|
 
- 积分
- 429
- 威望
- 429
- 包包
- 1768
|
本帖最后由 qianqianlaile 于 2011-3-22 22:26 编辑
x( C2 L& l5 z$ ]0 E% N& m9 C F0 n! e3 x
MATERIALS AND METHODS
5 `3 `' i- v# }# v# i4 } l! ZIsolation of Dental-Derived Stem Cells (PDLSCs, SHEDs) 6 P1 q4 `% m. T& X% ]
PDLSCs and SHEDs were harvested as previously described (Miura et. al, 2003; Seo et.
! H$ G8 }3 D" L( I+ [" tal, 2004). Briefly, PDLSCs were scraped from the root surface of a tooth into a p60 dish % y& Q& r2 B4 Q3 S
containing minimum essential alpha medium (DMEM, Gibco) and SHEDs were harvested by
( H; \5 K0 q6 [! Mscraping out the dental pulp tissue from a deciduous tooth into a p60 dish containing DMEM.) \: l( D3 }0 I3 Y
After collection, the cells were centrifuged at 1600 rpm for 5 minutes at room temperature. The
4 J) h: [/ J# G; u7 f% G+ g7 |supernatant was aspirated and the cells were resuspended in a phosphate buffered saline (PBS; / b6 ^/ x) f9 M( J: J
Gibco #14190) solution with 4 mg/ml Dispase II (Roche #04 942 078 001) and 2 mg/ml- J+ C" M, ^7 I. c) p9 X
Collagenase Type II (Worthington # LS004196) and incubated at 37°C for 60 minutes. The
( E* T% C3 V( Y! z1 S( |0 Penzyme solution was inactivated with 5 ml of DMEM- 15% FBS- 100µM ascorbic acid 2 + [3 a3 N% ^: V6 V1 D' H3 ~
phosphate (ASAP, Sigma A-8960) and centrifuged at 1600 rpm for 5 minutes at room
, U# p- Y4 m* y/ e8 N9 C% ctemperature. Cells were resuspeneded in 5 ml DMEM- 15% FBS- 0.1mM ASAP and transferred
# J0 S* P( P ]2 h3 {to T-25 flasks. Media was changed the next day and then every 2-3 days.
/ y" e& P; |5 r/ S- W" i1 S- NCell Culture0 S# P- F& h/ U; D$ Z0 h
Cells were expanded in culture in DMEM, Iscove’s modified Dulbecco’s media (IMDM, + x* v( \0 @, l1 w$ h1 d
Gibco-Invitrogen #12571), Gibco Stem Pro Mesenchymal Stem Cell Serum-Free Media
( F" I! X4 B/ p7 m(MSCSFM; Invitrogen# A1033401) or Lonza Therapeak Mesenchymal Stem Cell Growth
& i$ o# H: `1 D2 l) oMedia- Chemically Defined (MSCGM-CD; Lonza #00190632) and grown in a 37°C humidified
9 r$ s6 D4 {. dtissue culture incubator at 5% CO2. Media formulations are as follows: DMem (Gibco-- ~" ~& o% _7 A6 l# m
Invitrogen #12571) with 15% FBS (Gibco-Invitrogen-16000), 100µM ASAP and 5 µg/ml
; h9 {( h+ Q! O3 Y8 j" DGentamicin (Invitrogen # 15750060) (FBS-M); DMem with 2% bovine serum albumin (BSA; 9 w1 p" f8 J- |' T$ K! [: s1 B4 v
Sigma A7888), 10ug/ml human insulin (Sigma), 4ug/ml low density lipoprotein, 200ug/ml
6 e' S; M& t) E. ntransferrin, 10 nM dexamethasone, 100 uM ASAP, 50 uM ȕ-mercaptoethanol, 5 ug/ml( _! W3 r, F- `5 k
gentamicin, 10ng/ml platelet-derived growth factor (PDGF; Sigma), 10ng/ml epidermal growth : p H& X) j: }
factor (EGF; R&D Systems), 10ng/ml basic fibroblast growth factor (b-FGF, Sigma) (SDM);3 P7 u7 W9 g3 b: D2 j. F$ Z- K
IMDM with 0.2% BSA, SITE 3 (Sigma #S5295), 384µM ASAP, 10 ng/ml PDGF, 10ng/ml
; r2 u- x3 ^- `) a" B- Q* ~$ Y' xhydrocortisone 5ng/ml b-FGF, 1 ng/ml EGF, 10-7: d' l; t: [. S: b
mgm/ml parathyroid hormone (PTH) and 5 w, Q+ {( v; y& x& N# e9 ^# K
µg/ml gentamicin (K-M). Media on the cells were changed every 2 or 3 days. Cells were grown! ?2 z) J7 D; Q: F# g' E" l
in T-150 flasks to about 80% confluency then media was aspirated from the flasks, cells were . @# d% j% `" r0 f" {
washed with PBS and trypsinized with TrypLE Express (Gibco#12605) before being split into 12
/ w. v. A# |/ {. N$ `2 p) W$ {. dwell plates for the assays.
% s. }3 I' W6 p! D2 n4 YFibronectin Coating of Tissue Culture Plates/ v; N; k6 t4 B% l
Fibronectin (FN) was coated on the plates and flasks to provide growth and attachment6 `* X% ~4 H& ~0 {& J/ l S
support for cells grown in the serum-free, IMDM media. For the 12 well plates, 0.1% FN
* p4 K U* T M% G e4 G% f9 |( {solution (Sigma F-1141) was diluted in PBS so that each well received 3.8 micrograms per well
5 B8 `3 ~- {) U(1µg FN/cm2). The T-150 flasks were coated so that each received 150 micrograms of FN (1µg + d; @" ~+ N7 s+ ^. g
FN /cm2). The plates and flasks were tilted back and forth to ensure complete coverage of the 8 W4 ^# i6 Q# g! r0 M4 s
FN solution. The FN coating was allowed to stand at room temperature for 90 minutes. The FN
! A& ~6 T: Z( R% N5 esolution was then aspirated before the resuspended cells were transferred to the flasks and plates.3 [. r7 O& I$ {8 N" \: y
Proliferation Assays4 Z) @1 ^8 ^. w
After trypsinization cells were resuspended in an equal amount of the appropriate media7 w. L( J7 w- p
before an aliquot was removed for counting on a hemocytometer to determine the concentration.
( u0 S6 q" L* \; b% A# QThe cells were then centrifuged at ~1600 rpm for 5 minutes at room temperature. Cells were d' C3 x$ @! W0 p+ e
resuspended in the appropriate media at a concentration of 3800 cells per ml. One milliliter of
& _* A% E V+ c3 V0 t( M( ^% `cells was dispensed into each well of a 12 well plate. K-M plates were precoated with FN
$ k$ w3 z4 f5 l6 g! l3 @solution (as outlined above). Four plates for each cell type and media condition were plated and 9 d. T+ F2 e1 x+ A8 t$ F
counted on a hemocytometer at days 1, 3, 5 and 7 to determine the cell numbers within each 2 o9 n' T& Z' M2 Q$ V" I
well. All experiments were performed in triplicate.
: l; y6 r1 o0 C4 bRNA Isolation and Purification for MicroArray
! \( n( p" K7 u l/ ]+ o6 MPDLSCs and SHEDs were grown in T-75 flasks to 80% confluency before the cells were 0 M/ m* F! K2 v+ o1 a; T! Z- F
harvested for RNA. The Trizol method (Invitrogen) was used for RNA isolation. This involved 0 W- R5 Q- D# x% i1 U
washing the cell layer with PBS, adding Trizol directly to the cells and transferring this cell
) h8 \& ]- _# C, Fsuspension to polypropylene tubes. RNA was isolated from the cells by a Trizol-choloroform
# u) i% \, P6 h# R+ \extraction, isopropanol precipitation, an ethanol rinse and resuspension of theRNA pellet in
. v! ^6 _" B* V* A" T# k1 dDiethylpyrocarbonate (DEPC) water. The RNA was further purified by column' _% x' g* z- L* P' G6 R* F O
chromatography, following manufacturer’s instructions (Qiagen RNeasy Kit # 74104), and
' X( ^ V0 C+ fresuspended in DEPC water. RNA concentration was determined by the 260/280 absorbance
7 h6 X* h- n7 `, V) lmeasurement using a Beckman DU540 spectrophotometer.
/ U0 i/ V m. L/ n" E$ d* zIn Vitro Multilineage Differentiation
- X( u; d- F8 {Multipotency of PDLSCs and SHEDs was determined through lineage specific ; G% P' T" v% R4 e, _
osteogenic, chondrogenic, and adipogenic induction, according to previously described methods
5 l( g& B3 M, J(Pittenger et. al, 1999). Briefly, cells were plated at a density of 30,000 cells per well in 12 well r5 ^! ~! D+ a* Z6 J! w
plates. At 80% confluency cells were induced with osteogenic [Growth media plus 5mM E-: |7 f; w S5 c) p6 E0 k9 F+ X, w
glycerophosphate, 100nM dexamethasone, 50µM ascorbic acid 2-phosphate] or chondrogenic
: y# ?* p. k) @( \1 z[growth media plus 50µM ascorbic acid 2-phosphate, 100nM dexamethasone, 5 µg/ml human
3 T* ~$ F' p$ X5 C: E" Yinsulin (Sigma I-9278), 1 ng/ml TGFE, 400µM proline, 1X Non essential amino acids] or - E$ x! c5 t) b' R: @
adipogenic [growth media plus 0.5mM IBMX, 1 µM dexamethasone, 10 µg/ml human insulin,
' g7 `' H4 {$ N. w8 g200µM indomethacin] induction media. Cells were grown at 37°C in a humidified 5% CO2
; N; F( [0 K5 N$ Z+ N4 dincubator. The media was changed every 2-3 days. At three weeks the cells were fixed and
" X* y9 j1 c% O4 @+ Qstained as outlined below.
. N& [' ~5 ]2 k4 g6 ?" ZMultipotent Staining of PDLSCs and SHEDs 6 w% I; o& C/ r' }$ S7 Z: O% Z
To identify the mineralized nodules, induced PDLSC, SHED and DPSC were fixed in 4% - r7 w$ w) o2 O, C- s9 N
paraformaldehyde for 30 minutes, immersed in fresh 5% silver nitrate and incubated in the dark L" t) P- g- z7 y
for 30 minutes. After washing in water the PDLSC, SHED and DPSC were exposed to % y5 p. r# _" ?1 }5 A
ultraviolet light for 30 minutes followed by a four minute incubation in 1% sodium thiosulfate to 9 {! ]) ~1 N P1 B2 ~
neutralize the silver nitrate. Cells were washed twice with water before 1 ml of PBS was added 0 d; C8 j1 I6 ~' w; F. h
to each well and viewed. Plates were stored at 4°C.
6 O+ \% |$ m9 J2 O: s* a! `To detect chondrogenic differentiation induced PDLSC, SHED and DPSC were fixed in
( Z( S# J. A* Ncold 100% methanol for 30 minutes and then exposed to 1% alcian blue in 0.1N HCl for 30 / P" c/ c' T* P: ?* O1 [
minutes. Cells were washed twice with 0.1N HCl before 1 ml of PBS was added to each well % b# P; @! S0 D
and viewed. Plates were stored at 4°C.
, z% q4 J) P+ ]7 Y8 E* ?To detect adipogenic differentiation by identifying lipid vesicles, induced PDLSC, SHED 8 R) n; M" Q# ]8 V: W9 g
and DPSC were fixed in 4% paraformaldehyde for 30 minutes, and then immersed in 0.3% oil
4 T- o0 Q5 ~/ a0 r7 ~* B5 W6 Ured O solution for 30 minutes. Cells were washed twice with water before 1 ml of PBS was & Y0 R7 ]% ^8 W) D9 y, j& T
added to each well and viewed. Plates were stored at 4°C.
! h! W7 W" J, h+ ^2 KAlkaline Phosphatase Activity and Detection
$ ~- e) S- o, m# j/ S- D) gEarly osteogenic differentiation was detected and quantified by the alkaline phosphatase
, b& |: j0 F# d0 B# X1 I(ALP) enzyme assay. Cells were plated at a density of 30,000 cells per well in 12 well plates., Q3 J$ N* B) N6 T2 [" U3 ]/ u6 [. F
At 80% confluence, cells were induced with osteogenic media as described above. The media+ I0 s2 Q! S4 A) S4 ]
was changed every 2-3 days and after one week, ALP activity was measured.
3 I% v# P& \/ D' h9 \To detect phosphatase activity, PDLSCs and SHEDs were fixed in 70% ethanol for 30 6 ^( B, [% `+ c5 k* J# T0 Q
minutes. They were then incubated with freshly made substrate containing naphthol AS-TR : _% B& P, D4 Y, w6 m0 X ]7 }
phosphate (Sigma) and Fast blue (Sigma) for 30 minutes. Cells were washed twice with PBS then
P1 v2 ^, c2 @# X' eviewed or stored at 4’C.
/ x. h; Q: g( D5 ZTo quantify the ALP activity and normalize the results, cells were lysed in Passive Lysis / s0 Q& s9 V1 C6 X+ ^
Buffer (Promega) according to manufacturer’s instructions. Cell lysates were then sonicated,
, E& l8 g" C5 R1 ^/ l: vand centrifuged (10,000 rpm for 10 minutes at 4°C). The supernatant was recovered for the
1 t! u" i% _& hquantitative colormetric ALP assay (Manolagas et al., 1981) and the cell pellet was used for / Q' ?+ D4 c6 W1 V# ^' n
DNA isolation and the determination of the DNA concentration using the Quant-iT™ dsDNA 9 d" B& U; |' g! D0 z9 X
BR Assay (Invitrogen) per the manufacturer’s instructions.
4 g) S( b* S: aReverse Transcriptase Polymerase Chain Reaction (RT-PCR)
5 g3 |( F7 j8 {5 j8 Y, xTo confirm chondrogenic and adipogenic differentiation, total PDLSC and SHED cellular
. I1 H3 K: o9 G6 H5 b+ H3 oRNA was extracted, reverse transcribed, and amplified using osteoblast specific gene primers.
9 v; Q" t8 C' cMedia from the wells of induced and uninduced PDLSCs and SHEDs were aspirated. Cells . ^' k2 {3 |) |
were immediately resuspended in 1 ml of Trizol (Invitrogen) and RNA was isolated according to , m. `( q$ ^0 t" J3 Y
the manufacturer’s instructions. Synthesis of cDNA was performed using Invitrogen’s ( O3 E( R6 A9 P2 H* K1 ?$ M1 t
SuperScriptII kit and oligo dT. PCR reaction components and concentrations were as described . _% [! D, v# z! f2 {
in the Invitrogen Platinum Taq polymerase instructions using the primer sets below. An MJ 7 f; N5 N+ I' Z) q& h
themorcycler was used for the following two PCR reaction conditions: % x; A+ `' [. t# p( x6 t3 g% m
*94°C 2 minutes [94°C 45” 56°C 45” 72°C 1’] X 35 cycles 72°C 15’
$ o% R4 d( Q7 E3 q7 Eor
- |2 o* z0 g) S' _* s. b6 p**94°C 2 minutes [94°C 45” 67°C 45” 72°C 1’] X 35 cycles 72°C 15’
6 I- {0 F6 Y+ K8 {) O8 P& B4 {PCR Primer Pairs * W0 d1 }/ E9 \5 B) P7 x( \
Primer Name Primer Sequence Product( }* ?& Y$ K! f
Size* V5 o& [3 Y l* j9 ^: a5 D9 w
Accession
6 B! E" i0 \" A# ^Number; v3 J, V2 l' Z: `! U& V0 f
*GAPDH FWD AGCCGCATCTTCTTTTGCGTC 815 bp NM_0020463 H+ V9 g+ f8 Z) G3 C, r7 j
*GAPDH REV TCATATTTGGCAGGTTTTTCT
) L- {! |8 u! ?* e: }PPARJ2 FWD GCTGTGCAGGAGATCACAGA 226 bp NM_005037
, `: p8 S/ N- u8 e0 N7 `PPARJ2 REV GGGCTCCATAAAGTCACCAA# O' ~2 |3 R e8 x
Lipoprotein lipase FWD GTCCGTGGCTACCTGTCATT 212 bp NM_000237* z$ @% _, y% n. z: j) _) M
Lipoprotein lipase REV TGTCCCACCAGTTTGGTGTA0 y, D+ ?- i' v2 ]8 l/ h* `* ?" a8 J
Sox 9 FWD TTGAGCCTTAAAACGGTGCT 224 bp NM0003467 R2 \7 U1 I7 [1 Z4 m( h
Sox 9 REV CTGGTGTTCTGAGAGGCACA* s, C5 y+ t& ~+ A$ U# R4 c5 v: D
Type X collagen FWD TGAGCAGCAACGTAAAAACG 471 bp NM_000497 `! ?* e# b4 \3 b- i
Type X collagen REV AGGAAATGCCGAGTTTCTCA: t7 y7 a5 p8 t3 S3 o
Statistical Analysis
4 ~& y" v% J& `" B* [: _$ D7 yStatistical analysis was performed with the use of Instat software (GraphPad Software, San 1 |, {7 \+ o* [5 r9 Z M
Diego, CA, USA). All data were plotted as mean ± standard error of the mean (SEM), unless
3 I, w* c5 i. O+ lotherwise noted. Statistically significant differences were determined by two-tailed Student t
% C( [5 ~) ]/ Z8 ftests, and statistical significance was defined as p < 0.05. |
|
发表于 2011-3-21 23:02
