Characterization of the Potential Subpopulation of Bone Marrow Cells Involved in - 《stemcells》干细胞学杂志干细胞之家



免疫细胞治疗专区	欢迎关注干细胞微信公众号

12 3 4 5 6 7 8 9 10 ... 26 下一页

返回列表

查看: 368088\|回复: 254	go Characterization of the Potential Subpopulation of Bone Marrow Cells Involved in [复制链接]

江边孤钓

版主

Rank: 7 Rank: 7 Rank: 7

积分: 0
威望: 0
包包: 483

楼主

发表于 2009-3-5 00:53 |只看该作者 |倒序浏览 |打印

作者：Satish Khurana, Asok Mukhopadhyay作者单位：Stem Cell Biology Laboratory, National Institute of Immunology, New Delhi, India 5 R$ U3 e7 j8 m' v' |
   ! t5 s/ U! a9 w' a) j! _

      9 U+ m: B' E& F: M# S* U
                     1 n' L# F; u0 D" K
         * Y7 [5 x* c; ]: s3 ~' y

         # u0 m# M2 N% I


      + O1 F+ I" U6 U1 j( K


      【摘要】
   In vitro and in vivo studies have shown that bone marrow (BM) stem cells can differentiate into hepatocytes. However, it is not known whether such a differentiation event occurs during normal liver regeneration process. We investigated the role of endogenous BM cells in liver regeneration following acute injury and phenotypically characterized them. We showed that Lin¨CSca-1  cells proliferate in the BM and subsequently mobilize in the peripheral blood in response to liver injury by CCl4 or an injury simulating condition. In vitro studies confirmed that the damaged liver tissue was capable of inducing migration of a distinct population of BM cells, phenotypically characterized as Lin¨CCXCR4 OSMR¦Â , which can differentiate into albumin and cytoketarin-18 expressing cells. In order to study the migration of BM cells to the regenerating liver, the hematopoietic system was reconstituted with green fluorescent protein (GFP)  BM cells by intra-bone marrow transplantation prior to liver damage. The BM-derived cells were found to express hepatocyte-specific genes and proteins in the regenerating liver. Quantitative polymerase chain reaction analysis for a recipient specific gene (sry) in sorted GFP Alb  donor cells suggested that fusion was a rare event in this experimental model. In conclusion, we first demonstrated the potential phenotype of BM cells involved in regeneration of liver from acute injury, primarily by the process of direct differentiation.) o" A+ i" F; L( p

Disclosure of potential conflicts of interest is found at the end of this article. & j3 M/ Q& z) w0 {: s' h7 ?8 s9 S
      【关键词】 Bone marrow cells Migration Hepatocyte differentiation Quantitative polymerase chain reaction Tissue regeneration1 y0 s' E" a+ I+ `/ N
   INTRODUCTION/ Z5 D7 t& C. `1 M
. F. n. W( d, f8 X2 }1 ?
During mid to late stages of gestation, fetal liver acts as the major site of hematopoiesis in mice  it was shown that liver epithelium can be generated from BM cells without fusion, these studies precluded phenotypic characterization of the cells and their involvement in the liver regeneration model.
& y/ n! L4 z& ]: ]
In this study, we have explored (a) the function of endogenous BM cells in liver regeneration following acute injury, (b) the potential BM subpopulation responsible for such regeneration, and (c) whether BM cells directly differentiate into hepatocytes in the regenerating liver. We adopted the CCl4-induced acute liver injury model described by others . Our preliminary in vitro studies show that a distinct subset of Lin¨C BM cells, coexpressing CXCR4 and oncostatin M receptor ¦Â (OSMR¦Â), with/without stem cell antigen-1 (Sca-1), respond to the liver injury simulating condition. In order to comprehend the migration of cells from BM to the damaged liver, we transplanted green fluorescent protein (GFP)  cells directly in the BM before damaging the liver. We demonstrated that endogenous BM cells migrate specifically to the damaged liver, where they differentiate into albumin and cytokeratin (CK)-18 expressing hepatocytes. Furthermore, by real-time quantitative polymerase chain reaction (PCR) for the recipient-specific gene sry, we confirmed that the conversion of BM-derived cells into hepatocytes was primarily independent of fusion.
% ]9 z2 ?( n! N4 _/ c2 I" t
MATERIALS AND METHODS

Animals) o  L7 `, U. b9 S5 J( R
7 d4 W, N( J/ W/ h' G  K
Six to ten-week-old C57BL6/J, GFP transgenic mice (FVB.Cg-Tg 5NAGY/J) and FVB/NJ mice were used in this investigation. Mice were obtained from the Jackson Laboratory (Bar Harbor, ME, http://www.jax.org) and maintained in the institute's experimental animal facility. During the experiments, mice were kept in an isolator and fed with autoclaved acidified water and irradiated food ad libitum. All experiments using mice were conducted as per procedures approved by the Institutional Animal Ethics Committee.
. }) v8 u+ J8 s; i8 ]
Liver Damage and Collection of Sera
# A, W; _1 S) r, I) x1 x
Mice were given one injection of either 200 µl of mineral oil (control) or 10% solution of CCl4 via intraperitoneal route . Mice were euthanized at different time intervals to collect BM and peripheral blood (PB) cells. To collect sera, two groups of mice (n = 20) were taken; the first group was given one injection of mineral oil (200 µl) and the other group received CCl4, as above. Serum was collected 24 hours after injection, and the pooled serum was termed as normal serum (NS) (mineral oil injected mice) or damaged liver serum (DLS) (CCl4 injected mice).- I: {8 n$ c2 V2 t/ h

Cell Migration Assay  n% D; h" e9 n( d
. A, A; g+ o0 i* E- ^
In vitro cell migration assay was conducted using a Falcon cell culture insert (Becton, Dickinson and Company, Franklin Lakes, NJ, http://www.bd.com) fitted on a 24-well tissue culture plate. The insert had a 0.3-cm2 membrane with 5-µm pores at the bottom. Twenty-four hours after the liver damage with CCl4, a small piece of the same liver tissue was placed on one side of the lower companion well containing 1 ml of Iscove's modified Dulbecco's medium (IMDM) supplemented with 10% DLS. GFP  whole BM or PKH-26 labeled  Lin¨C BM cells were used as test cells for migration studies. One hundred thousand cells in 200 µl of IMDM were loaded on the insert, and the cells were allowed to migrate for 3 hours across the membrane. The migrated cells were analyzed by surface staining for lineage markers Sca-1, CXCR4, and OSMR¦Â by flow cytometry and immunocytochemistry. Lineage antibody cocktail was purchased from Miltenyi Biotec (Bergisch Gladbach, Germany, http://www.miltenyibiotec.com), anti-Sca-1 and anti-CXCR4 antibodies from BD Pharmingen (San Diego, http://www.bdbiosciences.com/index_us.shtml), and anti-OSMR¦Â from R&D Systems Inc. (Minneapolis, http://www.rndsystems.com). To study hepatic differentiation potential, the migrated cells as a whole and their OSMR¦Â  fraction and Lin¨CCXCR4 OSMR¦Â  cells from BM were cultured in the presence of 10% DLS for 3 days. Prior to culture, plates were coated with a mixture of gelatin (10 mg/ml), laminin (50 µg/ml), and hyaluronic acid (100 µg/ml). The cultured cells were examined for the expression of albumin (Nordic Immunological Laboratories, Tilburg, The Netherlands, http://www.nordiclabs.nl) and cytokeratin-18 (Santa Cruz Biotechnology Inc., Santa Cruz, CA, http://www.scbt.com) by immunocytochemical analysis. Before staining of intracellular proteins, cells were fixed using 4% paraformaldehyde and then permeabilized by treating with 0.1% saponin solution for 20 minutes at room temperature. Lin¨CCXCR4 OSMR¦Â  cells were separated from BM by following a three-step magnetic activated cell sorting protocol using specific antibodies and magnetic beads.
8 _. B4 v+ V/ R; [4 w9 ^
Intra-Bone Marrow Transplantation and Immunohistochemistry

FVB/NJ male mice (n = 30) were irradiated at 900 cGy (137Cs source) 2 hours prior to transplantation. Intra-bone marrow transplantation (IBMT) of GFP  BM cells was performed as described previously  with some modifications. Ten million GFP  cells were directly injected in the femur of anesthetized FVB/NJ mice (supplemental online Methods). After 15 days of marrow repopulation, mice were injected with either mineral oil or CCl4. To analyze liver tissue, mice were sacrificed at 3 days, 1 month, and 1 year after damaging the liver.$ P/ u* P, G! T
' b9 l. ?) [4 n! Y7 @  @
Formalin-fixed tissues were embedded in paraffin blocks, and 5-µm sections were cut. Immunostaining was performed using biotinylated anti-albumin antibody, rat anti-GFP, and mouse anti-CK-18 antibodies. The secondary antibodies used were either conjugated with Alexafluor488 or Alexafluor594 (Molecular Probes, Carlsbad, CA, http://probes.invitrogen.com). Nuclei were stained with 4,6-diamidino-2-phenylindole. Serial sections of each liver sample were examined in a fluorescence microscope (Olympus, Tokyo, http://www.olympus-global.com).& W1 h7 [% _4 T$ E

Flow Cytometry

Cells (BM, PB, and liver) were stained by incubating with primary antibodies at 4¡ãC for 45 minutes followed by detection using fluorochrome-labeled streptavidin. Cells were analyzed by flow-cytometry (BD LSR; BD Biosciences, San Diego, http://www.bdbiosciences.com). The antibodies and the conjugates used in this study were Sca-1/fluorescein isothiocyanate (FITC), streptavidin-FITC/phycoerythrin/Cy5.5 (BD Pharmingen), biotinylated anti-albumin, and lineage antibody cocktail. Isotype control antibodies were procured from BD Pharmingen.

Isolation of Total RNA and Reverse Transcription-PCR Analysis
9 o" g$ F" G: ~2 B- Z
The expression of different genes was analyzed by reverse transcription (RT)-PCR. In brief, total RNA was recovered using TRI Reagent (Sigma-Aldrich, St. Louis, http://www.sigmaaldrich.com) according to the manufacturer's instructions. cDNA was synthesized from 0.5 µg of total RNA using ProtoScript First Strand cDNA Synthesis Kit (NEB, Beverly, MA, http://www.neb.com) and was subjected to PCR amplification with primers selective for various target genes. The primers and amplification conditions for PCR reactions were as follows: albumin: GTGCAAGAACTATGCTGAGG (forward), ACTCACTGGGTCTTCTCAT (reverse) (amplicon¡ª465 base pairs , 58.1¡ãC); tyrosine aminotransferase (TAT): GAGGAGTGTACAAATAAGGC (forward), AGAGGACACTCCTGTGTCAG (reverse) (amplicon¡ª422 bp, 51.7¡ãC); tryptophan dioxygenase (TDO): CATGGCTGGAAAGAACACCT (forward), TCGAGGCTCTTCCCTGTAAA (reverse) (amplicon¡ª289 bp, 59¡ãC); CK-18: CACCACCTTCTCCACCT (forward), GCCTCGATTTCTGTCTCCAG (reverse) (amplicon¡ª573 bp, 50¡ãC); stroma-derived factor-1 (SDF-1): GTCCTCTTGCTGTCCAGCTC (forward), GGGGGTCTACTGGAAAGTCC (reverse) (amplicon¡ª356 bp, 58.9¡ãC); -fetoprotein (AFP): CGCTCTCTACCAGACCTTAGGA (forward), CTCCTCTGTCAGTTCAGGCTTT (reverse) (amplicon¡ª451 bp, 59.2¡ãC); -glutamyl transferase (GGT): CACAGACAGTGGCTCAGACTTGG (forward), AGTGTGTGGTCCTCCAGGATGG (reverse) (amplicon¡ª306 bp, 59.8¡ãC); CK-19: CACCACCTTCTCCACCAACT (forward), GCCTCGATTTCTGTCTCCAG (reverse) (amplicon¡ª573 bp, 57.3¡ãC); CD45: TCTCCCAGGAGTATGAGTCCAT (forward), GGCCAATACTGATCACACTTCA (reverse) (amplicon¡ª339, bp, 51.1¡ãC); glyceraldehyde-3-phosphate dehydrogenase: GAATACGGCTACAGCAACAG (forward), CTAGGCCCCTCCTGTTATTA (reverse) (amplicon¡ª209 bp, 57.9¡ãC). The reactions were performed with hot start at 95¡ãC for denaturation, annealing at specific temperatures, and finally amplification at 72¡ãC for 25¨C35 cycles (depending on the target gene). The amplified products were resolved in 1.5%¨C2.0% agarose gel and visualized by ethidium bromide staining, and images were recorded in UVP BioImaging System (UVP, Upland, CA, http://www.uvp.com).

Real-Time Quantitative PCR

Real-time quantitative (q)PCRs were performed by means of SYBR Green technology and ABI PRISM 7000 apparatus (Applied BioSystems, Foster City, CA, http://www.appliedbiosystems.com). For each sample, ABI PRISM 7000 software plotted an amplification curve by relating the fluorescence signal intensity (Rn) to the cycle number. The Rn value corresponded to the variation in reporter fluorescence intensity during each PCR cycle, normalized to the fluorescence of an internal passive reference. A specific crossing point (Ct) was determined for each PCR. The Ct was defined as the cycle number at which a significant increase in the fluorescence signal was first detected (the higher the starting copy number, the lower the Ct). The PCR reaction parameters were as follows: (a) reaction mix: 100 ng of DNA mixed with 12.5 µl of 2X Master Mix (Applied Biosystems) and 200 nM each primer in a final volume of 25 µl; (b) PCR cycles: 10 minutes at 95¡ãC, 40 amplification cycles (95¡ãC for 30 seconds, 60¡ãC for 30 seconds, 95¡ãC for 30 seconds), and 4¡ãC for 2 minutes. Dissociation protocol was added.' {- T2 ~' e( Y9 W" p

To evaluate the validity and the sensitivity of real-time qPCR sry gene analysis, standard amplification curves were plotted for recipient (male)- and donor (female)-specific DNA samples isolated from 10 serial halved dilutions of recipient cells in donor cells. The cell mixtures were made as follows: male cells were maintained 100%, 50%, 25%, 12.5%, 6.25%, 3.2%, 1.6%, 0.8%, 0.4%, 0.2%, and 0% and the corresponding female cells were 0%, 50%, 75%, 87.5%, 93.75%, 96.8%, 98.4%, 99.2%, 99.6%, 99.8%, and 100%. The genomic DNA was isolated from these standard cell mixtures using a Qiagen genomic DNA isolation kit (Hilden, Germany, http://www1.qiagen.com). In PCR, constant amounts (100 ng) of these DNA mixtures were used. To determine loading control in each standard mix, ¦Â-actin qPCR was performed. The Ct values of unknown samples were determined by qPCR, and the corresponding percentage of Y chromosome bearing cells was directly determined from the standard plot.

Statistical Values

Results of multiple experiments were reported as the mean ¡À SEM. One-way analysis of variance was followed to calculate the significance between two means.
1 @8 P& K( P+ M! w' H& q6 }- S
RESULTS

Liver Damage Induces Proliferation and Mobilization of Hematopoietic Progenitor Cells from BM to PB

Initially, we studied the proliferation of hematopoietic progenitor cells (Lin¨CSca-1 ) in BM and their mobilization in the peripheral blood in CCl4-injected mice. Mice were sacrificed at different times, and the number of progenitor stem cells in BM and PB was analyzed by flow cytometry. The analysis of Lin¨CSca-1  cells indicated a wave of increasing stem cell population in BM on day 1, which passes on to the PB by the next day (Fig. 1A). In BM, Lin¨CSca-1  cells reached a maximum level by day 1 post-liver damage, which declined to the basal level by day 3 (Fig. 1A). The increase in Lin¨CSca-1  cells at day 1 was 2.8-fold higher (p

Figure 1. Effect of liver damage on Lin¨CSca-1  cell population in BM and PB. Mice were sacrificed after 0, 1, 2, and 3 days of CCl4 injection, and the mononuclear cells were analyzed (supplemental online Fig. 1, panel IA). (A): Change in Lin¨CSca-1  population in BM and PB cells at different time intervals. (B): Percentage of S G2/M phase cells in BM at different time intervals. Mice were injected with either NS or DLS, and the mononuclear cells of BM and PB were analyzed. (C): Change in Lin¨CSca-1  population in BM cells at different time intervals. (D): Change in Lin¨CSca-1  population in PB cells at different time intervals. Mean ¡À SEM values from three to four independent experiments are shown. *, p 9 i5 K% K& O- e7 s$ y6 L/ @6 s

In order to examine whether the above change in BM-progenitor cells was a consequence of liver damage or due to direct effects of CCl4, instead of injecting CCl4 we injected NS and DLS in two different groups of mice. Although NS did not cause any change in the Lin¨CSca-1  population in BM and PB cells, DLS induced mobilization of these cells to PB (Fig. 1C, 1D). These results suggest that the serum of liver-damaged mice contains some soluble factors, which can induce the proliferation of Lin¨CSca-1  cells.

CXCR4/SDF-1 Mediated Migration of BM Cells Takes Place in Response to Liver Injury: x. }, T- w9 S. J; A

We analyzed the progenitor stem cell population in BM and PB cells for the expression of chemokine receptor CXCR4. The expression of CXCR4 on Lin¨CSca-1  cells was increased to a maximum value at day 1 and was twofold (p / B( }5 }5 {0 l* u; C- d
5 X5 M) u7 g/ ?" E4 t- a' C
Figure 2. Effect of liver damage on migration of BM cells in vivo and in vitro. The effect of liver damage on expression of chemokine receptor CXCR4 and gene of cognate ligand SDF-1 was analyzed in BM and liver, respectively. (A): Proportion of Lin¨CSca-1  cells in BM and PB expressing CXCR4 in response to CCl4 treatment. (B): Expression of SDF-1 gene in damaged liver tissue. Damaged liver tissue induces migration of Lin¨C BM cells in vitro. The GFP  BM cells were incubated in the upper chamber of culture insert in contact with damaged liver tissue placed in the lower chamber. Photomicrographs showing (Ca) GFP  cells in the upper chamber, (Cb) migrated GFP  cells in the lower chamber, (Cc) migration in absence of damaged liver tissue, (Cd) GFP  cells near the damaged liver tissue, and (Ce¨CCj) migration patterns of GFP  cells. The GFP  cells were crowded near the damaged liver tissue, and the numbers of migrated cells reduced with increase in distance between liver tissue and the plane of migration. (D): Analysis of migrated GFP  cells for the expression of lineage markers by flow cytometry. Mean ¡À SEM values from three independent experiments are shown. Representative results of one experiment are shown in (C) and (D). **, p

In order to ensure that BM cells migrate to the damaged liver, we performed in vitro migration studies. GFP  mononuclear BM cells were allowed to migrate, as mentioned in Materials and Methods. Within 1 hour, GFP  cells started migration, and significant numbers of cells were detected in the lower chamber within 3 hours (Fig. 2Cb). In contrast, there was no migration of GFP  cells in the absence of damaged liver tissue (Fig. 2Cc). Most interestingly, the number of GFP  cells that migrated near the liver tissue was more (Fig. 2Cd), which gradually reduced with increase in distance between cell migrating front and the liver tissue (Fig. 2Cd¨C2Cj). Based on these preliminary studies and RT-PCR results (Fig. 2B), we conclude that the concentration gradient of the chemoattractants, secreted by the damaged liver tissue, directed the migration of BM cells. We analyzed the migrated cells in terms of the expression of lineage markers and revealed that the migrated cells in the lower chamber were free from any lineage-committed cells (Fig. 2D).+ V" \. G3 Q6 {
' M$ r, v6 \4 U3 p* P  O6 K
A Distinct Population of Cells Expressing CXCR4 and OSMR¦Â Migrate Under the Influence of Damaged Liver Tissue; \2 c! j3 s3 |0 j( B

In vivo results showed that Lin¨CSca-1 CXCR4  cells are mobilized in the PB in response to the liver damage. Furthermore, in vitro migration experiments confirmed that only Lin¨C cells were capable of migration. In order to phenotypically characterize the migrating cells, PKH-26 labeled Lin¨C cells were used for similar in vitro migration experiments for 3 hours. The migrated cells were subjected to both immunocytochemical and flow-cytometric analyses for the cell surface markers. The results further confirmed that the migratory cells were Lin¨C fraction (/ Z2 E; x2 i% h: g' W9 }3 y5 I" M- j
2 W$ A) r8 ^' m: m! a; j
Figure 3. Phenotypic characterization of Lin¨C bone marrow (BM) cells migrated in response to damaged liver. In vitro migration experiments were performed using PKH-26 labeled Lin¨C BM cells, same as above. The migrated cells were stained with respective antibodies. Photomicrographs showing Lin¨C cells (, right). Abbreviations: DAPI, 4,6-diamidino-2-phenylindole; FSC, forward scatter; OSMR¦Â, oncostatin M receptor ¦Â; Sca-1, stem cell antigen-1.8 s3 X, K8 c$ s6 a* x1 J7 x6 S, P' p
( ?- z4 f- }$ O1 g5 C8 z
Before initiating further analysis on above cells, we ensured the differentiation potential by culturing them in the presence of 10% DLS. Although approximately 60% of migrated cells expressed albumin and CK-18 (Fig. 4A), the results demonstrated that a considerable fraction of them do not participate in the differentiation program. In order to reanalyze migrated cells, as well as the cells present in BM for differentiation potential, they were subjected to sorting for the phenotype expressing Lin¨CCXCR4 OSMR¦Â , as CXCR4 and OSMR¦Â were found important for migration and hepatic differentiation, respectively. The sorted cells from these two sources were again cultured and revealed that 100% of them expressed albumin and CK-18 (Fig. 4B, 4C). This implies that hepatic progenitor cells present in BM express OSMR¦Â and are denoted by Lin¨CCXCR4 OSMR¦Â Sca-1 /¨C.$ S6 ^; [9 B$ u' F( S- ~' q

Figure 4. In vitro hepatic differentiation potential of cells. Different fractions of cells were cultured for 3 days in the presence of damaged liver serum. Prior to immunostaining with anti-albumin and CK-18 antibodies, harvested cells were spread on glass slide with the help of a cytospin apparatus. Photomicrographs showing expression of albumin and CK-18 on (A) migrated cells as in Figure 3. (B): Migrated cells as in Figure 3, followed by positive selection for oncostatin M receptor ¦Â (OSM¦Â ). (C): Three-step purified fresh bone marrow cells designated as Lin¨CCXCR4 OSMR¦Â  fraction. Abbreviations: CK, cytokeratin; DAPI, 4,6-diamidino-2-phenylindole.
7 Z" P2 t4 j) G9 N! \8 ^
BM Cells Migrate to the Damaged Liver and Differentiate into Hepatocytes

Increase in progenitor stem cell population in the BM, its mobilization to the PB, increasing expression of chemokine receptor-ligand pair, and in vitro migration of a selected population of BM cells toward damaged liver tissue predict the involvement of these cells in liver regeneration from CCl4-induced acute injury. For further assessment of these cells, we conducted liver regeneration experiments. Bone marrow of FBV/J male mice was repopulated with GFP  BM cells of congenic female mice by IBMT. This method of transplantation circumvents trapping of BM cells in the liver, seen in cases of injections through the intravenous route, and allows us to directly deliver cells in the bone marrow. After repopulating BM with the donor cells (Fig. 5A), the liver was damaged by injecting CCl4 (control mice received mineral oil). The presence of GFP  cells in liver tissue was examined by immunostaining with anti-GFP antibody. The control mice showed no GFP  cells in any of the liver tissue sections examined (Fig. 5Be, 5Bi), whereas considerable numbers of GFP  cells could be visualized in CCl4 induced damaged liver sections (Fig. 5Bd). This migration of GFP  cells was specific to the damaged liver (Fig. 5B), as we did not observe any such cells in the pancreas (Fig. 5Ba), heart (Fig. 5Bb), and kidney (Fig. 5Bc) tissue sections of CCl4 treated mice. Immunohistochemical analysis of serial liver sections showed that as early as 3 days after injury, a distinct number of GFP  cells expressed albumin (Fig. 5Bf). Although some of the BM-derived cells expressed albumin at an early time point, they did not express CK-18, an epithelial marker (Fig. 5Bj). To ensure that the BM-derived cells were retained in the damaged liver tissue, we extended the study up to 1 year. At later times, GFP  cells not only expressed albumin, but a considerable number of them also expressed CK-18 (Fig. 5Bk). The long-term (1-year) study confirmed that BM-derived GFP  cells persisted in the liver lobules, and nearly 80% of them continued expression of liver-specific markers, such as albumin (Fig. 5Bh) and CK-18 (Fig. 5Bl). The BM-derived hepatocytes were found to be morphologically comparable to the normal hepatocytes. Summarizing the immunohistochemical analysis, the expression of albumin but not CK-18 could be seen in the donor-derived GFP  cells within 3 days of liver damage, although both of them were consistently expressed at later times.
$ L1 T8 N2 q& c* `
Figure 5. Assessment of bone marrow (BM) engraftment with GFP  cells, its migration to the damaged liver, and immunohistochemical analysis of liver sections. Hematopoietic system was reconstituted with GFP  cells as mentioned in Materials and Methods. Prior to liver damage with CCl4, BM reconstitution by donor cells was studied by analyzing GFP  cells in the peripheral blood. Mice showing GFP chimerism above 40% were inducted for in vivo migration experiments. (A): Analysis of GFP  cells in 15-day postengrafted BM followed by mineral oil injection (3-day, left) and CCl4 injection (3-day, middle and 30-day, right). (B): Immunohistochemical analysis of liver sections. Mice were sacrificed at 3 days, 1 month, and 1 year after the damage; 5-µm serial liver sections were analyzed with different antibodies. Top panel: Micrographs of different tissues (: liver) stained for GFP and nuclei (x100). Middle panel showing GFP (green), albumin (red), and nuclear (blue) staining (x400): micrographs. (Be): Three-day control after mineral oil injection; (Bf) 3 days, (Bg) 1 month, and (Bh) 1 year after CCl4 injection. Merged photographs (Bf¨CBh) showing yellow color GFP Alb  cells and nuclei stained blue with DAPI. Lower panel showing GFP (green), CK-18 (red), and nuclear (blue) staining (x400): micrographs. (Bi): Three-day control after mineral oil injection; (Bj) 3 days, (Bk) 1 month, and (Bl) 1 year after CCl4 injection. Merged photographs (Bj¨CBl) showing yellow color GFP CK-18  cells and nuclei stained blue with DAPI. Three-day and 1-month experiments were conducted in four mice each, and 1-year experiments were conducted in two mice. Representative results of one experiment are shown. Abbreviations: Alb, albumin; CK, cytokeratin; DAPI, 4,6-diamidino-2-phenylindole; eGFP, enhanced green fluorescent protein; GFP, green fluorescent protein.4 T! e& U7 R, D( W

Furthermore, de novo expression of hepatic genes was examined in sorted BM-derived liver cells (supplemental online Fig. 1, panel II) by RT-PCR. This analysis revealed that albumin and other hepatocyte-specific genes, such as TAT, TDO, and CK-18, were significantly expressed in the donor-derived cells. The expression of hepatocarcinogenic markers AFP and GGT was negligible in the 3-day samples but was completely absent at the later time points (Fig. 6). CK-19 expression, which is indicative of differentiation into bile ductular cells, was completely absent in BM-derived cells (Fig. 6). Hepatocyte-specific gene expression in GFP  cells confirmed the presence of an inductive microenvironment in damaged liver that mediates reprogramming of progenitor stem cells in favor of hepatocytes. This was further evident by the downregulation of the expression of CD45 gene in the sorted BM-derived cells. These results suggest that the BM-derived cells were comparable to normal adult hepatocytes in terms of gene and protein expression and also in morphological features.
- B# q1 e" l- ?4 H
Figure 6. Liver-specific gene expression in sorted cells recovered from the liver. Experiments were performed as described in Figure 5. GFP  (3-day and 1-month) and GFP Alb  (1-year) sorted cells were analyzed for the target genes by reverse transcription-polymerase chain reaction. BM cells were taken as negative control for the target genes (BM cells were supplemented with 2% liver cells, as the purity of GFP /GFP Alb  sorted cells was 98%¨C99%). Adult liver cells were used as positive control for albumin, TAT, TDO, CK-18, and CK-19, and fetal liver cells were used as positive control for AFP and GGT. Three-day and 1-month experiments were conducted in four mice each, and 1-year experiments were conducted in two mice. Representative results of one experiment are shown. Abbreviations: AFP, -fetoprotein; BM, bone marrow; CK, cytokeratin; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; GGT, -glutamyl transferase; TAT, tyrosine aminotransferase; TDO, tryptophan dioxygenase.

BM-Derived Cells Differentiate into Hepatocytes in the Regenerating Liver Without Fusion8 k. R4 U' W% y' ]* Z5 ~# A6 f0 _: ~

The observation that liver injury induced migration of BM cells to the liver and reprogrammed into hepatocytic cells suggests their physiological role in liver regeneration. With this understanding, we examined the possibility of fusion of the BM-derived cells with the host hepatocytes. We conducted real-time qPCR analysis for the Y chromosome-specific gene sry in sorted GFP¨CAlb  (recipient hepatocytes) and GFP Alb  (donor-derived hepatocytes) cells from the same mice. The premise behind this study was that, only if BM-derived cells (female) fused with host cells (male), they would possess sry gene; otherwise, GFP Alb  cells will not show the amplification of sry gene. To test the presence of sry gene in the sorted GFP Alb  cells, initially artificial chimeric genomic DNA samples were prepared from 10 serial halved dilutions (0.2%¨C100%) of recipient (male) cells in donor (female) cells. The specific PCR amplification plots obtained from these chimeric DNA mixtures were overlaid and are shown in Figure 7B. The amplification plot shifted to the right to higher threshold cycles as the input target sry gene quantity was reduced. By contrast, no amplification was visualized for the negative control DNA (100% female 0% male cells DNA) up to 40 cycles. Figure 7C represents the Ct values plotted versus the log values of percentage male cells in artificial chimeric DNA samples. Standard curve slope ranged from ¨C3.17 to ¨C3.41, and the corresponding PCR efficiency was found to be 0.97¨C0.99. In 100 ng of total DNA, the quantification of sry gene was shown to be linear over three logs of DNA concentrations of Y-chr  cells, and the assay could measure as low as 0.2% cells containing target gene.5 D: \( i8 ~$ f. t( ]
1 g2 F* g7 J8 i" m1 }; C" `- T
Figure 7. Real-time polymerase chain reaction (PCR) analysis for recipient-specific marker for sry gene. Experiments were performed as described in Figure 5 for 1-year postdamage of liver. (A): Sorting of GFP¨CAlb  and GFP Alb  cells using BD FACSAria. Dot plots of presorted and postsorted cells are shown to examine the purity of respective fractions of cells. (B): Amplification curve by relating the fluorescence signal intensity (Rn) to the cycle number for different concentrations of chimeric DNA mixture, as mentioned in Materials and Methods. (C): Crossing point (Ct) curve plotted against each concentration of male chromosome. Values of unknown samples (Y-chr  cells) of two mice (marked as 1 and 2) were directly quantified from the Ct plot. (D): Percentage of Y-chr  cells in the recipient (GFP¨CAlb ) and donor (GFP Alb ) cell fraction. PCR experiments were conducted for both the mice in duplicate samples. Mean ¡À SEM values from 2 x 2 experiments are shown. Abbreviations: Alb, albumin; E, efficiency; GFP, green fluorescent protein; S, slope.4 }+ V0 ]3 m- l) M& C- }; D& T
: l6 U# z* {7 q) |' H, o; ]+ G' M
To determine the presence of Y-chr  cells, we sorted GFP Alb  and GFP¨CAlb  liver cells of the experimental mice. The purity of these fractions of cells was greater than 98.5% (Fig. 7A). The purpose of using GFP¨CAlb  cells in qPCR analysis was to show that the recipient mice were indeed male, if Ct value almost matches with that obtained with 100% male standard cells used to establish amplification plots (Fig. 7B). The results of unknown samples (GFP Alb  cells) of two different experimental mice are shown in Figure 7C. The calculated values of Y-chr  cells in GFP¨CAlb  and GFP Alb  sorted cells were 99.26% ¡À 0.45% and 5.37% ¡À 0.83%, respectively (Fig. 7D). These results confirmed that (a) recipient mice were male and (b) fusion between the recipient and donor-derived cells was not the cause of hepatocyte-specific gene expression in BM-derived cells, indicating that direct differentiation was the principal mechanism of conversion of BM cells into hepatocytes. The presence of only 5% Y-chr  DNA in GFP Alb  sorted fraction could be either due to contamination with the recipient hepatocytes or due to the formation of few fused cells between BM-derived cells and recipient hepatocytes. These results indicate that cell fusion was not the predominating mechanism involved in differentiation of BM-derived cells into hepatocytes in the present experimental model.
, j' v& Y$ J; G0 Z, ~$ a" M7 {
DISCUSSION
8 n" C/ _) T+ e- \( S5 }- R* ^
Primary hepatocytes remain the choice for transplantation to treat patients with severe acute end-stage chronic liver and metabolic liver diseases . In this investigation, we provide direct evidence to show that endogenous BM cells are involved for regeneration of liver after acute injury, which appears to be an important mechanism for autonomous regeneration of liver. Using in vitro migration assay, we have characterized the potential population of BM cells, which participate in the regeneration process.' A1 w2 |, @; o$ Z3 ~. M" P: V7 }% g

As a first step toward understanding the role of BM cells in liver regeneration, we examined the effect of liver injury on cell cycle activation and proliferation of progenitor stem (Lin¨CSca-1 ) cells .

In the CCl4-treated mice, the major fraction of mobilized progenitor stem cells expressed chemokine receptor CXCR4. At the same time, the mRNA level of its ligand (SDF-1) in the damaged liver tissue was increased. These results provided us a clue that possibly CXCR4/SDF-1 interaction was responsible for the mobilization of progenitor stem cells from BM to the damaged liver for its regeneration, but it was not ascertained by these studies. The above findings were strengthened by the results of in vitro migration studies, in which only Lin¨C cells were attracted toward damaged liver tissue, out of which 90% of cells expressed CXCR4. SDF-1 dependent stress-induced recruitment of cord blood cells (CD34 CXCR4 ) in injured mouse liver has been shown earlier when transplanted through intravenous route  and present results, we believe that the expression of CXCR4 in mouse progenitor stem cells may be sufficient for its recruitment in the damaged liver; however, for hepatic differentiation, the expression of OSMR¦Â is imperative. Thus, we conclude that Lin¨CCXCR4 OSMR¦Â  BM cells are candidate hepatocyte progenitors in BM, which are involved in regeneration of damage liver.* ?, n8 G/ t4 f6 h3 P

Earlier investigators followed intravenous route for transplantation of BM cells either in irradiated or in CCl4-injected mice  induced differentiation of BM cells into hepatocytes.- @5 W& n9 B# p  |( s% N. u" h
: |# k5 y/ Z6 l" g
Overall, we conclude that liver regeneration after acute injury may not be completely autonomous, and the BM-derived cells might play an important role in such a regenerative process. A distinct characteristic of cells present in the BM are involved in liver regeneration. In response to acute liver damage, progenitor stem cells proliferate and mobilize to the PB and, finally, competent hepatic progenitor cells migrate to the damaged liver for participation in regeneration by direct differentiation process. The results of this investigation offer a conceptual basis for the repair of vital organs prone to damage in everyday functions, the liver being one such organ.# X' p& v1 u4 ]- L2 _

DISCLOSURE OF POTENTIAL CONFLICTS OF INTEREST9 M/ e" ]' G$ L* v; {

The authors indicate no potential conflicts of interest.
, {  V0 ^: y3 ~! p/ Y
ACKNOWLEDGMENTS
4 L; v8 C, }" G  Z
Authors are indebted to National Center for Biological Sciences, Bangalore, India, and the Jackson Laboratories for providing the GFP-expressing mice for this investigation. A part of the research was supported by grants from the Department of Biotechnology, Government of India.9 \9 C; y4 T- o4 `% P) q* c; V
      【参考文献】- m" O  q3 [8 R7 v* L
; U( M6 S. p9 z) [1 n4 P$ v: m
2 |0 @. B# x% i% e* D( s+ Y# e
Durand C, Dzierzak E. Embryonic beginnings of adult hematopoietic stem cells. Haematologica 2005;90:100¨C108.9 G5 s; U: M' m2 O. p5 F: Q

Kinoshita T, Miyajima A. Cytokine regulation of liver development. Biochim Biophys Acta 2002;1592:303¨C312.
1 R, Z8 w4 i  C& c5 h
Takezawa R, Watanabe Y, Akaike T. Direct evidence of macrophage differentiation from bone marrow cells in the liver: A possible origin of Kupffer cells. J Biochem 1995;118:1175¨C1183.
: a, w" d2 y7 ?; _
Murasawa S, Asahara T. Endothelial progenitor cells for vasculogenesis. Physiology 2005;20:36¨C42.) y$ W& ~' Z( B/ q! x. O7 I, H% g
, N& C  K/ b6 ]
Baba S, Fujii H, Hirose T et al. Commitment of bone marrow cells to hepatic stellate cells in mouse. J Hepatol 2004;40:255¨C260.* N" ?! n$ P, Q% b3 F+ s; I

Kotton DN, Fabian AJ, Mulligan RC. A novel stem-cell population in adult liver with potent hematopoietic-reconstitution activity. Blood 2005;106:1574¨C1580.2 C' @5 j1 Z" r: a

Jiang Y, Jahagirdar BN, Reinhardt RL et al. Pluripotency of mesenchymal stem cells derived from adult marrow. Nature 2002;418:41¨C49.. e3 d' e1 @; b9 c; j* ^: e
4 ^1 R6 `) X2 }3 K: g
Krause DS, Theise ND, Collector MI. Multi-organ, multi-lineage engraftment by a single bone marrow-derived stem cell. Cell 2001;105:369¨C377.
6 y% @4 w1 @, ^$ L. |) P
Petersen BE, Bowen WC, Patrene KD et al. Bone marrow as a potential source of hepatic oval cells. Science 1999;284:1168¨C1170.2 S) p, t; Q9 _. f
& U  o) Z! G9 n4 z- Y& E
Theise ND, Badve S, Saxena R et al. Derivation of hepatocytes from bone marrow cells in mice after radiation-induced myeloablation. Hepatology 2000;31:235¨C240.
2 _) v) X5 h* q' k, A; a
Lagasse E, Connors H, Al-Dhalimy M et al. Purified hematopoietic stem cells can differentiate into hepatocytes in vivo. Nature Med 2000;6:1229¨C1234.
, x6 }  \$ `- s0 L" E% y8 u  [
Mallet VO, Mitchell C, Mezy E et al. Bone marrow transplantation in mice leads to a minor population of hepatocytes that can be selectively amplified in vivo. Hepatology 2002;35:799¨C804.

Wang X, Montini E, Al-Dhalimy M et al. Kinetics of liver repopulation after bone marrow transplantation. Am J Pathol 2002;161:565¨C574.
; a9 d  P8 U$ t& F) y& |2 Z' q9 [
Wang X, Willenbring H, Akkari Y et al. Cell fusion is the principal source of bone-marrow-derived hepatocytes. Nature 2003;422:897¨C901.

Vassilopoulos G, Wang P, Russell DW. Transplanted bone marrow regenerates liver by cell fusion. Nature 2003;422:901¨C904.
* d5 ^& d# D- X. X
Jang YY, Collector MI, Baylin SB et al. Hematopoietic stem cells convert into liver cells within days without fusion. Nat Cell Biol 2004;6:532¨C539.

Harris RG, Herzog EL, Bruscia EM et al. Lack of a fusion requirement for development of bone marrow-derived epithelia. Science 2004;305:90¨C93.6 V, c" P/ ]' |2 W* v" f
* r4 K# v7 @9 S! ]
Liu SL, Degli Espoti S, Yao T et al. Vitamin E therapy of acute CCl4-induced hepatic injury in mice is associated with inhibition of nuclear factor-B binding. Hepatology 1995;22:1474¨C1481.- O' d! [- |" }' d1 [0 ^) a2 L
: B  v3 a' }/ R0 S
Wang X, Hung N, Costa RH. Earlier expression of the transcription factor HFH-11B diminishes induction of p21CIP1/WAF1levels and accelerates mouse hepatocyte entry into S-phase following carbon tetrachloride liver injury. Hepatology 2001;33:1404¨C1414.
2 V, M# T6 _  P# \" f. f3 Y
Gandhi CR, Nemoto FM, Watkins SC et al. An endothelin receptor antagonist TAK-044 ameliorates carbon tetrachloride-induced acute liver injury and portal hypertension in rats. Liver 1998;18:39¨C48.
# K: _- v6 ]5 \0 }9 L, B
Madhusudhan T, Richhariya A, Majumdar SS et al. An in vitro model for grafting of hematopoietic stem cells predicts bone marrow reconstitution of myeloablative mice. J Hematother Stem Cell Res 2003;12:243¨C252.
& p1 P/ Y) T1 s9 e9 u
Kushida T, Inaba M, Hisha H et al. Intra-bone marrow injection of allogeneic bone marrow cells: A powerful new strategy for treatment of intractable autoimmune diseases in MRL/lpr mice. Blood 2001;97:3292¨C3299.; `6 R7 {* F9 o$ n' p. E

Kollet O, Shivtiel S, Chen Y et al. HGF, SDF-1, and MMP-9 are involved in stress-induced human CD34 stem cell recruitment to the liver. J Clin Invest 2003;112:160¨C169.- C, o  P) k" H! }" j

Kamiya A, Kinoshita T, Ito Y et al. Fetal liver development requires a paracrine action of oncostatin M through the gp130 signal transducer. EMBO J 1999;18:2127¨C2136.

Petersen BE, Grossbard B, Hatch H et al. Mouse A6-positive hepatic oval cells also express several hematopoietic stem cell markers. Hepatology 2003;37:632¨C640.

Strain AT, Crosby HA. Hepatic stem cells. Gut 2000;46:743¨C745.
# x% F- ^0 ~( G" `" l, [* h9 D
Korbling M, Estrov Z. Adult stem cells for tissue repair¡ªa new therapeutic concept? N Engl J Med 2003;349:570¨C582.

Jurecic R, Van NT, Belmont JW. Enrichment and functional characterization of Sca-1 WGA , Lin¨CWGA , Lin¨CSca-1 , and Lin¨CSca-1 WGA bone marrow cells from mice with an Ly-6a haplotype. Blood 1993;82:2673¨C2683.

Spangrude CJ, Scollay R. A simplified method for enrichment of mouse hematopoietic stem cells. Exp Hematol 1990;18:920¨C926.
4 q, X5 a) l0 K1 ^$ q, l
De Silvestro G, Vicarioto M, Donadel C. Mobilization of peripheral blood hematopoietic stem cells following liver resection surgery. Hepatogastroenterology 2004;51:805¨C810.
. m+ Q/ T6 n- @
Dalakas E, Newsome PN, Qing L et al. Mobilization of pluripotent hematopoietic stem cells occurs in alcoholic hepatitis and is associated with an improved clinical outcome. Hepatology 2003;38 (suppl 1):284a.

Ratajczak MZ, Kucia M, Reca R et al. Stem cell plasticity revisited: CXCR4-positive cells expressing mRNA for early muscle, liver and neural cells ¡®hide out¡¯ in the bone marrow. Leukemia 2004;18:29¨C40.0 O% m* k; h( t6 t! G

Danet GH, Luongo JL, Butler G et al. C1qRp defines a new human stem cell population with hematopoietic and hepatic potential. Proc Natl Acad Sci U S A 2002;99:10441¨C10445.

Quintana-Bustamante O, Alvarez-Barrientos A, Kofman AV et al. Hematopoietic mobilization in mice increases the presence of bone marrow-derived hepatocytes via in vivo cell fusion. Hepatology 2006;43:108¨C116.' u" M  X% P: T" n, x$ A
  H% ^* ?/ z8 G. o+ a
Alvarez-Dolado M, Pardal R, Garcia-Verdugo JM et al. Fusion of bone-marrow-derived cells with Purkinje neurons, cardiomyocytes and hepatocytes. Nature 2003;425:968¨C973.5 }5 @7 T, R5 z1 f! e( B' |

Schirmacher P, Geerts A, Pietrangelo A et al. Hepatocyte growth factor/hepatopoietin A is expressed in fat-storing cells from rat liver but not myofibroblast-like cells derived from fat-storing cells. Hepatology 1992;15:5¨C11.
/ V1 r) f3 U0 R) Z
Castilla A, Prieto J, Fausto N. Transforming growth factor ¦Â1 and  in chronic liver disease. Effects of interferon  therapy. N Engl J Med 1991;324:933¨C940.

收藏0 分享0 顶0 踩0