|
 
- 积分
- 429
- 威望
- 429
- 包包
- 1768
|
本帖最后由 qianqianlaile 于 2011-3-22 22:26 编辑 ( ]$ G2 `1 k' @# P
8 ?0 E, e7 k( ?6 J
MATERIALS AND METHODS
, `( H) W4 r9 O M( d l8 s0 t0 |" O; |Isolation of Dental-Derived Stem Cells (PDLSCs, SHEDs)
+ L$ V, Y* ]4 @8 `* v8 XPDLSCs and SHEDs were harvested as previously described (Miura et. al, 2003; Seo et.
& L+ u5 m& f) o( w- j# Nal, 2004). Briefly, PDLSCs were scraped from the root surface of a tooth into a p60 dish
. `. G h& W. o, O' X' Fcontaining minimum essential alpha medium (DMEM, Gibco) and SHEDs were harvested by 1 ]4 Z1 R- k& O/ H% d4 Q2 I
scraping out the dental pulp tissue from a deciduous tooth into a p60 dish containing DMEM.2 X! f- G( h4 |/ A$ ?3 z! i$ h
After collection, the cells were centrifuged at 1600 rpm for 5 minutes at room temperature. The - P! l# {3 G$ G( D: K& D* Q
supernatant was aspirated and the cells were resuspended in a phosphate buffered saline (PBS;
# D" F' ~: ^4 c/ ?/ L! I: kGibco #14190) solution with 4 mg/ml Dispase II (Roche #04 942 078 001) and 2 mg/ml6 H* l5 q I- [0 z
Collagenase Type II (Worthington # LS004196) and incubated at 37°C for 60 minutes. The ) t [8 E/ e$ f5 V/ k
enzyme solution was inactivated with 5 ml of DMEM- 15% FBS- 100µM ascorbic acid 2 / \ q) I( |: x' l# e
phosphate (ASAP, Sigma A-8960) and centrifuged at 1600 rpm for 5 minutes at room
/ S) Z$ M% w4 k$ Gtemperature. Cells were resuspeneded in 5 ml DMEM- 15% FBS- 0.1mM ASAP and transferred
) e$ l0 D1 B( A. Oto T-25 flasks. Media was changed the next day and then every 2-3 days.
7 K$ d& J5 D+ |4 S4 eCell Culture
2 K* z+ w7 f) H8 s p& f+ X Cells were expanded in culture in DMEM, Iscove’s modified Dulbecco’s media (IMDM,
- V& {9 Q+ y# F/ J+ l; s7 l: bGibco-Invitrogen #12571), Gibco Stem Pro Mesenchymal Stem Cell Serum-Free Media
6 l! d; M; }* y+ W, G(MSCSFM; Invitrogen# A1033401) or Lonza Therapeak Mesenchymal Stem Cell Growth $ A! K3 d9 i6 Q
Media- Chemically Defined (MSCGM-CD; Lonza #00190632) and grown in a 37°C humidified! R0 A7 q. B* I! n, v2 C# k& f
tissue culture incubator at 5% CO2. Media formulations are as follows: DMem (Gibco-0 p4 t7 R: i* l1 y9 t
Invitrogen #12571) with 15% FBS (Gibco-Invitrogen-16000), 100µM ASAP and 5 µg/ml
" m0 N3 w5 ]' A1 Y0 V6 \Gentamicin (Invitrogen # 15750060) (FBS-M); DMem with 2% bovine serum albumin (BSA;
5 r3 l+ f9 z) X; oSigma A7888), 10ug/ml human insulin (Sigma), 4ug/ml low density lipoprotein, 200ug/ml" D" B0 l1 M- R: ~! \
transferrin, 10 nM dexamethasone, 100 uM ASAP, 50 uM ȕ-mercaptoethanol, 5 ug/ml
$ p' L$ S! n( q0 F2 e- }- H; g' sgentamicin, 10ng/ml platelet-derived growth factor (PDGF; Sigma), 10ng/ml epidermal growth
6 d) n1 ~6 m' Z4 E( Efactor (EGF; R&D Systems), 10ng/ml basic fibroblast growth factor (b-FGF, Sigma) (SDM);
% B3 w( Q2 h4 u8 q, z# T/ Y4 O& |- ?% RIMDM with 0.2% BSA, SITE 3 (Sigma #S5295), 384µM ASAP, 10 ng/ml PDGF, 10ng/ml( X0 I8 J" O: f+ v* J
hydrocortisone 5ng/ml b-FGF, 1 ng/ml EGF, 10-7$ J7 R/ V0 N! `7 _* W3 K5 \
mgm/ml parathyroid hormone (PTH) and 5 " c; M3 }1 {- P* i& a, H$ G
µg/ml gentamicin (K-M). Media on the cells were changed every 2 or 3 days. Cells were grown
/ w* g0 Q/ h4 N3 g& C0 `! Tin T-150 flasks to about 80% confluency then media was aspirated from the flasks, cells were ! s/ g; |! J, h6 D
washed with PBS and trypsinized with TrypLE Express (Gibco#12605) before being split into 126 }( T* e- f7 j# ?6 Q1 ]
well plates for the assays.
. o! z$ ^* |' ]6 G" ^Fibronectin Coating of Tissue Culture Plates' T& U v% b) Q. Z9 p
Fibronectin (FN) was coated on the plates and flasks to provide growth and attachment- y6 j9 R2 k8 \
support for cells grown in the serum-free, IMDM media. For the 12 well plates, 0.1% FN 2 @3 k, t3 P( i+ G. g+ o I
solution (Sigma F-1141) was diluted in PBS so that each well received 3.8 micrograms per well
$ N! |- C& Y# Q' }4 U(1µg FN/cm2). The T-150 flasks were coated so that each received 150 micrograms of FN (1µg : [ E( y0 I# N, y4 A/ ^/ d
FN /cm2). The plates and flasks were tilted back and forth to ensure complete coverage of the
! s% w; V# \9 R sFN solution. The FN coating was allowed to stand at room temperature for 90 minutes. The FN , ?8 c) F4 O# J5 t4 t; }
solution was then aspirated before the resuspended cells were transferred to the flasks and plates.
$ y, B4 u: y& jProliferation Assays
" K: \% A5 t/ W& i6 d6 XAfter trypsinization cells were resuspended in an equal amount of the appropriate media( c) R$ `% r& L0 x& _4 c! V. r5 v; `
before an aliquot was removed for counting on a hemocytometer to determine the concentration.
/ M8 E& V$ D1 a5 N7 wThe cells were then centrifuged at ~1600 rpm for 5 minutes at room temperature. Cells were
% O. K9 [' q( U) J) ]. u3 V lresuspended in the appropriate media at a concentration of 3800 cells per ml. One milliliter of
4 i8 C0 D6 s% X1 ~% {- z$ r( mcells was dispensed into each well of a 12 well plate. K-M plates were precoated with FN # M6 W7 S1 |, c+ ? }' \/ E. Y7 {% P
solution (as outlined above). Four plates for each cell type and media condition were plated and ; i! _- c) H) v4 x
counted on a hemocytometer at days 1, 3, 5 and 7 to determine the cell numbers within each
1 p- R, S& M% R; a0 T& B2 P2 f) u9 W1 Iwell. All experiments were performed in triplicate. " a. A' a# Q7 w; j# M! b
RNA Isolation and Purification for MicroArray 4 o6 {* ~. A) M3 w; X3 Y5 J
PDLSCs and SHEDs were grown in T-75 flasks to 80% confluency before the cells were / \7 W1 z- o4 y/ A: S- O+ ^5 b V
harvested for RNA. The Trizol method (Invitrogen) was used for RNA isolation. This involved
5 a$ k1 ~3 W7 L K- i% |$ n4 xwashing the cell layer with PBS, adding Trizol directly to the cells and transferring this cell
, y/ V1 `2 \6 S( T1 z: Ssuspension to polypropylene tubes. RNA was isolated from the cells by a Trizol-choloroform, n7 U5 H) D9 L
extraction, isopropanol precipitation, an ethanol rinse and resuspension of theRNA pellet in
8 @- v3 l r, v$ X' ]Diethylpyrocarbonate (DEPC) water. The RNA was further purified by column
- ^. K9 Z5 n. s; h! Nchromatography, following manufacturer’s instructions (Qiagen RNeasy Kit # 74104), and
/ F e; f: m" a& l% yresuspended in DEPC water. RNA concentration was determined by the 260/280 absorbance 9 s6 B1 U- K7 Z% A7 U# V2 a
measurement using a Beckman DU540 spectrophotometer.
" R0 C8 k9 G+ T+ n2 [In Vitro Multilineage Differentiation
9 s/ F* ^& ~/ gMultipotency of PDLSCs and SHEDs was determined through lineage specific
$ l! |# W* u( d# |( h! B3 Yosteogenic, chondrogenic, and adipogenic induction, according to previously described methods
4 X+ K' y( f7 M4 i(Pittenger et. al, 1999). Briefly, cells were plated at a density of 30,000 cells per well in 12 well
7 ]( R1 \! e8 W! C; G0 Fplates. At 80% confluency cells were induced with osteogenic [Growth media plus 5mM E- W' z1 t8 M) {. I( V" ]3 g
glycerophosphate, 100nM dexamethasone, 50µM ascorbic acid 2-phosphate] or chondrogenic 4 m9 E' D$ V+ i
[growth media plus 50µM ascorbic acid 2-phosphate, 100nM dexamethasone, 5 µg/ml human
( R0 t: p. u4 e7 `0 n8 ]5 jinsulin (Sigma I-9278), 1 ng/ml TGFE, 400µM proline, 1X Non essential amino acids] or
+ p' u" h _% \: L8 m8 fadipogenic [growth media plus 0.5mM IBMX, 1 µM dexamethasone, 10 µg/ml human insulin, ' i" |; A& f; H( A" M- P
200µM indomethacin] induction media. Cells were grown at 37°C in a humidified 5% CO2; m2 w7 I. g6 u+ K( W
incubator. The media was changed every 2-3 days. At three weeks the cells were fixed and : N; G" {8 ]3 `" B* p4 M
stained as outlined below. 2 J% p2 x9 L7 t$ l2 v! \" u0 @: U
Multipotent Staining of PDLSCs and SHEDs
# U7 @* _ G# I" m% Y% N1 _% _To identify the mineralized nodules, induced PDLSC, SHED and DPSC were fixed in 4% , H, q$ b" i$ c+ |, p3 I/ z; c
paraformaldehyde for 30 minutes, immersed in fresh 5% silver nitrate and incubated in the dark , Z0 Z5 Y' Y% A# c3 v
for 30 minutes. After washing in water the PDLSC, SHED and DPSC were exposed to 8 t3 ]1 k2 W" L. E
ultraviolet light for 30 minutes followed by a four minute incubation in 1% sodium thiosulfate to 2 y& w# l: }$ ~- ?) p) K, `
neutralize the silver nitrate. Cells were washed twice with water before 1 ml of PBS was added & n/ a- C7 Z! }- ^# q" n
to each well and viewed. Plates were stored at 4°C.
3 c2 z# M% M' Y0 y* u0 m& Q4 UTo detect chondrogenic differentiation induced PDLSC, SHED and DPSC were fixed in
n Y/ N H% e% W& tcold 100% methanol for 30 minutes and then exposed to 1% alcian blue in 0.1N HCl for 30
8 P7 H2 z% @' _- M4 lminutes. Cells were washed twice with 0.1N HCl before 1 ml of PBS was added to each well 9 W- s3 U) V' E- ^) F3 B/ C" m# h! r
and viewed. Plates were stored at 4°C.9 d; s3 e5 M( `1 Z
To detect adipogenic differentiation by identifying lipid vesicles, induced PDLSC, SHED
# P; `! O7 k: jand DPSC were fixed in 4% paraformaldehyde for 30 minutes, and then immersed in 0.3% oil
" |' t- b. o& J( vred O solution for 30 minutes. Cells were washed twice with water before 1 ml of PBS was ! P; P8 C0 E* u, _, p0 ~
added to each well and viewed. Plates were stored at 4°C. ' r" m! ~/ U( x5 k# `
Alkaline Phosphatase Activity and Detection
' J! ^2 z+ l! g6 u* x# h* JEarly osteogenic differentiation was detected and quantified by the alkaline phosphatase
8 Y* k+ d4 `$ Y) L+ x(ALP) enzyme assay. Cells were plated at a density of 30,000 cells per well in 12 well plates.9 n/ [/ _( M S. Z' \
At 80% confluence, cells were induced with osteogenic media as described above. The media2 l. e9 Z4 M& A
was changed every 2-3 days and after one week, ALP activity was measured.- l! `/ }' a. p) z, \+ Z3 v9 a) M& c
To detect phosphatase activity, PDLSCs and SHEDs were fixed in 70% ethanol for 30 # m. X5 B7 @9 [5 c/ z+ D! q
minutes. They were then incubated with freshly made substrate containing naphthol AS-TR ) i* p, z8 s4 f$ K7 Z# o& k
phosphate (Sigma) and Fast blue (Sigma) for 30 minutes. Cells were washed twice with PBS then
- |/ @2 t+ ?" {0 s8 U; Dviewed or stored at 4’C.; t' P K" Y' u' |7 H
To quantify the ALP activity and normalize the results, cells were lysed in Passive Lysis * M& b% B* p7 U; R& R
Buffer (Promega) according to manufacturer’s instructions. Cell lysates were then sonicated, # _1 P2 h" f) N4 X6 ]2 {
and centrifuged (10,000 rpm for 10 minutes at 4°C). The supernatant was recovered for the
, l! E1 _, c* @, Z& |2 I$ u5 Hquantitative colormetric ALP assay (Manolagas et al., 1981) and the cell pellet was used for
4 ~/ B- z9 a" S9 W/ S ], vDNA isolation and the determination of the DNA concentration using the Quant-iT™ dsDNA
) w: P+ B8 E [/ d" G8 n) u/ V- cBR Assay (Invitrogen) per the manufacturer’s instructions.
6 U4 _5 t z N0 iReverse Transcriptase Polymerase Chain Reaction (RT-PCR) * B) s. u- M4 }! c2 w
To confirm chondrogenic and adipogenic differentiation, total PDLSC and SHED cellular 6 C ^# K: b/ |. y
RNA was extracted, reverse transcribed, and amplified using osteoblast specific gene primers.7 {+ s, n( V7 ^( R; ~- j
Media from the wells of induced and uninduced PDLSCs and SHEDs were aspirated. Cells , v$ F/ G7 B6 w% N- K. N
were immediately resuspended in 1 ml of Trizol (Invitrogen) and RNA was isolated according to ( z. w' A2 W; M1 I4 s
the manufacturer’s instructions. Synthesis of cDNA was performed using Invitrogen’s 6 H' }( x, K G- D
SuperScriptII kit and oligo dT. PCR reaction components and concentrations were as described
, S$ P' R! h4 bin the Invitrogen Platinum Taq polymerase instructions using the primer sets below. An MJ 7 V( \) M1 e# o7 U
themorcycler was used for the following two PCR reaction conditions:
5 P3 M5 @! _1 n*94°C 2 minutes [94°C 45” 56°C 45” 72°C 1’] X 35 cycles 72°C 15’ 2 U( s, \5 E+ A& P% b o$ B* u1 P
or! n5 j, S, l* F& S
**94°C 2 minutes [94°C 45” 67°C 45” 72°C 1’] X 35 cycles 72°C 15’
( R% P$ A6 Z0 x1 j8 fPCR Primer Pairs 3 a7 D1 M2 V4 f, _
Primer Name Primer Sequence Product% y7 ~8 x( S! N- h! I1 o7 N
Size f A W! c6 P: F, a
Accession
' M4 x4 Z J4 o7 o, t C6 qNumber
: V- l2 }; j5 m- t8 o*GAPDH FWD AGCCGCATCTTCTTTTGCGTC 815 bp NM_002046
1 J" q. E$ d, ]0 i* a- `% h+ Z*GAPDH REV TCATATTTGGCAGGTTTTTCT% [; }" K9 |( p# N7 ]
PPARJ2 FWD GCTGTGCAGGAGATCACAGA 226 bp NM_005037/ C1 Y/ F6 L/ ?3 a6 ?
PPARJ2 REV GGGCTCCATAAAGTCACCAA
1 Q2 B# w9 E! d; ]Lipoprotein lipase FWD GTCCGTGGCTACCTGTCATT 212 bp NM_000237
( I" _6 g! o) B, vLipoprotein lipase REV TGTCCCACCAGTTTGGTGTA
0 ^- o0 S2 U/ U' _: U' ZSox 9 FWD TTGAGCCTTAAAACGGTGCT 224 bp NM000346
5 n$ b: z* u# f7 D( a3 ~Sox 9 REV CTGGTGTTCTGAGAGGCACA- y1 l: V4 O% v2 s
Type X collagen FWD TGAGCAGCAACGTAAAAACG 471 bp NM_00049
. H/ q, S1 g7 X0 Z- NType X collagen REV AGGAAATGCCGAGTTTCTCA7 G; ~1 u8 W& s. p$ d
Statistical Analysis
1 N& W/ S' C- e/ tStatistical analysis was performed with the use of Instat software (GraphPad Software, San
" g6 j1 m7 M5 [Diego, CA, USA). All data were plotted as mean ± standard error of the mean (SEM), unless 3 e3 g/ {; f, m6 E% ~
otherwise noted. Statistically significant differences were determined by two-tailed Student t
& z; j2 w- M. w: R4 v" |8 Ztests, and statistical significance was defined as p < 0.05. |
|
发表于 2011-3-21 23:02
