Reprogramming Efficiency Following Somatic Cell Nuclear Transfer Is Influenced b - 《stemcells》干细胞学杂志干细胞之家



免疫细胞治疗专区	欢迎关注干细胞微信公众号

12 3 4 5 6 7 8 9 10 ... 28 下一页

返回列表

查看: 497980\|回复: 273	go Reprogramming Efficiency Following Somatic Cell Nuclear Transfer Is Influenced b [复制链接]

江边孤钓

版主

Rank: 7 Rank: 7 Rank: 7

积分: 0
威望: 0
包包: 483

楼主

发表于 2009-3-5 00:02 |只看该作者 |倒序浏览 |打印

作者：Robert Blellocha,b, Zhongde Wanga, Alex Meissnera, Steven Pollardc, Austin Smithc, Rudolf Jaenischa作者单位：aWhitehead Institute of Biomedical Research and Department of Biology, Massachusetts Institute of Technology, Cambridge, Massachusetts, USA;bDepartment of Pathology, Brigham and Womens Hospital, Boston, Massachusetts, USA;cCentre Development in Stem Cell Biology, Institute for Stem Cell Research, Sc

   / z0 Z- v$ G+ m. h. j



         & e  X" h' m7 l' ?
         * Q4 P& ]; g4 R. J, l: A1 C




      * P' A) g% ]2 V
      【摘要】
   Reprogramming of a differentiated cell nucleus by somatic cell nuclear transplantation is an inefficient process. Following nuclear transfer, the donor nucleus often fails to express early embryonic genes and establish a normal embryonic pattern of chromatin modifications. These defects correlate with the low number of cloned embryos able to produce embryonic stem cells or develop into adult animals. Here, we show that the differentiation and methylation state of the donor cell influence the efficiency of genomic reprogramming. First, neural stem cells, when used as donors for nuclear transplantation, produce embryonic stem cells at a higher efficiency than blastocysts derived from terminally differentiated neuronal donor cells, demonstrating a correlation between the state of differentiation and cloning efficiency. Second, using a hypomorphic allele of DNA methyltransferase-1, we found that global hypomethylation of a differentiated cell genome improved cloning efficiency. Our results provide functional evidence that the differentiation and epigenetic state of the donor nucleus influences reprogramming efficiency.
      【关键词】 Embryonic stem cells DNA methylation Nuclear transfer Reprogramming) c1 q" D. h2 k1 K2 Y5 r' d5 v
   INTRODUCTION# v# B: w2 X$ O) ^8 e$ W& g" n

Somatic cell nuclear transfer (NT) is an inefficient process. Development of NT-derived blastocysts into embryonic stem (ES) cells or adult animals appears to be influenced by the differentiation state of the donor genome .. e  O' N4 \+ m! K3 g

The low efficiency of postblastocyst development following NT of differentiated cells is, at least in part, due to faulty global reprogramming, leading to defects in early embryonic gene expression. During normal development, early embryos undergo a well-orchestrated series of DNA methylation and histone modification changes that are believed to play an important role in establishing a chromatin state permissive to early embryonic gene expression. In contrast, nuclear transfer-derived embryos typically show abnormal patterns of DNA methylation and histone modifications , consistent with faulty epigenetic reprogramming causing the abnormal expression of Oct4 and other essential pluripotency genes.' O0 m: ?- Q; q/ i4 Q5 ~% F
$ n! \' [$ f0 X& @$ F- R
These data suggest that cellular differentiation influences the epigenetic state of the donor cell nucleus, which in turn determines the efficiency at which an enucleated oocyte can reprogram a donor cell into a pluripotent embryonic stem cell fate. Therefore, we hypothesized that somatic stem cells should be more efficiently reprogrammed than their differentiated counterparts. To test this, we analyzed the efficiency of reprogramming neural stem (NS) cells. We chose NS cells because they can be cultured as a homogenous population using recently established techniques . We found that neural stem cell donors had as high an efficiency of producing NT-derived ES cells as ES cell donors, suggesting extremely efficient reprogramming of this somatic stem cell genome. Furthermore, we tested whether DNA methylation, a critical component of the epigenetic program, influences cloning efficiency. To test the effect of genomic hypomethylation on reprogramming efficiency, we used donor fibroblasts carrying a hypomorphic allele of the DNA methyltransferase Dnmt1, which results in the global hypomethylation of the donor genome. We found that the Dnmt1 hypomorphic donor cells were more efficiently reprogrammed into pluripotent ES cells than their wild-type counterpart.
4 `3 X8 n4 p) I& ?  o1 O
MATERIALS AND METHODS& w$ V4 q3 E5 r+ A3 X! C% p9 ^

Donor Cell Lines

The NS5, NSV6.5, and Cor1-5 neural stem cell lines were derived and cultured as described . Cells were cultured on 0.2% gelatin-coated plates in NS-A (Euroclone, Pero, Italy, http://www.euroclone.net) plus N2 supplement (Gibco, Grand Island, NY, http://www.invitrogen.com), and 10 ng/ml fibroblast growth factor (FGF)/epidermal growth factor (R&D Systems Inc., Minneapolis, http://www.rndsystems.com). For differentiation, cells were transferred to polyornithine/laminin-coated plates. For glia differentiation, cells were cultured in NS-A medium plus 1% fetal bovine serum (FBS) for 6 days. For neuronal differentiation, cells were cultured in NS-A plus FGF alone for 7 days and then NS-A plus B27 for 6 days. Hypomorphic DNMT1 and wild-type tail tip fibroblasts were isolated from adult mice and cultured in Dulbecco¡¯s modified Eagle¡¯s medium plus 10% FBS, nonessential amino acids, ß-mercaptoethanol, and penicillin/streptomycin.

Nuclear Transfer and ES Cell Derivation
. ]2 K1 W7 D9 @2 G0 u2 r
Nuclear transfer was performed as previously described . Oocytes were collected from superovulated (C57BL/6 x DBA/2 F1) females. Enucleation and nuclear transfer were done with a piezo-driven micromanipulator system (Primetech, Ibaraki, Japan, http://www.primetech-jp.com) on a Nikon microscope with inverted optics (Nikon, Tokyo, http://www.nikon.com). One to 3 hours after nuclear transfer, reconstructed oocytes were activated for 5 hours with 10 mM Sr2  in Ca2 -free medium in the presence of 5 µg/ml of cytochalasin B. Resulting embryos were cultured to the blastocyst stage in KSOM medium (Specialty Media, Phillipsburg, NJ, http://www.specialtymedia.com). Resulting blastocysts were treated with acid Tyrode¡¯s solution to remove the zona pellucida and then cultured in ES medium supplemented with 5 x 10¨C5 M PD98059 MEK1 inhibitor (Cell Signaling Technology, Beverly, MA, http://www.cellsignal.com) on mouse embryonic fibroblasts (MEFs). Inner cell mass outgrowths were mechanically dissociated in the presence of trypsin and then replated on MEFs in ES medium.+ P! L4 b% y3 L* B5 p# k

Chimera Analysis
. q5 L- q9 h' h; w& ^
NT-derived ES cells were labeled with a ubiquitously expressed green fluorescent protein (GFP) by targeting an enhanced green fluorescent protein (eGFP)-puroR vector to the Rosa26 locus as previously described . Chimeras were produced by injecting diploid blastocysts isolated from (C57BL/6 x DBA/2 F2) crosses. Three to eight cells were injected per blastocyst before transfer into day 2.5 psuedopregnant Swiss or (C57BL/6 x DBA/2 F1) females. Chimeras were allowed to develop to adults or were isolated by laporotomy at day 14.5. Day 14.5 embryos were analyzed under fluorescence microscopy, and representative GFP-positive embryos were fixed in 10% buffered formalin for 24 hours and embedded in paraffin. Five-µm sections were cut and immunostained using an avidin-biotin immunoperoxidase technique. Primary antibody (anti-GFP; 1:1,000; Molecular Probes Inc., Eugene, OR, http://probes.invitrogen.com) was incubated overnight at 4¡ãC. Samples were subsequently incubated with biotinylated secondary antibodies (Vector Laboratories, Burlingame, CA, http://www.vectorlabs.com) for 30 minutes and then with avidin-biotin peroxidase complexes (Vector Laboratories) for 30 minutes. Diaminobenzadine was used as the chromogen and hematoxylin as the counterstain.
) y; m  I( `) P3 `' E% C! g+ ^6 H0 J
Northern and Bisulfite Sequencing
) N  [; o" c5 _! {6 t5 D' ~$ x
For Northern analysis, 10 µg per sample of total RNA isolated using Trizol (Invitrogen, Carlsbad, CA, http://www.invitrogen.com) was run in each lane and then transferred to Gene Screen (PerkinElmer Life and Analytical Sciences, Boston, http://www.perkinelmer.com). The resulting membranes were probed using cDNAs spanning the open reading frames of the corresponding genes and washed under high stringency conditions (0.2x standard saline citrate, 65¡ãC for 45 minutes) before exposure to film. Bisulfite treatment of DNA was done using the CpGenome DNA Modification Kit (Chemicon, Temecula, CA, http://www.chemicon.com) following the manufacturer¡¯s instructions. The resulting modified DNA was amplified by nested polymerase chain reaction (PCR) using two forward (F) primers and one reverse (R) primer: Oct4 (F1, GTTGTTTTGTTTTGGTTTTGGATAT; F2, ATGGGTTGAAATATTGGGTTTATTTA; R, CCACCCTCTAACCTTAACCTCTAAC) and Nanog (F1, GAGGATGTTTTTTAAGTTTTTTTT; F2, AATGTTTATGGTGGATTTTGTAGGT; R, CCCACACTCATATCAATATAATAAC). The first round of PCR was done as follows: 94¡ãC for 4 minutes; five cycles of 94¡ãC for 30 seconds, 56¡ãC for 1 minute (¨C1¡ãC per cycle), 72¡ãC for 1 minute; and 30 cycles of 94¡ãC for 30 seconds, 51¡ãC for 45 seconds, and 72¡ãC for 1 minute, 20 seconds. The second round of PCR was 94¡ãC for 4 minutes; 30 cycles of 94¡ãC for 30 seconds, 53.5¡ãC for 1 minute, and 72¡ãC for 1 minute 20 seconds. The resulting amplified products were gel-purified (Zymogen, Zymo Research, Orange, CA, http://www.zymoresearch.com), subcloned into the TOPO TA vector (Invitrogen), and sequenced using the M13F&R primers.
5 L  t  ?  t- @; o. Q; W3 h
RESULTS0 _  q, R; C/ S; J+ g- ~

Nuclear Transfer of Neural Stem Cell Lines7 `4 E$ e/ X9 b$ S1 g- R- L& [
8 I# m5 N3 t% i& `4 i' }; {
An important experimental requirement for assessing cloning efficiency is homogeneity of the donor cell population. Because no good markers are available to directly isolate NS cells from animals, we used a cell culture method that has been shown to produce and maintain a homogenous population of NS cells .! G# Y, w5 o, c* c; k0 F5 Z  U( B

We used three lines for NT: NS5, NSV65, and Cor1-5. NS5 and NSV65 were derived from differentiation in vitro of strain 129 46C ES cells ). Furthermore, the efficiency of ES cell derivation from fertilization-derived blastocysts is 50%¨C80% (R.B., Z.W., and A.M., unpublished data). We conclude that ES cell derivation is significantly more efficient following nuclear transfer of neural stem cell nuclei than with nuclei from neurons or other differentiated cell types previously tested.
! Y* a% K4 T$ m+ i
Table 1. Nuclear transfer of NS cells

Methylation of Oct4 and Nanog Promoters in NS Cells- B4 o, Y# m" s) a" ~- G# f
- k3 ^4 k' O! L" Y$ z5 |6 G
The transcription factors Oct4, Sox2, and Nanog have essential roles in early development and are required for the propagation of undifferentiated ES cells in culture . We performed Northern analysis to confirm the expression status of the three genes in NS and their corresponding NT-derived ES cells. Figure 1 shows that, as expected, the NS cells did not express Oct4 and Nanog but did express Sox2. In contrast, the NT-derived ES cells expressed all three genes.4 l: m$ `+ ~4 m( _* }: w
# @& K* N2 C" a! O
Figure 1. Oct4 and Nanog are not expressed in neural stem (NS) cells but are expressed in derivative NT ES cells. Northern analysis of Oct4, Nanog, and Sox2 expression in wild-type ES cells, NS cells, and NT-derived ES cells from the three independent neural stem cell lines, NS5, NSV6.5, and Cor1-5. Nanog shows two bands. The upper band corresponds to the expected size for the Nanog transcript. The nature of the lower band is unknown. Abbreviations: ES, embryonic stem; NSC, neural stem cell; NT, nuclear transfer; WT, wild-type.6 b8 U+ V; R7 L

Transcriptional silencing of Oct4 during differentiation has been correlated with de novo methylation of its promoter . A possible explanation for the efficient derivation of ES cells from NS cells following nuclear transplantation could be that the promoters of essential early embryonic genes such as Oct4 remain relatively hypomethylated in NS cells compared with their differentiated counterparts, thus facilitating nuclear reprogramming. We therefore investigated whether the promoters of Oct4 and Nanog were differentially methylated in NS cells relative to earlier and later stages of differentiation. For this, we performed bisulfite sequencing on DNA isolated from ES cells, NT ES cells, NS cells, and mature neural tissue. The results, depicted in Figure 2, show that both promoters were densely methylated in NS cells and adult brain relative to the wild-type and NT-derived ES cells. Therefore, the methylation status of these two promoters cannot explain the high efficiency of deriving ES cells from NS cell NT blastocysts.
. X8 F5 z1 ^) m
Figure 2. Bisulfite sequencing of the Oct4 and Nanog promoters in the three NS cell lines and NT-derived ES cells from the Cor1-5 NS cell line. Wild-type ES cells and whole adult brain are shown as controls. Differentially methylated CpG sites are depicted below the bar graphs as closed circles along the promoters of Oct4 and Nanog. Bars represent the percentage of sequence reads that showed methylation for each site. Number of reads for each line is shown in brackets. Four independent cell lines were used in the Cor1-5 analysis. Abbreviations: ES, embryonic stem; NT, nuclear transfer; WT, wild-type.! q! y4 V& B# T: ^  `

NT of Dnmt1 Hypomorphic Fibroblasts

Global demethylation is a hallmark of early development. During cleavage development of the early mouse embryo, the genome is globally demethylated and then remethylated in a stereotypical fashion . Therefore, we asked whether a global decrease of DNA methylation in the donor cell prior to nuclear transfer would improve reprogramming efficiency.5 w& y+ F4 g" f. L2 _+ R

We have previously generated a hypomorphic allele, Chip, of the DNA methyltransferase DNMT1 that, when heterozygous with a null allele of DNMT1, results in a globally hypomethylated genome . Tail tip fibroblasts were derived from Chip/null and control mice. Bisulfite sequencing of the fibroblast DNA showed partial methylation of the Oct4 promoter and little to no methylation of the Nanog promoter in Chip/null mice as compared with wild-type controls (Fig. 3). Importantly, although the nanog promoter was unmethylated, nanog was not expressed in the Chip/null fibroblasts (supplemental online Fig. 2). Nuclei from the hypomethylated and wild-type fibroblasts were transferred into enucleated oocytes and cultured to the blastocyst stage that were explanted onto MEF-coated plates and cultured to derive ES cells. Strikingly, the globally hypomethylated donor fibroblasts showed a three-fold increase in the efficiency of ES cell derivation (Table 2). This suggests that DNA hypomethylation enhances the efficiency of ES derivation from NT blastocysts, presumably by altering the epigenetic state of the genome rendering it more susceptible to the "reprogramming factors" of the egg.
: y) e; _" J! I( C- r% k
Figure 3. Bisulfite sequencing of hypomethylated (chip/c) versus wild-type fibroblasts. Abbreviation: WT, wild-type.

Table 2. Nuclear transfer of tail tip fibroblasts1 k3 V6 N5 `/ I5 p: }
2 j0 n+ h0 |, T9 V: [
Pluripotency of NT-Derived ES Cells3 S" V/ W' M& m2 g& a3 H

To confirm pluripotency of the ES lines derived following NT of NS cells and hypomethylated fibroblasts, we produced chimeric mice. ES cells derived from the cor1-5 NS cells contributed to the coat color in adult mice in five of five ES lines tested. Coat color contribution varied from approximately 10% to approximately 50% (Fig. 4A). To further test contribution to chimeras, one of the ES lines from each of the Cor1-5 NS cells and the chip/null fibroblast experiments, was targeted with an eGFP reporter gene ubiquitously expressed from the ROSA26 locus during embryonic development , injected into blastocysts, and transferred to surrogate mothers as above. None of the resulting E14.5 embryos showed GFP expression (0 of 13 embryos), confirming that unlike ES cells, the neural stem cells cannot contribute to early embryonic development. NT ES cells derived from Dnmt1 hypomorphic fibroblasts broadly contributed to E14.5 embryos (Fig. 4D¨C4F). We conclude that NT blastocysts from both NS cells and hypomethylated fibroblasts produce pluripotent ES cells at high efficiencies, similar to that seen with ES cell donors., b2 }% q, ^2 c! B( ^
0 B; e& I+ |% |2 m: B+ ~
Figure 4. NT-derived ES cells are pluripotent. NT-derived ES cells from both neural stem (NS) cell (A¨CC) and hypomethylated tail tip fibroblast (D¨CF) donors are pluripotent. Representative NT ES cell lines were targeted with a ubiquitously expressed green fluorescent protein (GFP) (R26-GFP). Resulting ES cells were injected into wild-type blastocysts to produce chimeras. Chimerism was analyzed in adults by coat color contribution (A) and anti-GFP antibody staining in E14.5 embryos. The NS cells were derived from outbred mice with white coat color and were injected into wild-type 129/B6 F2 blastocysts, which produce tan, brown, and black coat color adults. Therefore, any white coat color must derive from the NT ES cells. Darkly labeled cells represent positive GFP staining. Contribution to all three germ layers was seen including ectoderm (, liver). Abbreviations: ES, embryonic stem; NSC, neural stem cell; NT, nuclear transfer; TT, tail tip.
  G' m. ~' a1 u+ _4 d1 y
DISCUSSION
) c# n; w  z0 |& @# |' O
The results described in this paper show that the differentiation and methylation status of the donor cell nucleus can strongly influence the efficiency of deriving ES cell lines from nuclear transfer-derived blastocysts. NS cell donors produced embryonic stem cell lines at a rate of greater than or equal to 50%, which is comparable to that seen for ES and embryonal carcinoma cells  produced NT ES cell lines at a rate of
0 l! N( V- z" P6 R
Nuclear reprogramming is used here to describe the transition of the donor genome from an epigenetic state that is characteristic for the somatic cell to one that is characteristic of the early embryo. It can been assessed by evaluating abnormalities in gene expression, DNA methylation, and histone modifications in NT-derived embryos or adult clones  and this study). Therefore, the differences in the efficiencies of ES derivation from NT blastocysts described here likely reflect differences in the efficiency of reprogramming between donor epigenetic states rather than damage inherent to NT manipulations, cell cycle asynchrony, or the genetics of the donor nucleus. Furthermore, relative to full-term development of clones, the production of NT ES cells occurs in high enough numbers to make meaningful numerical comparisons possible.

During cleavage, the genome undergoes a stereotypical wave of demethylation followed by remethylation. Although it has been shown that global demethylation and histone acetylation are abnormal in cloned embryos  rather than the effect on the epigenetic state of the donor nucleus.0 X' d# E, j- a! G" M0 d7 Y

Expression of Oct4 and Nanog is essential for early embryonic development and the establishment and maintenance of ES cell lines. Oct4 often fails to be expressed appropriately following nuclear transfer . When the methylation patterns of the Oct4 and Nanog promoters were analyzed in the different cell types, we found dense methylation in both the NS cells and differentiated neural tissue, consistent with gene inactivity, in contrast to the lack of methylation and active transcription in ES cells. Thus, the higher reprogramming efficiency of NS cells did not correlate with hypomethylation of these genes. It is possible that other genes not analyzed in our present study are differentially methylated in NS versus differentiated cells. Alternatively, other types of epigenetic modification may be involved that make the promoters of Oct4, Nanog, and similar pluripotency genes more amenable to demethylation and reactivation in NS cells than neurons.4 |3 }7 [  u& Y1 x
% P4 v" _/ }' o. j. [
Early amphibian cloning experiments demonstrated an inverse correlation between developmental age of embryonic endodermal cells and cloning efficiency . It will be interesting to repeat these cloning experiments with NS cells isolated directly from animals. However, at present, no markers exist that allow for the direct purification of a homogenous population of NS cells.0 z* ~& I3 S) M2 Y. v

In this study, we have identified two parameters, the differentiation status and methylation state of the donor cell, that strongly influence the efficiency of ES cell derivation following NT. Because nuclear transfer-derived ES cells can be used to dissect mechanisms of disease , it is of practical significance to identify means of improving reprogramming efficiency. It will be important to determine whether other somatic stem cells, which are more accessible than NS cells, and alternative means of altering the epigenetic state of the donor genome would also result in more efficient reprogramming.

DISCLOSURES  p/ k/ m1 G, F8 u& E

The authors indicate no potential conflicts of interest.9 z! T5 |1 {3 T* L) W

ACKNOWLEDGMENTS+ d, `( P) U! m

We thank Rostilav Medvid for technical support and Caroline Beard and Chris Lengner for critical reading of the manuscript. R.B. was supported by a Lance Armstrong Foundation Grant and by NIH Grant K08 NS48118; A.M. was supported by a Ph.D. fellowship from the Boehringer Ingelheim Fonds; S.P. and A.S. were supported by the Biotechnology and Biological Sciences Research Council and the Medical Research Council of the U.K.; R.J. was supported by NIH Grants R37 CA84198-04 and R01 HD045022. R.B. and Z.W. contributed equally to this work. R.B. is currently affiliated with the Developmental and Stem Cell Biology Program and Department of Urology, University of California San Francisco; Z.W. is currently affiliated with Hematech, Sioux Falls, SD.4 R/ _# H+ H# M) `) Q
      【参考文献】$ q) g* q& z: S; q; y

8 a& a. ?& K8 t
Rideout WM III, Eggan K, Jaenisch R. Nuclear cloning and epigenetic reprogramming of the genome. Science 2001;293:1093¨C1098.2 Z# p# j/ K2 }9 s
& i# q$ A; f* a
Hochedlinger K, Jaenisch R. Nuclear transplantation: Lessons from frogs and mice. Curr Opin Cell Biol 2002;14:741¨C748.) w0 \& C3 y8 K& z* g6 |6 W

Hochedlinger K, Jaenisch R. Monoclonal mice generated by nuclear transfer from mature B and T donor cells. Nature 2002;415:1035¨C1038.1 O* Q5 A4 q) ^) K5 J& ~

Inoue K, Wakao H, Ogonuki N et al. Generation of cloned mice by direct nuclear transfer from natural killer T cells. Curr Biol 2005;15:1114¨C1118.: u: L$ ^: `% F4 l4 r+ E/ B* U# m9 Q
( F( `4 A$ r  R8 |* u' h
Li J, Ishii T, Feinstein P et al. Odorant receptor gene choice is reset by nuclear transfer from mouse olfactory sensory neurons. Nature 2004;428:393¨C399.
! ]: `7 f( F; B: X& A
Eggan K, Baldwin K, Tackett M et al. Mice cloned from olfactory sensory neurons. Nature 2004;428:44¨C49.

Wakayama S, Ohta H, Kishigami S et al. Establishment of male and female nuclear transfer embryonic stem cell lines from different mouse strains and tissues. Biol Reprod 2005;72:932¨C936.

Blelloch RH, Hochedlinger K, Yamada Y et al. Nuclear cloning of embryonal carcinoma cells. Proc Natl Acad Sci U S A 2004;101:13985¨C13990.
  w$ ]: x% n! S
Santos F, Zakhartchenko V, Stojkovic M et al. Epigenetic marking correlates with developmental potential in cloned bovine preimplantation embryos. Curr Biol 2003;13:1116¨C1121." n; d/ R9 F1 D6 y! f/ |2 @

Kang YK, Koo DB, Park JS et al. Aberrant methylation of donor genome in cloned bovine embryos. Nat Genet 2001;28:173¨C177.
: o( C! z  \  h/ V
Dean W, Santos F, Stojkovic M et al. Conservation of methylation reprogramming in mammalian development: Aberrant reprogramming in cloned embryos. Proc Natl Acad Sci U S A 2001;98:13734¨C13738.& A( Z9 `2 X# w  V; o  r

Bourc¡¯his D, Le Bourhis D, Patin D et al. Delayed and incomplete reprogramming of chromosome methylation patterns in bovine cloned embryos. Curr Biol 2001;11:1542¨C1546.4 i* W" |5 L1 P0 {
9 x4 `7 t4 Z7 K7 g+ x  l, B( H! |! k( ]
Bortvin A, Eggan K, Skaletsky H et al. Incomplete reactivation of Oct4-related genes in mouse embryos cloned from somatic nuclei. Development 2003;130:1673¨C1680.6 N2 J0 w7 i8 q! E" t

Boiani M, Eckardt S, Scholer HR et al. Oct4 distribution and level in mouse clones: Consequences for pluripotency. Genes Dev 2002;16:1209¨C1219.8 W6 s8 i; D0 c  R8 v! K0 ]8 D% b4 ]0 V
9 c# a% O# K7 b
Gidekel S, Bergman Y. A unique developmental pattern of Oct-3/4 DNA methylation is controlled by a cis-demodification element. J Biol Chem 2002;277:34521¨C34530.

Hattori N, Nishino K, Ko YG et al. Epigenetic control of mouse Oct-4 gene expression in embryonic stem cells and trophoblast stem cells. J Biol Chem 2004;279:17063¨C17069.

Simonsson S, Gurdon J. DNA demethylation is necessary for the epigenetic reprogramming of somatic cell nuclei. Nat Cell Biol 2004;6:984¨C990.0 ^+ w7 p' N5 P2 v7 b
3 i; K) R3 b( e; H! r" t& I
Yamazaki Y, Fujita TC, Low EW et al. Gradual DNA demethylation of the Oct4 promoter in cloned mouse embryos. Mol Reprod Dev 2006;73:180¨C188.4 J9 r! H3 W8 p

Conti L, Pollard SM, Gorba T et al. Niche-independent symmetrical self-renewal of a mammalian tissue stem cell. PLoS Biol 2005;3:e283.

Wakayama T, Perry AC, Zuccotti M et al. Full-term development of mice from enucleated oocytes injected with cumulus cell nuclei. Nature 1998;394:369¨C374.& P: F/ e8 i' e1 O0 R& B$ q! W- J

Ying QL, Smith AG. Defined conditions for neural commitment and differentiation. Methods Enzymol 2003;365:327¨C341.9 B* k: p+ j/ N0 F+ O! Q( n
0 s5 Y: a' L6 [% E/ c( d1 _
Eggan K, Akutsu H, Loring J et al. Hybrid vigor, fetal overgrowth, and viability of mice derived by nuclear cloning and tetraploid embryo complementation. Proc Natl Acad Sci U S A 2001;98:6209¨C6214.

Boiani M, Scholer HR. Regulatory networks in embryo-derived pluripotent stem cells. Nat Rev Mol Cell Biol 2005;6:872¨C884.; b* l* p0 j6 V1 o- n+ m
, X( [- t) {( r$ C- @
Santos F, Dean W. Epigenetic reprogramming during early development in mammals. Reproduction 2004;127:643¨C651.

Gaudet F, Hodgson JG, Eden A et al. Induction of tumors in mice by genomic hypomethylation. Science 2003;300:489¨C492.6 V- u7 Q' L  }( ^% l5 Z
- Z+ T- ?" h+ V4 {' A' H8 a5 {
Ventura A, Meissner A, Dillon CP et al. Cre-lox-regulated conditional RNA interference from transgenes. Proc Natl Acad Sci U S A 2004;101:10380¨C10385./ \# {3 q5 s9 B% `2 P5 T8 r

Humpherys D, Eggan K, Akutsu H et al. Epigenetic instability in ES cells and cloned mice. Science 2001;293:95¨C97.1 Z' ]- t8 [3 b4 [5 s7 o& q2 n

Humpherys D, Eggan K, Akutsu H et al. Abnormal gene expression in cloned mice derived from embryonic stem cell and cumulus cell nuclei. Proc Natl Acad Sci U S A 2002;99:12889¨C12894.' H3 K: h' f3 y2 H" L

Wakayama T, Rodriguez I, Perry AC et al. Mice cloned from embryonic stem cells. Proc Natl Acad Sci U S A 1999;96:14984¨C14989.

Campbell KH, Loi P, Otaegui PJ, Wilmut I. Cell cycle co-ordination in embryo cloning by nuclear transfer. Rev Reprod 1996;1:40¨C46.

Cibelli JB, Stice SL, Golueke PJ et al. Cloned transgenic calves produced from nonquiescent fetal fibroblasts. Science 1998;280:1256¨C1258.

Jones KL, Hill J, Shin TY et al. DNA hypomethylation of karyoplasts for bovine nuclear transplantation. Mol Reprod Dev 2001;60:208¨C213.
2 w9 u3 @! ]1 C5 `! q5 G
Enright BP, Kubota C, Yang X et al. Epigenetic characteristics and development of embryos cloned from donor cells treated by trichostatin A or 5-aza-2'-deoxycytidine. Biol Reprod 2003;69:896¨C901.
5 U1 T6 S- y; o. L+ p$ b: u* M
Enright BP, Sung LY, Chang CC et al. Methylation and acetylation characteristics of cloned bovine embryos from donor cells treated with 5-aza-2'-deoxycytidine. Biol Reprod 2005;72:944¨C948.8 X, c9 {4 v, U$ v

Gurdon JB, Uehlinger V. "Fertile" intestine nuclei. Nature 1966;210:1240¨C1241.: {9 t* h* B- K4 B

Gurdon JB. The developmental capacity of nuclei taken from intestinal epithelium cells of feeding tadpoles. J Embryol Exp Morphol 1962;10:622¨C640.0 J# a6 \% Y8 b

Briggs R, King TJ. Changes in the nuclei of differentiating endoderm cells as revealed by nuclear transplantation. J Morphol 1957;100:269¨C311.1 F' d$ F9 Z7 U6 j

Yamazaki Y, Makino H, Hamaguchi-Hamada K et al. Assessment of the developmental totipotency of neural cells in the cerebral cortex of mouse embryo by nuclear transfer. Proc Natl Acad Sci U S A 2001;98:14022¨C14026.
0 f3 I5 x& R! C! t
Do JT, Scholer HR. Comparison of neurosphere cells with cumulus cells after fusion with embryonic stem cells: Reprogramming potential. Reprod Fertil Dev 2005;17:143¨C149.3 X, \- z0 J3 M$ E, E

Pevny L, Rao MS. The stem-cell menagerie. Trends Neurosci 2003;26:351¨C359.: E1 F% S* F; A9 v' o  b0 Y# D
# U0 k7 y% f1 r. z$ e0 |: A
Hochedlinger K, Blelloch R, Brennan C et al. Reprogramming of a melanoma genome by nuclear transplantation. Genes Dev 2004;18:1875¨C1885.
( e. Q' ?% i  j) Z
Rideout WM III, Hochedlinger K, Kyba M et al. Correction of a genetic defect by nuclear transplantation and combined cell and gene therapy. Cell 2002;109:17¨C27.

收藏0 分享0 顶0 踩0