: L1 C! k' C- e9 V, f/ s) b
expression vector encoding HIV-1 Tat, a strong transactivator of. O7 t' d- n( A
the LTR that induces high levels of virus production when5 `5 x3 c8 s$ [
overexpressed in latently infected cells (30, 31)." I8 P3 Z$ ?0 u; t! p) f% ^1 p# v
Overexpression of VII-Ets-1 resulted in an increase of virus3 z/ U# e5 @- {. J& L/ [; N
release from 9- to 560-fold, indicating that overexpression of$ f7 d+ k0 w# M) f* s7 l$ }
VII-Ets-1 alone is sufficient to cause virus production in these3 T U2 C: C9 d) k2 ]- w; K; q
resting CD4 T cells of patients on HAART (Table 1). This/ C. {/ G7 H0 l6 p, G! Z+ c7 n/ ^
stimulation was comparable with that achieved with the positive
+ D2 i1 j0 C6 Z) @3 |3 t. o+ ~, Gcontrol Tat-expression vector. The transfection efficiency was' I; `! O3 b$ \4 ?' ^; k& j
estimated to be 45 to 70% based on the frequency of GFP cells; L+ J& N- `4 [% N5 y5 Y
among cells transfected with the GFP-expression vector. For 3* }. \8 c) |. S9 O! P/ L5 c- b
patients, we also tested whether fl-Ets-1 expression could activate, N% r% R: D; v. f, {
virus production. Full-length Ets-1 expression resulted in a2 e6 l! x" t+ R E2 W
measurable activation of virus, but the effect was weaker than
/ M4 h' G& P: b5 r6 [* i/ jthat observed with either VII-Ets-1 or Tat, consistent with the5 L2 U& P+ |! U0 }: F
weaker ability of fl-Ets-1 to activate transcription from the- x* k0 I1 {% V% N f7 _1 M
HIV-1 LTR (Fig. 2).
. Q: s5 y9 [7 I$ |Discussion: y/ j0 o2 X/ D1 ?+ ] t4 q
The reactivation of latent HIV-1 provirus is an essential prerequisite" M& C% V8 i% o/ j
for the eradication of HIV-1 infection. We have0 P$ U3 ]( }0 y$ @3 s: m8 J
demonstrated that an unbiased screen for activators of LTRdependent1 M; e$ B ]7 k% e
transcription is a straightforward approach toward
! \" `/ {9 }2 v' K: sthe identification of activities that can reactivate latent HIV-1.( }7 o. V' G9 s
We isolated VII-Ets-1 as an activity that was sufficient to
^5 i# A- u& J, q# VmκB-LTR-Luc
& E' l( |- G4 r0 N% E+ b- I8 kdelEBS-mkBLTR- j8 w% _# c7 N& t
Luc9 E7 Z. y+ j! x* E! t
Sp1-TA-LTR-Luc
' L6 {* [0 B: e) z+ s UTA-LTR-Luc
. f% Q# Y+ Q! u" O! smEBS-mκBLTR-3 k8 Q, `6 n: B# C3 L
Luc
8 N! \) {6 U9 w' sdelEnh-LTR-Luc" |) U( \: @0 N$ U4 N0 O
mEBS-delEnh-
$ ~4 r4 P* j: G! B* ^LTR-Luc
0 ^/ d+ J1 @ |0, W) q- Q u6 v$ p! c
1" J1 p6 z! |3 b5 `
2
9 g$ [" s; \5 _: r& ?- t3
, P3 c7 J9 O% p) B/ Z4: Z5 e# N" ]1 i" R
5
, T: D' X6 r4 v, Q y( w6# G( b. u; q' U, g
7- q; t4 k B, n$ Z; L
8
7 s4 s, \; b! N0 J- z1 im􀉅BLTR) ]( d R) c( X; r( J
mEBSm
& @) e- y S% w1 Q4 y& q. q2 {0 O􀉅B-LTR# M7 e$ K4 b$ a1 n$ f
delEBSm J B$ h1 J$ ^5 \; {$ U
􀉅B-LTR. }8 \5 C& c; A+ T( x0 M6 C- ]
delEnh-
0 H" I! V; w0 A) }# b7 OLTR1 \+ u) a, u. R) P& z! f" i
mEBSdelEnh-& D: i8 \: d( g' o" P
LTR/ Z7 H- V! m z
Sp1-TALTR9 ], q3 l9 m/ I: q) f$ f5 e
TA-LTR, \% n' t t& w/ S
mDBDEBS1 V# ~1 f8 r/ c
TATA$ a- q& w/ u7 H5 f/ f6 u/ o
3 X Sp19 X, N% W8 B5 E# `. K" r2 I/ W
R U5 GLS) `, K. u. s X# f
mEBS# }6 D0 c0 t' w! c9 [' J
VII-Ets-1
7 y8 X, z. c# }0 g+ uVII-Ets-11 `8 {# `- K0 W) f
Fold Stimulation& |/ j1 |/ X, C
2 X m􀉅B A# {( U, m/ j7 d0 X* N* ]. O
B! Y- t0 O0 G( s) ?
CTCACTTTCCGCTGCTCACTTTCC& Q) o H" ]( o# X: @* y* \
GAGTGAAAGGCGACGAGTGAAAGG1 b( E/ l) v J2 G
-106 -83
& n+ O& L+ c5 g/ }: ~, wCATCCG) D! L7 P7 G5 j; B, L: |
GTAGGC
0 ]$ @2 A# L6 k* TCTAGAG1 [# i& s) C5 S2 q/ U3 \
GATCTC" \, K" d# j) a' V1 K8 h
-150
- _( L9 U q5 w, I-106-830 r+ k# ~4 F( K( u
R U5 GLS
+ @& G' y6 ^4 R; N# R-136! t; g5 n1 I& u5 ]3 B
R U5 GLS# |* Y, }( x- `1 Y- j9 k
R U5 GLS
% E0 N3 e/ Q" Q8 P- y& Y/ U4 v-82
8 c3 q' S7 D* \) `( gR U5 GLS- j# F0 a7 g9 U0 a0 }# L0 i
-43
& G; l9 C D3 K2 i( y$ ?R U5 GLS
" x2 r4 Y0 C' R% `: }-150-145 -106 -831 m& r/ B- G0 b0 S" S
R U5 GLS; ]* s$ o6 [2 _& Z
-1453 w5 B0 |9 t3 N! Y2 Z$ S" w/ ^
mutagenesis
' [$ X# s) q4 q) @8 G7 N( k-150-145 -106-83
! K* N1 k- v- h-106 -83
- }! h" o. J1 Q. F& a-106 -83
; h1 S& w+ Q, q, |Fig. 4. Mapping the VII-Ets-1-responsive elements in the HIV-1 LTR. (A)
/ e; ~# f: R6 C. X) @: x3 Z5 DReporter constructs with truncations or point mutations of the HIV-1 LTR.! H7 Q/ w; Y# S% U9 Y
Numbering indicates the nucleotide positions relative to the transcription
9 o' j; K( O' M- c) ]start site (1). The underlined sequences within the B sites indicate putative
3 e" c: f2 i( b0 e: REBSs. (B) Cotransfection of HEK293T cells with 0.5 ng TK-RLuc and either 70 ng
1 N, I$ ~, a1 l$ J1 b7 o7 ~of VII-Ets-1-expression vector, mDBD-VII-Ets-1, or pmax-Empty with the
* d+ w6 ^1 O1 j) G. r Aindicated reporters. The fold stimulation normalized to that observed with
$ H. `( m. i: x" [$ ?% W5 dpmax-Empty is shown. Data are means SD of triplicate transfections, and. B, G' ^' V1 K6 R& z
represent 2 independent experiments.
- a E( X' r. ], s$ J- w4 of 6 www.pnas.orgcgidoi10.1073pnas.0809536106 Yang et al.
% I' F# |/ J9 H- k3 dinduce transcription from the HIV-1 LTR. When introduced
0 H4 ], }. o9 T$ v: j5 @. ainto latently infected CD4 T cells from HIV-1-positive patients,
$ y7 p* j4 n3 b7 y n. c8 K$ XVII-Ets-1 could activate HIV-1 production without inducing T
2 g: O2 i' z' j0 j% x( e0 xcell activation.0 t6 q$ w6 M1 r. Y. `9 l/ i
The HIV-1 LTR integrates the function of a multitude of! k2 f+ I; G, `- A9 j
transcription factors, some of which respond to signaling pathways1 u ^( H* X8 N# r2 K9 f8 D
that are central to cell activation, proliferation, and survival.
; _# y0 }' u; z. w1 ^5 pOur results indicate that it is possible to use only one of the
- I+ N, i7 V/ G& }& L! |% h% @factors that contributes to LTR regulation to activate latent6 q6 H! i! ]4 A8 i
HIV-1 provirus without the need to activate multiple transcription, j* K9 E# W$ T
factors or pathways that may be toxic. Other regulators of
' l* N0 H- m" wLTR transcription may provide a similar opportunity, and should( ~4 h! A- h9 `. a, u
be explored.
1 m' F6 P, [" T& ?+ v- b/ l6 KTo focus our screen on activities that would be less likely to: M" c( E3 a( I& |# s, Q$ w2 B
induce T cell activation, we used a mutant LTR that could not' N, A/ P) U( H
respond to NF-B. This approach removed from our analysis the
6 V; J0 H: G O; ahigh frequency of genes that can activate NF-B when overexpressed
: h! y* M: D" x$ J(20), and targeted the detection of genes that function
4 e3 b+ z! o0 `8 G# d# l+ Othrough elements of the LTR distinct from the NF-B-binding; G, K- s |( f( u4 P5 \1 ^
sites. However, it is still possible that some activators of NF-B c' \' C1 }( _: ^
may be particularly efficient at activating latent HIV-1 without$ f( m% _/ _8 ]6 c- `
inducing T cell activation.
& N8 ]5 m1 `5 K% L; q" }Full-length Ets-1 has previously been shown to participate in
, Z, h& R i( D( \LTR regulation in concert with other transcription factors, like
- Z# v) Z- X! TNF-B, NFAT, and USF-1 (26, 27), by binding to a conserved
* \% _4 B& t3 A# s0 ?3 b- CEts-1-binding site (150 to145) in the distal region of the LTR3 u. @# R7 I( ~' |2 }
(32). Our results demonstrate that overexpression of the alternatively
% g( S0 _: _$ {6 sspliced form of Ets-1, VII-Ets-1, is sufficient both for' k5 K& `2 @4 V( [* b
LTR transcriptional activation and activation of latent HIV-1.4 r; ?9 T9 [6 o. A% r; c
The activation of the LTR by VII-Ets-1 required its DNAbinding V/ Y& W: w, `- N) b
activity, and proceeded through 2 conserved regions of. ~+ C8 p0 J7 y, q- d
the LTR, the region containing the Ets-1-binding site (150 to
/ W) l0 L- o$ h' d6 `. `- m' w7 t145) and the region of the LTR containing the Sp1 binding
+ E6 B. L, t( N: K% q$ F1 fsites (3x Sp1) (82 to 44). Although Ets-1 has not previously4 ^8 U" L& k! j- [3 c$ f/ B m
been reported to bind between 82 and 44, it is possible that: t1 l, A7 f7 `& M
VII-Ets-1 can bind to a previously unidentified EBS in this+ S4 q& P4 \- c, k2 C* Q
region. Alternatively, VII-Ets-1 may activate a cellular gene
7 p8 \; Q Y1 z9 ?7 \# W- D" N( @; K( ]that in turn acts in this region to induce transcription from the
v( d8 k! f: O a0 Z7 a3 g: x* ZHIV-1 LTR. Further studies are necessary to resolve these
1 Q, x9 m& W7 `+ k9 Npossibilities. VII-Ets-1 is an isoform that is not subject to the
5 _. ?! }7 W) Y+ bregulation imposed by the autoinhibitory domain that is encoded
7 \* m- w2 ^9 n6 E3 W. k6 hby exon VII, or by phosphorylation sites also encoded by exon
. H$ \0 y3 p/ n' W/ D6 Q2 ^VII that negatively regulate Ets-1 DNA binding and transcriptional. \2 ~0 R- `6 y3 I, M
activity. Our data indicate that VII-Ets-1 is a more
3 P) c8 F0 D/ G7 a2 h6 m) Fpotent activator of LTR-dependent transcription than fl-Ets-1,
- ~* Q3 u6 k: Gand this enhanced activity correlates with a greater ability to5 X" b; L4 ~/ U" i
activate HIV-1 production. Therefore, the VII-Ets-1 isoform
0 R0 G& T5 W# \1 `0 y4 V! jmay be uniquely suited to being active without the need for other$ p4 N* n1 J& p7 R, G# U
factors or pathways that may be required for the activity of
6 E; h& V' S# b x' n7 Kfl-Ets-1. The ability of VII-Ets-1 to reactivate latent HIV-1
3 q& b. |# \; z; K/ Ysuggests that potential therapies might be aimed at increasing the
/ K4 `: H& w$ W# b9 c J; ?levels of expression of this isoform of Ets-1 in latently infected N% `, A; T# G/ F' t( C6 p
cells. Alternatively, potential therapies might involve the conversion7 Z0 w* d& I$ S- \
of fl-Ets-1 from an inhibited to an active transcription2 ^ z" W# {+ y+ |
factor.
/ k5 M% Y+ v0 i5 lOur screen was conducted with only 1 cDNA expression
J! F. ]4 [4 P. |: h/ |, }library, and screening was well below saturation. Therefore, it is
+ d7 L0 n5 ~4 N8 jlikely that our approach can be expanded and lead to the# ]/ N+ j, L; K; D9 l4 G- i
isolation of further interesting genes with desirable therapeutic
# X5 p/ k+ o2 V" R4 vpossibilities. Our results prove that the screen for activators of
$ L# o5 E @# y+ H: k4 Y1 I+ pLTR transcription is a good surrogate screen for genes that can s! p' h% N; t P+ \% F( u, p
activate latent HIV-1. It will allow efficient, inexpensive screening% k# y( g% l7 y/ B s' ^4 p
of more cDNA libraries, and can be adapted easily for the% o1 @. j* B3 O2 @+ [# a+ h( P9 @
screening of small molecules.
: ?" Q+ j: r1 bCD691 ?: `) Y9 y; S* v ?, V
Isotype Mock αCD3+αCD28
3 K' `' D. n5 M0 p1 m100 101 102 103 104 100 101 102 103 104. I) Z# I5 y( ^ T
100 101 102 103 1041 p6 U, B, k7 O; q! f1 b5 |
100 101 102 103 104
1 b. B+ f! j8 O- P: j f5 Y' e100 101 102 103 104( p+ i% c5 m7 W3 t
100 101 102 103 104$ F- [! z% J, B( S1 G# {
100 101 102 103 104
4 N4 w' j( f8 P8 j100 101 102 103 104
3 r$ M5 S8 U; i( Q* |0.6 0.04 0.9 0.08 14.8 8.59
! h! @2 I0 i6 {HLA-DR
2 j" \5 }% b% }' qCD25
0 e; V: N, K% \1 a: v100 101 102 103 104
; i% b* f$ g) ~3 F* l+ q100 101 102 103 1042 ~) R" h; l4 S6 F9 k- v) }
100 101 102 103 104
% d% o2 b4 V9 |) x100 101 102 103 104
* y" J- @2 V/ k5 ?; Z; M1 E100 101 102 103 104' d& d2 N1 N" W8 K) u7 b
100 101 102 103 104
9 K4 e; k1 W+ [4 x100 101 102 103 104 100 101 102 103 1043 T6 K( ~* H; {8 v- r7 K" R
0.5 0.04 0.4 0.07 13.6 12.40
' a! Y. B1 f# [% ]0
+ i4 @$ c; Q- j) g# g1 @50
! P4 Y, k1 a8 t1 {* N8 e% j100
2 s& o, s6 d$ `/ M5 Z' c( H150: @) v& i: [" t. A* C" T6 t5 u4 f
2009 ~5 U0 a7 O$ i1 M9 u
Mock5 T! C, D+ o7 S
Fold increase
2 }1 W6 _) p M% [% D) a J" q0+ T' P- t' F& ~- E7 S
55 K- \: \) R0 Z+ R
101 p9 i2 O: m+ m! ~& A& v& z2 B
15
; p, i A- v9 _3 KPI$ n# o E2 }1 V P# D; |3 k
0 200 400 600 800 1000; ~2 A6 g$ d8 ~4 _) [
4.69 % [ K; a# H+ g+ b9 `2 q5 G
0 200 400 600 800 10005 }" d; [; }1 E0 [5 u( F
4.82 %
* Q/ A: N) ~+ p r/ [0 200 400 600 800 10006 r a+ [. x* B( v9 u5 A
34.28 %; Z+ X! \/ Z+ k h, |
0.09 0.06 4.58 Z6 T4 a( q7 E+ K5 o
0.10 0.08 1.23) @3 \' I* @. [9 N
VII-Ets-1/ A, b8 E3 e: Q9 n k! K
VII-Ets-1 PHA
1 c, ]. X. U) H: g; m3 m6 p' ~% CFold increase3 ~5 ]' P$ L/ O$ r
Mock VII-Ets-1 αCD3+αCD289 [* m6 T& ]& F
A& Z/ C1 e7 N# V' B
B
A1 z6 N. Q; Y, w9 p. rD$ a4 o5 b# m! e4 E: v5 ?2 ~
C
; ^; c! ?) I* b2 x q8 hMock VII-Ets-1 PHA
6 P2 T4 g! R0 N- e; m4 kMock VII-Ets-1 αCD3+αCD28
' q8 S; o6 [9 H2 U# w+ Q3 o10
8 E. N# P' a. N6 `# a7 }0
8 ?, O1 N+ x% W3 n% g2 Q, t10 10 10 10 1 2 3 4 104 c7 h3 q/ @# c6 B; r- y S6 C" U
0. e( i7 N( o1 O
10 10 10 10 1 2 3 49 X* ?9 J) [' L' K* o& J+ Q
10
# j u. I7 f" }; W2 R0. m9 D; E( M0 O% U
10 10 10 10 1 2 3 4
' @: p: A; o. J: B8 j1.6% 1.77% 17.89%4 }" Y- D3 d3 b" A; n. n1 D
CFSE
. r: T( ?4 ~/ h% E, qE4 ^" O% ?4 `4 g! h- z
Fig. 5. Overexpression of VII-Ets-1 in primary resting CD4 T cells does not
$ Z' j" s. z4 N* ^( `induce significant activation of T cells. (A) Expression of activation markers on( X7 Q; N/ R7 {2 W* d3 E
VII-Ets-1-transfected primary resting CD4 T cells or CD4 T cells activated
6 P6 V! S' G9 R1 z7 @% Rwith 2.5 g/mL anti-CD3 and 1 g/mL anti-CD28 for 72 h; 5 g of VII-Ets-1-
' d5 n1 M$ H2 b/ Xexpression vector was transfected into 3.5 106 primary resting CD4 T cells
0 e8 y5 h8 C& v' A6 i# l% Iby nucleofection. VII-Ets-1-transfected cells were analyzed for surface expression2 l; W: S4 K: t
of CD25, HLA-DR, and CD69 byflowcytometry 72 h after transfection.
7 B" r8 A3 |/ q5 F, \5 ^1 qIFN- (B) and IL-2 (C) transcripts from primary CD4 T cells 72 h after transfection3 ]7 N3 ~! G0 D
or after 72 h of PHA treatment were quantified by real-time RT-PCR,
% `6 c/ f b: D6 ~1 |' }8 L- C' Fand were normalized to ubiquitin mRNA levels. The fold stimulation was: A/ Y. {, K, p
normalized to that observed with the reference control vector pmax-Empty.
- J. T% @) R3 a; a# t6 [3 JData are means SD of triplicate measurements, and represent 2 independent
+ Z8 s" ]' R: u/ y7 b$ L8 `experiments. (D) VII-Ets-1-transfected cells, pmax-Empty-transfected
; N8 k. X2 F& T9 e; fcells, and anti-CD3/anti-CD28-treated cells were stained with propidium iodide,
3 A; O/ |0 \8 `5 f/ m" A: m9 Q0 {! jand analyzed for cell proliferation by flow cytometry on day 3 after0 O- v% O5 `4 ^
nucleofection or antibody treatment. (E) Primary CD4 T cells were stained
$ \$ Z+ Z1 M* Q! G* q1 b$ xwith 1 M CFSE and then transfected with VII-Ets-1 expression vector or
/ c, _( `- X) Kpmax-Empty or activated with anti-CD3 and anti-CD28, and analyzed for cell4 k7 Y0 u+ ?1 X& a p4 y- ?
proliferation by flow cytometry on day 3 after nucleofection or antibody
/ p: D; `' ?" g1 J' [treatment.0 d5 C/ \7 c! I2 L
Table 1. Induction of virus production from primary CD4 T cells
2 v% d ~/ n; D$ lisolated from patients on HAART by transfection of VII-Ets-1, Q4 K# c* I: h1 S* N
fl-Ets-1, or Tat& z' ~5 [: {8 c6 }9 k) ]6 C
Control VII-Ets-1 fl-Ets-1 Tat, I% E4 q9 R) J E u7 I
Patient 1 128 1206 (9.4) ND ND" ]' {$ l) d. E+ k0 J
Patient 2 50 778 (15.6) ND 815 (16.3)
% U4 R& k4 ~* ?+ H' XPatient 3 50 28006 (560.1) ND 17353 (347.1)
6 @" b; k2 w- {' pPatient 4 50 1132 (22.6) 112 (2.2) 745 (14.9); X' [) x4 D% T/ V0 f
Patient 5 50 643 (12.9) 85 (1.7) 821 (16.4)) d% `9 T K- I, J- e
Patient 6 50 788 (15.8) 220 (4.4) 851 (17.0)1 K2 m. f! s. C) S' |
The number in each cell represents the copy number of viral RNA released2 I' G* l" @- b
in the culture supernatant. The number in parentheses is the fold increase, as
7 \2 \4 z- M% S a7 N7 o: Wcompared with the reference control vector pmax-GFP (patients 1–3) or
$ s% y$ k+ o5 vpmaxEmpty (patients 4–6). ND, not determined., o" M6 y8 E8 q6 Y+ [0 o O! G* Z6 d
Yang et al. PNAS Early Edition 5 of 6
* t/ g! ^$ F* p7 z$ pMICROBIOLOGY# T' \1 D8 Q+ @: ?/ y; W: d
Materials and Methods
7 w$ ?! h8 v. m( F# G3 Q$ VPatients. Resting CD4 T cells were isolated from 6 HIV-1-infected adults who8 H1 ~' H* L9 \7 m4 z" T
had been continuously receiving HAART for at least 6 months and had
2 q1 h' x+ ?; Xsuppression of viremia to 50 copies/mL.
, w/ B2 Y1 p" R' x6 _Primary and Secondary Screening.Weadapted the strategy of Pomerantz et al.
, A/ M- b/ {: Q(20). A human splenocyte cDNA library was divided into pools of 100 cDNAs9 m) i9 e ~6 b+ h$ L
per pool. HEK293T cells were plated at 9 104 cells per well in 24-well dishes,
: q7 J; w2 u1 K) d$ mand transfected 24 h later with a total of 356 ng of DNA, including 2 ng of
! `0 @- s2 V; u# x1 ^8 hpCSK-LacZ, 4 ng ofmB-LTR-Luc, and 350 ng of poolcDNAby using the calcium
/ _8 n; W5 _4 N7 Ephosphate method. The reference control transfection contained 350 ng5 x4 C3 t' M5 U+ A# |. l2 k
pcDNA3.1() (Invitrogen). At 40–48 h after transfection, the cells were lysed0 ^! y9 g6 _$ C" M7 `! D2 v0 [
in 100 L of passive lysis buffer (Promega) at room temperature, and centrifuged: J* ~+ U( m9 A$ N0 J2 D
at 13,000 g at room temperature for 5 min to pellet debris. We used
" s7 O+ W4 E" }9 N- j20 and 10 L of lysate, respectively, to assay luciferase and -Gal activities, by
( e$ q: o6 @% _; {: I; i- ausing the luciferase assay system (Promega), a chemiluminescent -Gal reporter0 ?0 H/ ~4 ~) V5 G' y
gene assay (Roche), and luminometer (Central LB 960; Berthold) in
/ U5 {7 _- \3 \6 q0 c2 v+ vaccordance with the manufacturers’ instructions. Fold stimulation was calculated7 B! ~) \5 \/ s" A, z2 M
for each sample by dividing the luciferase activity, normalized to the! T0 M4 @; B- U$ x+ b- _; K
-Gal activity, by that observed in the empty vector control sample. Positive$ e# B* H/ s* ^& M1 Z- m
pools were considered NF-B-independent if their activity with the Ig2-IFNGL46 R" s0 M n9 ^5 c' Y# d) R3 G
reporter was 30% of that observed with the mB-LTR-Luc reporter, or/ x/ ^# L y+ M+ k) J# _! U
if they stimulated the Ig2-IFN-GL4 reporter 1.5-fold.
% V3 Z6 F. [' O7 Q. P9 V, GTransient Transactivation Assay in HEK293T Cells and Jurkat T Cells. In Figs. 2–4,
& ]. B# D- m1 A- x5 G& Rwe used TK-RLuc (pGL4.74; Promega) as an internal control instead of pCSKlacZ;/ Y; C, d# K! ~! D o
20 L of lysates were analyzed by using the Dual-luciferase Reporter6 T! |) x1 Q2 b
Assay System (Promega) according to the manufacturer’s instructions. Fold
* d/ s$ m( ]' `, vstimulation was calculated by comparing observed activities with that
3 T- z4 N0 P) Y$ ?( l' F: eachieved with the vector pmax-Empty. Jurkat T cells were grown in RPMI
8 }: _- ? P) _7 K/ D5 Bmedium 1640 with GlutaMax-I (Invitrogen) supplemented with 10% FBS
! ?0 M/ J( f- Z7 o0 A(Gemini Bio) and 100 U/mL each of penicillin and streptomycin. On the day of9 V7 x# o# T+ c! J+ n6 {
transfection, 5 105 cells were plated in 2 mL in each well of a 6-well plate
5 Z; _4 i+ ?9 L2 p" X' e5 N! pbefore incubation with DNA-Fugene 6 (Roche) complexes using a total of 2.95
, b6 c# Y8 A( |: E7 z( G; Wg of DNA and 9 L of Fugene 6. Transfections included 100 ngmB-LTR-Luc,; Y. x0 A5 o% O$ W, j$ H% X
50 ng TK-RLuc, and up to 2.8 g pmax-VII-Ets-1; 40–48 h after transfection,! g' F: T7 O- z5 T% U
cells were lysed in 150 L of passive lysis buffer (Promega) for 15 min at room
3 N+ g4 ] p5 J9 [temperature. Debris was removed by centrifugation at 14,000g for 5 min in
# S: N* m: Z! |; g& K# G j6 V# _% Ra microcentrifuge at room temperature, and 40L of lysates were analyzed as
3 X; j1 g1 J$ Y* ~" Mdescribed above.2 D; o/ V5 I; ~2 B$ _5 V1 v$ \8 c
Cell Lysates, Western Blots, and Antibodies. Primary CD4 T cells or HEK293T
7 Y0 E# G; y) p u) J1 @. Qcells were lysed in RIPA buffer (50 mM Tris, pH 7.5/150 mM NaCl/10 mM
- \& X, L- |1 o1 A1 G$ B0 u& uEDTA/1% Nonidet P-40/0.1% SDS) plus protease inhibitors (Sigma). Debris was
8 ?* [ W1 N q! Jremoved by centrifugation for 20 min at 13,000 g in a microcentrifuge at7 H( [1 ?1 L6 ]0 A
4 °C. Anti-Ets-1 (sc-350; Santa Cruz), anti--actin (Sigma), and anti-FLAG-HRP
7 U j' I+ ^& k4 b* s7 ^(Sigma) were used at dilutions of 1:400, 1:2,500, and 1:3,000, respectively.
+ w: ~' N, Q" CRNA Isolation and Real-Time RT-PCR. Total cellular RNA was isolated by using4 z. [/ W2 a# N/ z" Q: Y' L/ T
RNeasy Mini Kit (Qiagen) and RT reactions were performed by using Super-* j z1 O- k: T% ?. U! e
Script III Reverse Transcriptase (Invitrogen) with random primers (Invitrogen). |/ z0 R( u2 H1 a
Expression of IFN- or IL-2 transcripts was measured by using TaqMan Gene6 A1 h3 Z1 ~6 v- F0 q
Expression Assay products on an ABI 7300 Real Time PCR System. The ubiquitin9 K" |- d- S1 Q5 l
mRNA was measured by RT-PCR with SYBR Green PCR Master Mix (Applied
, ^" U" i4 L) dBiosystems). All control reactions with no template or without the addition of
3 ~' }8 B7 r! p" n) QRT were negative.$ U' r1 Y/ m5 t$ M
T Cell Purification and Transfections, RNA Isolation, and Real-Time RT-PCR for7 P) \2 G! ]' u6 [
Viral Load. Resting CD4 T cells from patients onHAARTwere isolated through$ L% T9 b" y: n
a 2-step purification procedure as previously described (2). Transfections were
- Q2 Z) p# K8 |0 _$ V# @performed by using anAmaxaNucleofector. PurifiedCD4 T cells (2.5–4106)9 ^; ^" c6 M7 M% B: \
were resuspended in 100 L of Nucleofector solution, transfected by using# p5 `8 W0 Y. Z7 \. j; |; `
program U-014, then cultured in 2 mL of RPMI medium 1640 with GlutaMax-I; j( E3 f8 P. E! ?, f* ~
(Invitrogen) plus 10% FBS (Gemini Bio) and 100 units/mL each of penicillin and
$ c. ?9 \* F6 ?! v' j, W! U7 U6 Pstreptomycin. For each patient, the number of cells used was identical for each
* S$ n+ a0 G2 f7 Xcondition. For each transfection, 3.5–5.0g of pmax-GFP, pmax-Empty, pmax-
1 P, _' C7 l4 Z" [0 b/ TVII-Ets-1, pmax-fl-Ets-1, or pcDNA-Tat-86 was transfected. GFP expression1 { H5 m6 C. v9 P* u: I
served as a negative control and an indicator of transfection efficiency based
- Y% p3 x7 `0 h5 L# p" h8 Fon the frequency of GFP-positive cells assayed by flow cytometry. To measure
, V) E$ B) X( t u7 @0 Wthe copy number of released virus, supernatants of transfected resting CD4
6 u. X) |- R; c; c# N+ c0 BT cells were collected 72 h after nucleofection. RNA isolation and real-time
: W/ l# X+ W5 f) W; _RT-PCR were done by using Amplicor Ultrasensitive for HIV-1 Kit (Roche)
3 ~( w) z9 d$ M+ l$ v5 z$ Y lfollowing the manufacturer’s instructions.1 ~ l& ~8 H G& @/ T6 ?' y& H
Further details regarding the construction of reporter constructs and expression
& x+ X9 f/ M; b! g; F/ [vectors are available in supporting information (SI) Materials and
/ V. W, X6 a- g2 j" L% P/ F; uMethods.
# [, @8 d3 t4 I% GACKNOWLEDGMENTS. We thank H. Zhang for help in cell sorting, the laboratory+ f8 \0 P8 |( O* g
of Dr. Thomas C. Quinn for measuring viral load, and Drs. J. Blankson
, U% S. F6 m0 o' D& \# Pand A. Shen for critical comments on this manuscript. This work was supported
5 e- l7 R- N5 a& }( Xby National Institutes of Health Grant AI043222 (to R.F.S.). J.L.P is a Rita Allen
; Y# t9 i. A9 f# B6 E! W# t: YFoundation Scholar and a recipient of a Kimmel Scholar Award from the' ~3 k- U; T& c- A% Q
Sidney Kimmel Foundation for Cancer Research.
9 ]1 T2 Z) k' q9 A- x' ]1. Palella FJ, Jr, et al. (1998) Declining morbidityandmortalityamongpatients withadvanced/ V+ ^! R3 x$ X2 j$ u( C/ h+ |& k
human immunodeficiency virus infection. HIV Outpatient Study Investigators. N Engl
* |$ ]- B# a2 l" E; V# o9 PJ Med 338:853–860.+ x0 ^4 `5 r% }2 I L4 H% {; e* i
2. Finzi D, et al. (1997) Identification of a reservoir for HIV-1 in patients on highly active
1 g; K9 M! j5 {& i7 E! iantiretroviral therapy. Science 278:1295–1300.
P$ u/ g$ J \! e0 }# p* z3. Wong JK, et al. (1997) Recovery of replication-competent HIV despite prolonged suppression& ]4 C: h/ b/ |* o6 w
of plasma viremia. Science 278:1291–1295.
- q- P3 x% q! d f7 Y2 o+ t4. Chun TW, et al. (1997) Presence of an inducible HIV-1 latent reservoir during highly active
9 ^8 P6 S/ g# J; w$ oantiretroviral therapy. Proc Natl Acad Sci USA 94:13193–13197.
3 T9 C. h y( ^7 }& `2 p1 ~5. Siliciano JD, et al. (2003) Long-term follow-up studies confirm the stability of the latent, Q% a8 @/ G" P
reservoir for HIV-1 in resting CD4 T cells. Nat Med 9:727–728.
* q& `) _# ?3 f% t6 x- Q1 B6. Geeraert L, Kraus G, Pomerantz RJ (2008) Hide-and-Seek: The Challenge of Viral Persistence0 C& \+ `! ~+ o' l3 Y- I
in HIV-1 Infection. Annu Rev Med 59:487–501.
5 Y: X+ K/ i7 e) d; O7. Margolis DM, Archin NM (2006) Attacking HIV provirus: Therapeutic strategies to disrupt
0 c3 k( v0 p2 a. ]7 ` D8 upersistent infection. Infect Disord Drug Targets 6:369–376.
* Q: N# @" @$ R$ _( j7 @8. Brooks DG, et al. (2003) Molecular characterization, reactivation, and depletion of latent' U6 M4 I+ @* k0 z2 p: Q
HIV. Immunity 19:413–423.
+ H+ o9 {) S/ _% n9. Lehrman G, et al. (2005) Depletion of latent HIV-1 infection in vivo: A proof-of-concept
# W$ c) V8 w& R; n# e/ Y1 U+ Mstudy. Lancet 366:549–555.6 b6 K' K. |: F1 E, D
10. Prins JM, et al. (1999) Immuno-activation with anti-CD3 and recombinant human IL-2 in
' u" m$ l c7 RHIV-1-infected patients on potent antiretroviral therapy. AIDS 13:2405–2410.
5 p/ z2 v$ c* `. c11. van Praag RM, et al. (2001) OKT3 and IL-2 treatment for purging of the latent HIV-1
0 a. A( z. y T: C: V- k+ T/ A, r1 ~/ Lreservoir in vivo results in selective long-lasting CD4 T cell depletion. J Clin Immunol4 W- r& V9 D1 n$ a8 f# V( I1 v
21:218–226.8 H, g" C) C+ O! J
12. Duh EJ, Maury WJ, Folks TM, Fauci AS, Rabson AB (1989) Tumor necrosis factor alpha; }$ @- y/ Q. j( T7 T
activates human immunodeficiency virus type 1 through induction of nuclear factor9 o& x0 a! s! n7 I$ f: }. G, V
binding to the NF-kappa B sites in the long terminal repeat. Proc Natl Acad Sci USA! K7 J( p0 R) q. A
86:5974–5978.
, O5 Z* T0 R+ D: D7 V13. Nabel G, Baltimore D (1987) An inducible transcription factor activates expression of+ C {% `7 f& C& p* F& Q5 i$ o% V. I1 A
human immunodeficiency virus in T cells. Nature 326:711–713. _" e* m8 T& x
14. Tong-Starksen SE, Luciw PA, Peterlin BM (1987) Human immunodeficiency virus long
?* ^& r7 B5 Y4 D$ Z2 v$ O, m" B, oterminal repeat responds to T-cell activation signals. Proc Natl Acad SciUSA84:6845–6849.6 g& g! Q; }- X. k5 l1 }
15. Pereira LA, Bentley K, Peeters A, Churchill MJ, Deacon NJ (2000) A compilation of cellular
/ W0 @2 N' V$ Atranscription factor interactions with the HIV-1 LTR promoter. Nucleic Acids Res 28:663–
/ z+ T2 E9 H1 j3 R: e668." U: D- s2 n5 j" b7 ]- g/ @
16. Chen BK, Feinberg MB, Baltimore D (1997) The kappaB sites in the human immunodeficiency
! @* Z' r+ |) q& dvirus type 1 long terminal repeat enhance virus replication yet are not absolutely9 J; Y5 M) H5 Q7 b$ i
required for viral growth. J Virol 71:5495–5504.% _$ P7 L: ]: i! E2 s% Q, T
17. Antoni BA, Rabson AB, Kinter A, Bodkin M, Poli G (1994) NF-kappa B-dependent and
6 [# |6 u! z8 d* I-independent pathways of HIV activation in a chronically infected T cell line. Virology( K( y0 D0 e0 J8 d+ P1 t
202:684–694.$ C; Q3 s; @" S6 m
18. Leonard J, et al. (1989) The NF-kappa B binding sites in thehumanimmunodeficiency virus, _! o/ t- ^' D2 @1 q
type 1 long terminal repeat are not required for virus infectivity. J Virol 63:4919–4924.
& N) M" O+ o! }1 J19. Bonizzi G, KarinM(2004) The two NF-kappaB activation pathways and their role in innate
3 I4 G3 K* w, \and adaptive immunity. Trends Immunol 25:280–288. K) v' i0 H+ B% z
20. Pomerantz JL, Denny EM, Baltimore D (2002) CARD11 mediates factor-specific activation; X: V1 Q6 e0 Z8 O/ s
of NF-kappaB by the T cell receptor complex. EMBO J 21:5184–5194.8 d2 F8 _% b, f, `" l
21. Dittmer J (2003) The biology of the Ets1 proto-oncogene. Mol Cancer 2:29.
5 y( x, d/ `5 K! V( X) e1 ?22. Jorcyk CL, Watson DK, Mavrothalassitis GJ, Papas TS (1991) The human ETS1 gene:5 v6 m& a% f- `: N. w A% M8 f
Genomic structure, promoter characterization and alternative splicing. Oncogene 6:523–9 f+ n i: ], W
532.
! C3 [& B+ i# s, x6 B1 E/ f; y23. Muthusamy N, Barton K, Leiden JM (1995) Defective activation and survival of T cells7 H' a& F9 X1 N) H
lacking the Ets-1 transcription factor. Nature 377:639–642.. r8 \0 d# A) T; M$ ]2 ~# [4 c
24. Jonsen MD, Petersen JM, Xu QP, Graves BJ (1996) Characterization of the cooperative
) Z* n$ N0 |4 |/ O8 ~function of inhibitory sequences in Ets-1. Mol Cell Biol 16:2065–2073.) ~: a4 Q1 Y6 i, I! ~
25. Cowley DO, Graves BJ (2000) Phosphorylation represses Ets-1 DNA binding by reinforcing
8 {7 U Q, n& p9 Y6 U7 a* Wautoinhibition. Genes Dev 14:366–376. g. U& e7 H o7 M. _. w
26. Bassuk AG, Anandappa RT, Leiden JM (1997) Physical interactions between Ets and3 o8 V3 c7 E6 q5 y: M
NF-kappaB/NFAT proteins play an important role in their cooperative activation of the
1 e: l2 P1 ?: b6 j. Z" u/ uhuman immunodeficiency virus enhancer in T cells. J Virol 71:3563–3573.
) P% C s5 H, U" @7 F8 n' l27. Sieweke MH, Tekotte H, Jarosch U, Graf T (1998) Cooperative interaction of ets-1 with
7 v6 C; o4 J' L1 e$ `, \USF-1 required for HIV-1 enhancer activity in T cells. EMBO J 17:1728–1739.
7 {7 k# H0 n: Y& M/ j( ]+ K28. Garvie CW, Hagman J, Wolberger C (2001) Structural studies of Ets-1/Pax5 complex
3 Y7 }' N+ l8 q9 ^/ Jformation on DNA. Mol Cell 8:1267–1276.
% S5 c0 e5 f i" g: p2 A& K29. Flory E, Hoffmeyer A, Smola U, Rapp UR, Bruder JT (1996) Raf-1 kinase targets GA-binding2 e% r+ f7 z% L" u
protein in transcriptional regulation of the human immunodeficiency virus type 1 promoter.
, V3 P+ q0 T* v* zJ Virol 70:2260–2268.
8 x& v O. c2 s# T' @2 h1 g) ?30. Lassen KG, Ramyar KX, Bailey JR, Zhou Y, Siliciano RF (2006) Nuclear retention of multiply
- ?% q4 c; X! d: ^. H+ ospliced HIV-1 RNA in resting CD4 T cells. PLoS Pathog 2:e68.( z7 R5 ?8 R( ~; F1 l7 n
31. Lin X, et al. (2003) Transcriptional profiles of latent human immunodeficiency virus in1 v0 J1 e! f) e$ B2 F
infected individuals: Effects of Tat on the host and reservoir. J Virol 77:8227–8236.0 G7 x# Q4 J5 U( N1 W! h
32. Estable MC, et al. (1996) Human immunodeficiency virus type 1 long terminal repeat
' w+ i* `$ Q% ivariants from 42 patients representing all stages of infection display a wide range of* n$ G( L p7 b+ j% R1 @4 E
sequence polymorphism and transcription activity. J Virol 70:4053–4062. O3 o8 ?; c2 D4 r" ~( j! A+ U1 x, j
6 of 6 www.pnas.orgcgidoi10.1073pnas.0809536106 Yang et al. |
-
总评分: 威望 + 2
包包 + 2
查看全部评分
|
发表于 2009-6-1 17:38
