Facilitation versus depression in cultured hippocampal neurons determined by tar - 《JCB》细胞生物学杂志干细胞之家

干细胞之家 - 中国干细胞行业门户第一站 › 干细胞之家论坛 › 干细胞文献资源库 › 《JCB》细胞生物学杂志 › Facilitation versus depression in cultured hippocamp ...



免疫细胞治疗专区	欢迎关注干细胞微信公众号

12 3 4 5 6 7 8 9 10 ... 24 下一页

返回列表

查看: 405617\|回复: 239	go Facilitation versus depression in cultured hippocampal neurons determined by tar [复制链接]

kato

版主

Rank: 7 Rank: 7 Rank: 7

积分: 0
威望: 0
包包: 792

楼主

发表于 2009-4-20 09:19 |只看该作者 |倒序浏览 |打印

作者：Mian Xie, Xiang Li, Jing Han, Daniel L. Vogt, Silke Wittemann, Melanie D. Mark, and Stefan Herlitze作者单位：Department of Neurosciences, Case Western Reserve University, Cleveland, OH 44106 0 L1 C  d* L- ^! j8 S

   6 }$ ^5 ?/ s& h  F# l7 S
      ! i7 s2 q( ^) p1 C6 \, d' g! g. x) m
                     / L4 s6 x, H  m# i/ @1 P0 F
         # j2 j: N8 X1 t: @& f( m! a$ M
         6 P( V$ \1 Z3 @$ K" R. E6 h




      8 d% K0 d( b) g4 W* M, W$ x! d


      【关键词】 versus; x5 A1 \6 r6 h$ j2 s, w

1 m# B* u7 g8 _1 P
Introduction& e) d' D0 E$ B1 }9 B" K3 H
- ]& ^) N9 I" @) O, d/ ^2 K- @
High voltage–activated Ca2  channels in neurons consist of several subunits, a pore-forming 1 subunit (Cav1), and several auxiliary subunits, including 2 and ? (Cav?; Catterall, 2000). Cav? subunits are involved in transport of the pore-forming 1 subunit to the plasma membrane (Dolphin, 2003; Herlitze et al., 2003). Cav? subunits shield an ER retention signal on the 1 subunit, thereby guiding the pore-forming subunit to the target membrane (Bichet et al., 2000).
  E+ [! F. A: m$ P; O8 c$ R! U) `* T
Cav? subunits also determine the biophysical properties of the Ca2  channel. The effects of the Cav? subunit family members on the biophysical properties are complex. Four family members have been described (Cav?1–4). P/Q-type channels assembled with Cav?1b and ?3 subunits in heterologous expression systems are fast inactivating in comparison with Cav?4- and ?2-assembled channels (Stea et al., 1994; Fellin et al., 2004; Luvisetto et al., 2004). Cav?2 has the most dramatic effects on the channel properties, causing the channel to inactivate very slowly. In addition, the Cav?2 subunit is unique because this subunit can be attached to the plasma membrane via its palmitoylated N-terminal protein domain (Chien et al., 1998).0 I- n' {) Q. h5 Q  X4 r" H: v

Several studies also suggest that at least certain Cav? subunit family members can target and function independently of the Cav1 subunits at the plasma membrane and other intracellular structures such as the nucleus. For example, these subunits may be involved in gene transcription (Hibino et al., 2003) and the regulation of Ca2  oscillations and insulin secretion (Berggren et al., 2004).! K' d5 S0 e2 ~3 y. Z0 D2 {) O- m: y* m

Recently, the crystal structures of the Cav? core domains and the interaction domain between Cav? and Cav1 have been determined (Chen et al., 2004; Opatowsky et al., 2004; Van Petegem et al., 2004). These studies revealed that the Cav? subunits belong to the membrane-associated guanylate kinase family containing Src homology type 3 and guanylate kinase domains (Hanlon et al., 1999; Richards et al., 2004; Rousset et al., 2005). A mutagenesis study of the Src homology type 3 and guanylate kinase domains showed that these domains regulate the inactivation of these Ca2  channels (McGee et al., 2004) but also suggested that Cav? subunits are involved in scaffolding and in the precise localization of Ca2  channel complexes to defined subcellular domains. Indeed, deletion of the nonconserved N and C termini of the Cav?4b subunit results in a loss of synaptic localization and presynaptic function (Wittemann et al., 2000). In addition, the isolated N terminus of Cav?4a is capable of interacting with proteins of the vesicle release machinery (Vendel et al., 2006).
3 U6 F$ H5 B5 c2 {7 o
All Cav? subunits are expressed in the brain. Their subcellular distribution within neurons reveals that they are localized to neuronal cell bodies and dendrites. In addition, Cav? has been suggested to be localized to synaptic terminals (Herlitze and Mark, 2005). However, its precise function for determining synaptic transmission and, in particular, synaptic plasticity is unclear. Therefore, the goal of this study is to analyze the distribution of endogenously and exogenously expressed Cav? subunits in hippocampal neurons and to correlate their distribution with their effects on synaptic transmission. Our results suggest that Cav?2a and Cav?4b subunits are targeted to presynaptic terminals, where they determine whether synapses facilitate or depress.
. \0 ]# @4 e! b1 C6 {! m% k
Results& Z- {: l1 ^0 Q; |2 M% L- V1 e

Distribution of endogenous Cav? subunits in hippocampal neurons

We first investigated whether hippocampal neurons in culture express endogenous Cav? subunits, as would be predicted by the presence of the endogenous high voltage–activated Ca2  channels (Reid et al., 1998; Wittemann et al., 2000). We produced a peptide-derived antibody, which recognizes all ?-subunit family members (pan-? antibody). As indicated in Fig. 1 A, the antibody recognized specifically Cav? subunits in hippocampal neurons, as demonstrated by antagonistic action of the epie peptide (not depicted). Many, but not all, of the puncta colocalize with the synaptic markers synaptobrevin 2 (Fig. 1, A–C) and synapsin 1 (Fig. 1 D). The subunits are expressed throughout the neuron with high and uniform staining detected in the soma and proximal dendrites, with more clustered distribution in synaptic areas. We next analyzed whether we could detect Cav? subunit–specific mRNAs in these neurons and whether we could see quantitative differences among the four different Cav? mRNAs. As a positive control, we used 18S RNA. Real-time PCR revealed the highest mRNA levels for the Cav?3 subunits and lower mRNA levels for Cav?1,2,4 (Cav?1 Cav?4 Cav?2; Fig. 1 E). The results indicate that all four Cav? subunits are expressed in hippocampal neurons in culture, which localize to the soma and to synapses.1 L% w- A6 J% I% U. r

Figure 1. Endogenous distribution and expression of Cav? subunits in cultured hippocampal neurons. (A–C) (A, green) Confocal pictures of the endogenous Cav? subunits detected with a pan-? antibody reveal punctate staining. (B, red) Hippocampal neurons were stained with an anti–synaptobrevin-II antibody and visualized with an AlexaFluor546-coupled secondary antibody. (C) Overlay of A and B demonstrates that the endogenous Cav? subunits are partially colocalized with the synaptic vesicle marker synaptobrevin-II. (right) Boxed areas show that several pan-staining puncta are colocalized with synaptobrevin-II (arrows). Magnification of the indicated areas from the neuron shown on the left. (D) Cav? subunits colocalize with the synaptic marker synapsin-I. Confocal images of the endogenous Cav? subunits in hippocampal neurons visualized with the pan-? antibody (left), synapsin-I visualized with an anti–synapsin-I antibody (middle), and overlay of the two pictures (right) reveal that endogenous Cav? subunits partially colocalize with the presynaptic marker synapsin-I. (E) Endogenous Cav? subunit mRNAs are expressed at different levels in cultured hippocampal neurons. The mRNA expression levels of Cav?2a, Cav?3, and Cav?4b were normalized to the mRNA level of the Cav?1b subunit. The bar graph shows that the Cav?3 mRNA level was approximately three times higher than Cav?1b, whereas the Cav?2a expression level was 50% lower (n = 12; **, P
  u8 E  Z* T% e# ?$ z
Distribution of exogenously expressed Cav? subunits in hippocampal neurons

We next analyzed whether the exogenous expression of the Cav? members resembles the endogenous distribution of the Cav? subunits as determined in Fig. 1 and whether Cav? subunits can target to synaptic sites when expressed alone in neurons (Fig. 2). We found that the Cav?1b and Cav?3 subunits reveal a more homogenous distribution, whereas the Cav?2a and Cav?4b subunits are highly clustered (Fig. 2, A–C). When cells expressing these exogenous subunits were immunostained with the synaptic marker synaptobrevin-II or synapsin-1, we found that Cav?4b subunits revealed a higher degree of colocalization with synaptic markers than Cav?2a. Association of the Cav? subunits with the Cav1 subunits predicts that both proteins should be distributed in cylasmic as well as membrane regions, which we confirmed by Western blots from cytosolic and membrane fractions of whole rat brain using the pan-Cav? antibody (Fig. 3, A and B). Exogenous expression of the Cav? subunits revealed a similar distribution, with subtype-specific enrichment within either the cylasmic or the membrane fraction (Fig. 3 C). Cav?2a subunits are highly enriched in the membrane fraction, whereas Cav?1b was mostly concentrated in the cylasm (Fig. 3 C). Cav?3 and Cav?4 subunits were equally distributed in both fractions (Fig. 3 C). Because Ca2  channel Cav?2a and Cav?4b subunits reveal a mainly punctuate distribution within the neurons, we wanted to know whether we can detect Cav? subunits in presynaptic terminals on vesicles or vesicular structures (Fig. 4). The high expression levels of the GFP-tagged subunits allowed us to study their localization by immunoelectron microscopy. As a negative control, we used the untagged GFP overexpressed in hippocampal neurons. As shown in Fig. 4, Cav?2a and Cav?4b subunits were detected on vesicular structures (Fig. 4, A and B) and close to presynaptic terminals (Fig. 4, C and D). We also observed that both Cav?2a and Cav?4b were attached to the plasma membrane (Fig. 4 D). In contrast, GFP was found only in the nucleus and outside of the nucleus but was not associated with vesicles or transported to the presynapse (unpublished data). The results suggest that both Cav?2a and Cav?4b subunits are transported to synaptic sites and to the plasma membrane, where they most likely associate with the Cav1 subunits to form channel complexes.

Figure 2. Exogenously expressed Cav?1-4 subunits distribute in different patterns in hippocampal neurons and colocalize to various degrees with presynaptic marker proteins. (A) Fluorescence pattern of neurons from low density hippocampal cultures infected with the indicated GFP-tagged Cav? subunit (i.e., Cav?1–4) reveal either a punctate (Cav?2a and Cav?4b) or a more diffuse, cytosolic staining (Cav?1b and Cav?3). (B) Increased magnification of hippocampal neurites reveal that Cav?2a and Cav?4b are clustered, whereas Cav?1b and Cav?3 are diffusely distributed. (C) The bar graph indicates that neurons overexpressing Cav?2a and Cav?4b mainly reveal punctate staining similar to the endogenous distribution of Cav? subunits, whereas the majority of neurons infected with Cav?1b and Cav?3 or GFP alone do not reveal punctate staining (n = 110–153 for each subunit; *, P ) o' K6 P7 O) T1 V/ r' {

Figure 3. Cav? subunits are found in cylasmic and membrane fractions in hippocampal neurons. (A and B) Rat whole brains (postnatal day 0–3) were homogenized and fractionated in a discontinuous sucrose gradient. Primary membrane and cytosolic fractions were taken for Western blot analysis. (B) When immunoblotted with the pan-? antibody, the endogenous Cav? subunits were mainly located in the membrane fraction but also found in the cytosolic fraction. (C) Exogenously expressed Cav? subunits revealed a subunit-specific distribution between the cytosolic and membrane fraction. 13–16 h after infection with Cav? subunits, 14-d in vitro hippocampal neurons were harvested, and cell extracts were blotted with anti-GFP antibodies.
6 f- h+ X9 p" V; F( n
Figure 4. Immunoelectron microscopy reveals that Cav?2a and Cav?4b subunits are associated with membranes and vesicular structures and are targeted to presynaptic terminals in hippocampal neurons. (A and B) Immunoelectron microscopy pictures of 14-d in vitro autaptic neurons exogenously expressing GFP-tagged Cav?2a (A) or GFP-tagged Cav?4b (B) subunits. In neurons expressing Cav?2a and Cav?4b subunits, gold particles were found attached or close to vesicular structures (arrowheads). (C and D) In adult hippocampal slices, exogenously expressing GFP-tagged Cav?2a (C) and Cav?4b subunits (D) were found in presynaptic terminals close to synaptic vesicles and attached to the cell membranes (arrowheads). Bars, 50 nm.

Effect of Cav? subunits on Ca2  channel currents in HEK293 cells and hippocampal neurons
2 d9 G6 y/ g9 A9 A9 u
Cav? subunits determine the biophysical properties of the Ca2  channel. When expressed with the P/Q-type channel in Xenopus laevis oocytes or HEK293 cells, Cav? subunits determine the time course of inactivation in a subunit-specific manner. Cav?1b- and Cav?3-assembled channels inactivate rapidly, whereas Cav?2a- assembled channels inactivate slowly (Stea et al., 1994). Cav?4b-assembled channels inactivate with a time course that lies between Cav?1b,3 and Cav?2a. The gating properties of the presynaptic Ca2  channels determine Ca2  influx into the presynaptic terminal and, therefore, determine transmitter release and synaptic plasticity, such as facilitation and depression.- g1 X$ h" L1 f) c$ ?2 s7 Z' m. m
1 m7 t: R  G0 D, j2 t
We wanted to know how P/Q-type channels assembled with different Cav? subunits open and closed during action potential (AP) waveforms, which we obtained from cultured hippocampal neurons. We expressed Cav12.1 subunits together with the Cav2 and the various Cav? subunits in HEK293 cells and applied 30 APs to analyze how many channels would be opened during AP trains. To determine the proportion of open channels, we used the following protocol. Based on the voltage dependence of the activation of P/Q-type channels, we applied a 10-ms depolarizing test pulse to a test potential in which 100% of channels within the cells were open (Herlitze et al., 1996, 1997, 2001; Mark et al., 2000). This value is given by the amplitude of the tail current. We then compared the tail current elicited by the AP to the tail current elicited by the 10-ms depolarization to  100 mV. We were interested in three values. We wanted to know whether activation with the AP waveforms would reveal differences in the opening of the channels when assembled with different Cav? subunits. The results indicated that the AP opens between 55 and 65% of the channels. No considerable differences were observed between channels assembled with the different Cav? subunits (Fig. 5, A and B).
8 M6 y% d$ R2 Y4 m0 e
Figure 5. Hippocampal AP waveform protocols detect differences in the amount of open P/Q-type channels assembled with the different Cav? subunits during long 20-Hz stimulations but not for paired pulses. (A) HEK293 cells expressing Cav12.1, Cav2, and one of the four Cav?1b, Cav?2a, Cav?3, and Cav?4b subunits were held at –60 mV, and Ca2  currents were elicited by a 20-Hz AP train 1 s after a prepulse to 100 mV for 10 ms. This prepulse was given to open 100% of the Ca2  channels expressed in the cell (). The tail current elicited by the prepulse was used to relate the tail current elicited by the AP to gain an understanding about the percentage of channels opened by the AP. The example whole cell currents () and the bar graph (bottom) indicate that approximately the same amount of channels were opened by the first AP and the second AP for the Cav?1–4-assembled P/Q-type channels analyzed. (B) Increased time resolution of the underlying current elicited by the AP. The deactivation time of the tail currents can be fitted with a single exponential. Only currents were included and analyzed in the experiments described in A–E, which reveal fast deactivation kinetics and no change in the deactivation kinetics between the first and the last tail current elicited. (C) Examples of P/Q-type channel currents assembled with Cav?1–4 subunits during a 20-Hz 30-pulse AP waveform train. (D) Relative ICa2  ratio for the P/Q-type channel currents assembled with Cav?1–4 subunits. The tail current amplitudes were related to the tail current elicited by the first AP. (E) Comparison of the relative amplitude of the tail currents elicited by the first and 30th AP during the 20-Hz AP train reveals that currents through P/Q-type channels assembled with Cav?1b and Cav?3 subunits are relatively smaller than currents through P/Q-type channels assembled with Cav?2a and Cav?4b. Error bars represent SEM. *, P

We next compared the ratio between the amount of channels opened by the first and the second AP (Fig. 5 A). By comparing this value, we gain information on differences on the influx of Ca2  through Ca2  channels into the presynaptic terminal, which may determine whether synapses facilitate or depress during paired pulses. No differences were detected between channels assembled with different Cav? subunits. We next analyzed whether a 20-Hz train of 30 APs leads to a decrease in channel opening, as would be expected from the inactivation of Ca2  channels during long, constant depolarizations (Stea et al., 1994; Herlitze et al., 1997). When comparing the proportion of channels opened by the first AP relative to the amount of channels opened by the 30th AP, we found that currents mediated by Cav?1b- and Cav?3-assembled channels are reduced by 10–15% (Fig. 5, D and E). In contrast, currents mediated by Cav?4b- assembled channels are reduced by 2% (Fig. 5, D and E), and currents mediated by Cav?2a-assembled channels increased by 5% (Fig. 5, D and E). Thus, P/Q-type channels assembled with different ? subunits reveal substantial differences in the amount of channel opening during long AP trains.

It has been shown that the biophysical properties of P/Q-type channels depends on the cellular environment in which the pore-forming Cav1 subunit is expressed (Tottene et al., 2002). We found that the maximal current elicited by a 500-ms-long voltage ramp is shifted to more negative potentials (around 20 mV) in neurons expressing non–L-type channels in comparison with HEK293 cells expressing P/Q-type channels encoded by the Cav12.1, Cav2, and Cav? subunits (Fig. 6 A). Therefore, Cav? subunit–mediated effects on presynaptic Ca2  channel (non–L type) inactivation may be shielded in neurons by, for example, neuronal-specific channel-interacting proteins. To show that the Cav? subunits (i.e., Cav?2a and Cav?4b) also change the biophysical properties of non–L-type channels in hippocampal neurons, we analyzed the Ca2  channel inactivation of somatic neuronal non–L-type channels. As shown in Fig. 6 B, the exogenous expression of Cav?2a and Cav?4b subunits reduce non–L-type channel inactivation in a subunit-specific manner. Cav?2a subunit expression leads to an increase in the non–L-type current during a 100-ms test pulse from –60 to 0 mV, whereas neuronal non–L-type currents in the presence of Cav?4b subunits do not change in size (Fig. 6 B).
" S& Z& [$ k8 a" h5 r
Figure 6. Cav? subunits expressed in hippocampal neurons change the biophysical properties of the endogenous non–L-type channels. (A) The activation of non–L-type channels in hippocampal neurons is shifted to more negative potentials when compared with P/Q-type channels exogenously expressed in HEK293 cells. () Example current traces (IV curve) of non–L-type currents from hippocampal neurons in comparison with currents through P/Q-type channels (Cav12.1, Cav2, and Cav?4b) expressed in HEK293 cells elicited by 500-ms voltage ramps from –60 to 90 mV. (bottom) Diagram of the voltage at which the peak current appears during the voltage ramp for P/Q-type channels expressed in HEK293 cells and non–L-type currents from hippocampal neurons in the presence or absence of Cav?2a and Cav?4b subunits. (B) The inactivation properties of non–L-type channels in hippocampal neurons are changed in the presence of Cav?2a and Cav?4b subunits. (left) Example traces of non–L-type currents elicited by a voltage pulse from –60 to 0 mV reveals that in the presence of Cav?2a and Cav?4b subunits, inactivation is slowed. (right) Diagram of the current change (percentage) within the 100-ms current trace. The current at the beginning of the test pulse (10 ms) is compared with the current at the end of the test pulse (95 ms). Error bars represent SEM. *, P 3 U, _0 P! p6 B* [4 e; ]9 Z% @

Effects of Cav? subunits on synaptic transmission1 U; ~4 T" J0 L, H
  w/ Y+ {$ S+ J7 L/ A5 k' s
Our results on the recombinant P/Q-type channels and endogenous neuronal Ca2  channels suggest that Ca2  influx into the presynaptic terminal should be altered during long 20-Hz AP trains but not for paired-pulse responses. We analyzed the effect of the Cav? subunits on paired-pulse facilitation (PPF) by comparing the first and second excitatory postsynaptic current (EPSC; defined as the paired-pulse ratio ) and analyzed the effect on synaptic depression by comparing the first and last EPSCs (averaged 27–30 EPSCs) within a 20-Hz stimulation protocol when 30 pulses were elicited in 4 mM of extracellular Ca2  (Fig. 7, A and C). Because we did not observe effects on synaptic transmission when Cav?1b and Cav?3 subunits were expressed in our initial studies (unpublished data), we only analyzed Cav?4b and Cav?2a subunit effects on synaptic transmission in the following experiments. According to our results regarding the effects of Cav? subunits on the inactivation properties of Cav2 channels, we found that Cav?2a subunits did not change the PPR as expected from the aforementioned biophysical analysis. However, Cav?4b subunits increased the PPR, leading to facilitation (Fig. 7, A and C).
9 G# m4 r! p6 J7 p
Figure 7. Cav? subunit–specific determination of facilitation and depression in autaptic hippocampal neurons. (A and B) EPSC recordings of autaptic hippocampal neurons exogenously expressing Cav?2a and Cav?4b subunits in 4 mM Ca2 . (A) Representative autaptic EPSC traces from noninfected and Cav?2a and Cav?4b subunit–infected neurons reveal that in the presence of Cav?2a and Cav?4b subunits, synaptic depression is increased during long 20-Hz stimulations. Gray areas represent the asynchronous release. (B) Bar graph of the quantified EPSC ratios of Cav?2a and Cav?4b subunit–infected and noninfected neurons. The EPSC amplitudes of the first and second EPSC (), the first and the mean from the 27–30th EPSC (middle), and the largest EPSC during a train and the mean from the 27–30th EPSC (bottom). (C) Relative EPSCs for Cav?2a- and Cav?4b-infected and noninfected neurons. The EPSC amplitudes during the 20-Hz pulse train were related to the EPSC elicited by the first pulse. The decline in EPSC amplitude could be fitted with a single exponential starting from the largest EPSC within the pulse train. (D) Bar graph of the mean maximal EPSC amplitude of Cav?2a and Cav?4b subunit–infected and noninfected neurons during a 20-Hz pulse train. (E and F) Comparison of the RRP before and after 30 2-ms-long pulses to 10 mV (20-Hz stimulation). (E) Example traces of sucrose responses before (P2) and after the 20-Hz stimulation (P1). (F) Relative pool size for Cav?2a- and Cav?4b-infected and noninfected neurons. The relative pool size was determined by the ratio between the sucrose response after the 20-Hz stimulation (P1) and the sucrose response before the stimulation (P2). (G) Time course of asynchronous release during a 20-Hz pulse train. The charge of the largest EPSC (EPSCmax) within the 20-Hz train was compared with the charge of the asynchronous release for each EPSC. (H) Bar graph of the quantified total charge during a 20-Hz stimulation protocol for the phasic release and asynchronous release for Cav?2a- and Cav?4b-infected and noninfected neurons. The mean values of the time course of depression (C) and the asynchronous release (G) were fitted with a single exponential, and the time constants for each fit and the number of experiments (given in parentheses) are given in the diagrams. Error bars represent SEM. * P,

We next analyzed whether the Cav?4b and Cav?2a subunits influence synaptic transmission during longer AP trains. The biophysical analysis predicts that in the presence of Cav?4b and Cav?2a subunits, Ca2  influx into the presynaptic terminal should be increased as a result of the noninactivating properties of the presynaptic Ca2  channels in comparison with Cav?1b and Cav?3 subunits. The increased Ca2  influx may cause more vesicle depletion (depression) and may influence asynchronous transmitter release, which has been shown to be proportional to the residual i (Atluri and Regehr, 1998). Analysis of the synaptic responses during 30 20-Hz AP trains revealed that Cav?4b- and Cav?2a-expressing neurons show larger depression in comparison with wild-type neurons (Fig. 7, A–C) Note that the amount of depression is related to the largest EPSC compared with the minimal EPSC at the end of the stimulus train. The largest EPSC in noninfected neurons and Cav?4b-expressing neurons is the EPSC elicited by the second pulse. Therefore, depression is significantly larger for Cav?2a (0.34 ± 0.01; n = 14) as well as for Cav?4b (0.49 ± 0.03; n = 15) in comparison with noninfected neurons (0.7 ± 0.01; n = 15). To determine whether Cav?4b- and Cav?2a-expressing neurons reveal more vesicle depletion during AP trains, we compared the readily releasable pool size before and after 20-Hz train stimulations. As shown in Fig. 7 (E and F), the pool size is substantially reduced in Cav?2a-expressing neurons (12 ± 3.5%) and is slightly reduced in Cav?4b-expressing neurons (9 ± 2.7%) in comparison with control neurons (3 ± 2.2%). However, the Cav?4b effects were not substantial. To further verify that Cav?4b- and Cav?2a-expressing neurons may increase the Ca2  influx into the presynaptic terminal, we analyzed the asynchronous release. We found that onset of the asynchronous release was much faster and the amount of asynchronous relative to the phasic release at the beginning of the AP train was increased in Cav?4b- and Cav?2a- expressing neurons in comparison with control neurons (Fig. 7 G). Although the total amount of phasic and asynchronous release (Fig. 7 H) as well as the mean EPSC amplitude (Fig. 7 D) were slightly increased in Cav?4b-expressing neurons in comparison with control and Cav?2a-expressing neurons, the differences were not substantial.* j, b" @: q, ~( a

These aforementioned results support the idea that during AP trains, the Ca2  influx into the presynaptic terminal is larger in the presence of Cav?4b and Cav?2a subunits. A larger Ca2  influx into the presynaptic terminal during AP trains in Cav?4b and Cav?2a subunit–expressing neurons should also result in faster vesicle recycling (Stevens and Wesseling, 1998). To test this hypothesis, we repeated the experiments described in Stevens and Wesseling (1998). We first analyzed the recovery of the readily releasable vesicle pool (RRP) after RRP depletion without 20-Hz stimulation trains applied during depletion. No differences were found for the recovery of the RRP regardless of whether Cav?4b or Cav?2a subunits were expressed in the neurons (Fig. 8, A and B). Also, recovery of the EPSC after RRP depletion was not different between neurons expressing or not expressing Cav?4b and Cav?2a subunits (Fig. 8, C and D), suggesting that exogenously expressed Cav?4b and Cav?2a subunits most likely do not interfere with the vesicle recycling. We next analyzed the RRP recovery after 20-Hz stimulation trains were applied during the initial sucrose application (Fig. 8 E). We confirmed the observation described by Stevens and Wesseling (1998) that the RRP recovery for all neurons analyzed (regardless of whether Cav? subunits were expressed or not) was accelerated by the 20-Hz stimulus train (Fig. 8, E and F). Interestingly, RRP recovery was faster in Cav?4b and Cav?2a subunit–expressing neurons in comparison with control neurons (rec without 20-Hz train stimulation: control = 11.4 s, Cav?2a = 9.1 s, and Cav?4b = 12.6 s; rec after 20-Hz train stimulation: control = 4.1 s, Cav?2a = 1.8 s, and Cav?4b = 1.6 s), suggesting again that Ca2  influx into the presynaptic terminal is increased during 20-Hz stimulation trains in Cav?4b and Cav?2a subunit–expressing neurons.- B: k( |" X9 g. z

Figure 8. Cav?2a and Cav?4b subunits expressed in hippocampal neurons accelerate the recovery of the readily releasable pool when trains of APs have been evoked previously. To evaluate whether Cav?2a and Cav?4b subunits affect vesicle recycling, we analyzed the recovery of the RRP and the EPSC after RRP depletion. The RRP was measured by applying hypertonic solution (500 mM sucrose) for 4 s. (A) Example traces of the time-dependent RRP recovery. (B) Time course of the recovery of the RRP. There were no substantial differences in the time course of RRP recovery between Cav?2a- and Cav?4b-expressing and nonexpressing neurons. (C) Example traces of the EPSC recovery after RRP depletion. (D) Time course of the recovery of the EPSC after RRP depletion. EPSCs were elicited by a 2-ms test pulse to 10 mV. (E) Example traces of the time-dependent RRP recovery when 20 stimulus trains have been evoked for 1 s at the end of the first sucrose application. (F) Time course of the recovery of the RRP reveals that in the presence of Cav?2a and Cav?4b, the RRP recovery is faster. The relative recovery of the RRP and the EPSC was calculated by comparing the sucrose or EPSC response after the initial sucrose response to the initial (first) response. For RRP recovery in E and F, the sucrose response after the first depletion (P1) was compared with the sucrose response 30 s after the second sucrose response (P2). The interpulse intervals are given in A, C, and E. The mean values of the recovery of the RRPs and EPSCs shown in B, D, and F were fitted with a single exponential, and the time constant for each fit are given in the diagram. The numbers of experiments are given in parentheses. Error bars represent SEM.+ S7 X- V3 B3 Z) k

Although the exogenous expression of Cav? subunits determines the synaptic responses during long AP trains according to the biophysical properties of the assembled presynaptic Ca2  channels, the induced facilitation by Cav?4b during paired pulses cannot be explained by the biophysical properties of presynaptic Ca2  channel assembled with the Cav?4b subunit. However, this may suggest that in the presence of Cav?4b subunit, the Ca2  dependence of the vesicle release is altered, which may result in a reduced release probability (Thomson, 2000). Therefore, we compared the release probability of noninfected and Cav?2a- as well as Cav?4b-expressing neurons. The release probability can be examined by comparing the RRP with the number of vesicles elicited by a single AP. The RRP size is determined by application of a hypertonic sucrose solution (Rosenmund and Stevens, 1996). As shown in Fig. 9, we found that the release probability in the presence of Cav?4b was reduced in comparison with noninfected and Cav?2a-expressing neurons. No differences in the mean RRP and EPSC size were detected between the neurons expressing different Cav? subunits, probably because only a small number of cells were analyzed., @5 l# _& @: ?  V2 R/ S
% Q1 O; G2 y: N: F
Figure 9. Cav?4b subunits expressed in hippocampal neurons reduce the synaptic release probability, change the Ca2 -dependent transmitter release, and are more sensitive to EGTA. (A, left) Representative EPSC traces evoked by 2-ms depolarizing pulses from –60 to 10 mV are shown for noninfected and Cav?2a- and Cav?4b-infected neurons. (right) Representative traces of the hypertonically mediated release of quanta from the same neuron shown on the left upon the application of 500 mM sucrose for 4 s. (B) Probability of synaptic vesicle release was evaluated by calculating the ratio of release evoked by the AP to that evoked by hypertonic sucrose. In autaptic neurons infected with Cav?4b, the vesicular release probability is significantly reduced compared with noninfected or Cav?2a subunit–infected neurons. (C) Representative EPSC traces elicited by the application of increasing extracellular Ca2  concentrations of autaptic hippocampal neurons expressing Cav?4b subunits. (D) Dose-response curve of the EPSC amplitude by increasing extracellular Ca2  concentrations. The Ca2 -dependent EPSC responses of noninfected, Cav?4b-, or Cav?2a-infected neurons were free fitted according to the Hill equation (EPSC = EPSCmaximal/(1 (EC50/o)Hill coefficient). The EPSCs were then normalized to the maximal EPSC given by each fit. The mean normalized EPSCs for the given Ca2  concentrations are shown. The curves again were fitted according to the Hill equation. The Hill coefficients are 2.7 ± 0.4 for control and Cav?2a-infected neurons and 1.9 ± 0.4 for Cav?4b-infected neurons. (E) Representative EPSC traces before and after a 50-μM EGTA-AM application evoked by two 2-ms depolarizing pulses from –60 to 10 mV within 50 ms are shown for noninfected and Cav?2a- and Cav?4b-infected neurons. (F) Bar graph of the remaining EPSC amplitude after 10 mM EGTA was applied intracellularly for 20 min () and after 50 μM EGTA-AM was applied extracellularly for 15 min (bottom). Error bars represent SEM. *, P - z  A- y9 X- T9 f- Z; ?
7 h! x0 d$ N% ^+ R6 Z$ C/ X
The relationship between the Ca2  influx into the presynaptic terminal and the vesicle release is approximately given by the following equation: vesicle release Hill coefficient, where the Hill coefficient is defined as the Ca2  cooperativity. The Ca2  cooperativity in many synapses is high (three to four), indicating that a small change in Ca2  influx can result in drastic changes in transmitter release. Thus, in our experiments, the Hill coefficient gives an indirect measure of the Ca2  influx through presynaptic Ca2  channels relative to the transmitter release. This means that a change in the number, localization, or organization of the presynaptic Ca2  channels most likely results in a change in Ca2  dependence of the transmitter release. Interestingly, in the presence of the Cav?4b subunits, the Ca2 -dependent transmitter release dose-response curve became more shallow, with a small change in the half maximal concentration (EC50) when compared with wild-type neurons or neurons exogenously expressing Cav?2a subunits (Fig. 9). Because the Cav?4b subunit particularly changed the cooperativity of the transmitter release, this result may suggest that Cav?4b is involved in organization of the Ca2  channel domains necessary for efficient vesicle release. For example, Cav?4b-assembled channels may be further apart from the release machinery. If this is the case, synaptic transmission in Cav?4b-expressing neurons should be more sensitive to the slow Ca2  buffer EGTA. Indeed, we found that when 10 mM EGTA was applied intracellularly or 50 μM EGTA-AM was applied extracellularly, the EPSC amplitude was substantially more reduced in Cav?4b-expressing neurons to 60 and 93%, whereas in Cav?2a-expressing neurons and control neurons, the EPSC amplitude was reduced only by 50 and 87–89% (Fig. 9, E and F).

Discussion

In this study, we investigated the targeting and function of Cav? subunits in hippocampal neurons. We found that Cav?2a and Cav?4b are sufficiently targeted to synaptic sites, where they influence synaptic transmission during long AP trains according to the biophysical properties that these subunits induce in the presynaptic Ca2  channel. During paired pulses, Cav?4b subunits also altered the Ca2  dependence of transmitter release. The physiological consequences and implications of the findings are discussed below.

Targeting of Cav? subunits to the plasma membrane and synaptic terminals
- |6 s$ O9 n8 R- f
We show that Cav?2a and Cav?4b are targeted to synaptic sites and colocalize with synaptic markers. All Cav? subunits (exogenously and endogenously expressed) are found to various degrees in cylasmic and membrane fractions, as suggested by an overexpression study of Cav? subunits in HEK293 cells (Chien et al., 1998). In particular, Cav?2a subunits are associated with the membrane fraction, as predicted from their N-terminal located palmitoylation site (Dolphin, 2003; Herlitze et al., 2003). This is in agreement with previous studies performed in HEK293 cells in which palmitoylated Cav?2a subunits reach the plasma membrane independently of the Cav1 subunit (Chien et al., 1998; Bogdanov et al., 2000). Cav?2a subunits could also be found on vesicular structures, supporting the view that they most likely are associated with Cav1 subunits, where they are transported as preassembled channel complexes to synaptic sites (Ahmari et al., 2000; Shapira et al., 2003). Our studies for Cav?1b and Cav?3 reveal that these subunits, when expressed alone, distribute more homogenously in neurons and do not substantially influence the synaptic parameters analyzed. The reason for this could be that Cav?1b and Cav?3 are not sufficiently transported to the presynaptic terminals as suggested by Maximov and Bezprozvanny (2002). On the other hand, because Cav?3 is the main mRNA detected in hippocampal neurons, most synaptic Ca2  channels could be assembled with Cav?3 subunits. Therefore, the biophysical properties of the presynaptic Ca2  channels would not be affected by either Cav?1b and Cav?3, because the biophysical differences of channels assembled with these subunits are small., I/ p+ U2 Z  Q
5 N* y5 Q) f! }4 i+ E1 ]
Cav? subunits may determine synaptic plasticity during longer AP trains as a result of the effects on the inactivation properties of the presynaptic Ca2  channel complexes$ Y; k. M  j$ c) g
0 O2 A5 y! C' T" q; q5 A
Cav? in particular determines the time course of inactivation of high voltage–activated Ca2  channels. How P/Q-type channels assembled with different Cav? subunits behave when AP waveforms derived from hippocampal neurons are used as command potentials has not been studied before. Interestingly, we did not detect substantial differences in the opening of the channels for the first two APs, which would determine the Ca2  influx into the presynaptic terminal during paired pulses underlying short-term synaptic plasticity, but found that Cav?1b- and Cav?3-assembled channels exhibited substantial differences in the proportion of channels open after 30 APs or longer trains when compared with the Cav?2a- and Cav?4b-assembled channels (20 Hz; Fig. 5 D). We have to point out that the determination of the biophysical properties of the P/Q-type channel in HEK293 cells cannot directly be compared with the effects these subunits have on the native presynaptic Ca2  channels. For example, Tottene et al. (2002) showed that the maximal current amplitude (when the peak current was analyzed with voltage step protocols) of the pore-forming human Cav12.1 subunit expressed in neurons from Cav12.1 knockout mice was shifted by –20 mV when compared with the same channel subunit coexpressed with Cav2b and Cav?2e in HEK293 cells. A similar shift in the maximal current amplitude was seen in our experiments when we compared the voltage ramps of rat Cav12.1-, Cav2-, and Cav?2a,4b-assembled channels in HEK293 cells with the non–L-type currents elicited by voltage ramps in noninfected or Cav? subunit–infected neurons. This indicates that non–L-type currents in neurons differ in their biophysical properties probably because of cell type–specific interacting proteins and variations as well as combinations of splice variants contributing to the non–L-type current. The differences in channel opening and, therefore, Ca2  influx correlate well with the observed effects Cav? subunits have on synaptic depression, asynchronous release, and activity-dependent RRP recovery.

Synaptic depression can be achieved via various cellular mechanisms. Therefore, an increase in Ca2  influx leading to faster vesicle depletion is only one possibility (Zucker and Regehr, 2002). Synaptic depression can also be independent of vesicle depletion. For example, a decrease in presynaptic Ca2  influx into the calyx of Held is the major cause of synaptic depression at this synapse type (Xu and Wu, 2005). In addition, a reduction in the AP amplitude during high repetitive firing (>20 Hz) has been correlated with a reduction in the transmitter release (Brody and Yue, 2000). Because we did not observe any change in the AP amplitude when we elicited and measured 20-Hz AP trains in the presence or absence of Cav?2a and Cav?4b subunits, a decline in AP amplitude is most likely not involved in the depression effects observed (Fig. S1, available at http://www.jcb.org/cgi/content/full/jcb.200702072/DC1). Because our synaptic terminals are too small to directly record the Ca2  influx, we cannot exclude the possibility that the presynaptic Ca2  influx into the terminal is reduced. However, the decrease in channel inactivation, particularly for Cav?2a subunit–assembled channels, correlated with the faster RRP recovery and faster onset of asynchronous release does not agree with this mechanism but rather suggests a larger Ca2  influx into the presynaptic terminal./ [9 t: I7 z1 B3 a
- [4 r$ N* t. H/ _) Z# S8 K/ K* F
Cav?4b subunits change the cooperativity of transmitter release

Exogenous expression of Cav?4b subunits induced PPF. PPF occurs at low release probability synapses during high frequency stimulation and is associated with a restricted Ca2  influx during the first AP accompanied by a build up in presynaptic Ca2  concentration and, thus, an increase in the synaptic release probability once the second AP reaches the presynaptic terminal (Thomson, 2000; Zucker and Regehr, 2002). To analyze whether the increase in PPR in the presence of Cav?4b subunits could account for a reduction in channel opening caused by Cav?4b, we examined the possibility of detecting differences in the amount of channels opened by a hippocampal AP. We could not detect substantial differences between the Cav?-assembled channels during the paired-pulse protocol used. To provide an explanation for the facilitation behavior of Cav?4b-expressing synapses, we analyzed several parameters, including Ca2  dependence of the transmitter release, the effect of the expression of Cav? subunits on the contribution of N- and P/Q-type channels to synaptic transmission, and somatic non–L-type currents. We found that the expression of Cav?4b changes the shape of the Ca2  response curve, which is most likely not correlated with a change in the ratio between the P/Q- or N-type channel or a Cav?4b channel–specific effect on the terminal (Fig. S2, available at http://www.jcb.org/cgi/content/full/jcb.200702072/DC1). This result suggests that in the presence of Cav?4b subunits at the presynaptic terminal, the cooperativity of the Ca2 - dependent transmitter release is changed. Recently, the cooperativity of the transmitter release was determined using the same rat hippocampal autapse system. The cooperativity was estimated to around 3 (Reid et al., 1998), a value which we determined and confirmed in our study of wild-type and Cav?2a-expressing neurons. The authors did not find a difference in the contribution between N- or P/Q-type channels. This is important to note because Cav?4 could preferentially assemble with one or the other channel type. For example, the preferential assembly with N- or P/Q-type channels would have important implications for the synaptic transmission at the calyx of Held, where N-type channels are suggested to be further apart from the release site than P/Q-type channels (Wu et al., 1999). The change in cooperativity in the presence of Cav?4b subunits may suggest that the coupling between the Ca2  channels and the release machinery is affected or that the Ca2  channels are more distant from the release site. The idea is supported by our finding that Cav?4b-expressing neurons are more sensitive to the slow Ca2  chelator EGTA. This is an important finding given the recent observation that the N terminus of the Cav?4a subunit can bind synaptotagmin and the microtubule- associated protein 1A (Vendel et al., 2006). This raises the possibility that the Cav?4a subunit is creating a Cav? subunit–specific anchor between the Ca2  channel and the synaptic release machinery (Weiss, 2006), whereas the Cav?4b subunit would not. Therefore, Cav?4b subunit–assembled channels might be further apart from the release machinery or may change the placement of the readily releasing vesicle next to the Ca2  channels, which may cause the change in the Ca2  response curve. In fact, it has been suggested recently that recruitment and placement of the synaptic vesicles to sites where Ca2  channels cluster are important for rapid neurotransmitter release (Wadel et al., 2007).
0 _; ~: ~6 q  ~! `5 ?
Physiological consequences of neuronal Ca2  channels assembled with different Cav? subunits
& ]! I( L! ~0 h) t0 T( C. z7 l
Cav? subunit–specific effects on synaptic transmitter release (i.e., facilitation and/or depression) will arise if a certain subunit is abundant in a neuronal circuit or synapse. For example, in the thalamus, a brain region that is critical for seizure activity, high expression levels of Cav?4 subunits are found, whereas Cav?1–3 subunits seem to be absent or at a lower abundance (Tanaka et al., 1995; Burgess and Noebels, 1999). Loss of Cav?4 subunit function results in absence seizure epilepsy correlated with a reduced excitatory synaptic transmission in the thalamus (Caddick et al., 1999). Cav?2 subunits have been suggested to play a crucial role for Cav1.4 function at the ribbon synapse of the outer plexiform layer of the retina, where these channels mediate glutamate release, whereas the role of Cav?2 within the brain is poorly understood. Because Cav? subunits are targets of protein phosphorylation and regulate the trafficking of the Ca2  channels (Dolphin, 2003; Herlitze et al., 2003), it can be expected that activity-dependent trafficking of specific Cav? subtypes in and out of synaptic terminals may occur as an important mechanism for the regulation of synaptic plasticity within a presynaptic terminal.# e1 p" V0 ^. c5 d) p

Materials and methods

Cell culture. T5 w8 E( B2 S: e7 \  _4 x

Microisland and continental cultures of hippocampal neurons were prepared according to a modified version of published procedures (Bekkers and Stevens, 1991). In brief, hippocampal CA1-CA3 neurons from newborn rats (postnatal day 0–3) were enzymatically dissociated in 2 U/ml DME plus papain (Worthington) for 60 min at 37°C. Dissociated neurons were either plated onto astrocyte-covered poly-D-lysine/collagen (Sigma- Aldrich)-treated microislands that were prepared 3–5 d before plating (autaptic cultures) or were plated onto poly-D-lysine/collagen-treated coverslips that were placed invertly over astrocyte feeder cells (continental cultures). Neuronal cultures were grown in Neurobasal-A media (Invitrogen) supplemented with 4% B-27 (Invitrogen) and 2 mM Glutamax (Invitrogen) for 12–15 d.
/ P5 ^4 c+ @# l6 }0 K; ?
Immunocytochemistry and imaging
+ {+ @9 j8 M1 M2 Z- s. Y' m9 R7 b
Continental hippocampal cultures were prepared as described in the previous section and were infected with GFP-tagged Cav? subunits. 12–18 h after infection, neurons were fixed with 4% PFA and permeabilized with 0.2% Triton X-100 in PBS. Anti–synaptobrevin-II (SYSY) and antisynapsin (Invitrogen) antibodies were used to label the synaptic markers. Neurons were incubated with the primary antibody overnight at 4°C, washed, and incubated with AlexaFluor568-conjugated secondary antibody (Invitrogen) for 30 min at room temperature. Cells were embedded in Prolong Gold Antifade (Invitrogen). Images were acquired with a confocal microscope (LSM 510; Carl Zeiss MicroImaging, Inc.) mounted on an inverted microscope (Axiovert 200M; Carl Zeiss MicroImaging, Inc.). Images were acquired with a 63x oil plan Apo NA 1.4 objective at room temperature, processed with the built-in LSM 510 software (version 3.5; Carl Zeiss MicroImaging, Inc.), and analyzed by using VOLOCITY software (Improvision).: I0 \4 Y3 j* p5 z0 i+ s: V
2 A) H3 |: }1 u% h4 S2 @
Pan-? antibody: x. S6 p/ I' |$ A, h7 w
4 V2 y. v& l) r
Polyclonal anti–pan-? antibody was raised by Harlan Bioproduct for Science according to a published procedure (Vance et al., 1998). In short, a highly conserved peptide sequence presented in all ? subunits (CESYTSRPSDSDVSLEEDRE) was synthesized, and a standard 112-d protocol was used for polyclonal antibody production (Harlan Bioproduct for Science). The specificity of the product was documented with Western blots using rat brain homogenate as well as homogenates of HEK293 cells expressing Cav?1b, Cav?2, Cav?3, or Cav?4 subunit and resulted only in bands with desired molecular weights.: K- c5 [7 }' [/ p- C

Electrophysiology and analysis, x/ O. E1 P0 h+ ?5 b  r
8 x1 [# L3 s- _1 A6 D6 F
For HEK293 cell recordings, HEK293 cells (tsA201 cells) were transfected with the Ca2  channel subunits Cav12.1 and Cav2, with Cav?1b, Cav?2a, Cav?3, or Cav?4b, and with GFP to identify positively transfected cells (molar ratio of 2:1:1:0.25). Whole cell recordings were performed as described previously (Li et al., 2005). For EPSC recordings, only dots containing a single neuron forming excitatory synapses (autapses) were used using an EPC-9 amplifier (HEKA). Recordings were performed at room temperature.
, T4 \4 R9 m! c4 \! K8 m: {
For EPSC measurements as well as for recordings of Ca2  currents in HEK293 cells, the extracellular recording solution contained 172 mM NaCl, 2.4 mM KCl, 10 mM Hepes, 10 mM glucose, 4 mM CaCl2, and 4 MgCl2, pH 7.3; the internal solution contained 145 mM potassium gluconate, 15 mM Hepes, 1 mM potassium-EGTA, 4 mM Na-ATP, and 0.4 mM Na-GTP, pH 7.3. For EGTA experiments (Fig. 9, E and F), the internal solution contained 10 mM potassium EGTA (Sigma-Aldrich), or 50 μM EGTA-AM (Invitrogen) was applied 15 min before recording to the extracellular recording solution. Currents were elicited by a 2-ms-long test pulse to 10 mV and recorded and analyzed as described previously (Wittemann et al., 2000). For recordings using various extracellular Ca2  concentrations (extracellular o), solutions containing different extracellular o were applied directly onto the recorded neurons by using a fast-flow perfusion system (ALA Scientific). Non–L-type channel recordings in cultured hippocampal neurons were performed as previously described (Li et al., 2005; Han et al., 2006). The internal recording solution contained 120 mM N-methyl-D-glucamine, 20 mM tetraethylammonium-Cl–, 10 mM Hepes, 1 mM CaCl2, 14 mM phosphocreatine (Tris), 4 mM Mg-ATP, 0.3 mM Na2GTP, and 11 mM EGTA, pH 7.2, with methanesulfonic acid. The external solution contained 145 mM tetraethylammonium, 10 mM Hepes, 10 mM CaCl2, and 15 mM glucose, pH 7.4, with methanesulfonic acid. In addition, 1 μM tetrodotoxin (Sigma-Aldrich) and 5 μM nimodipine (Sigma-Aldrich) were added to the external solution to block voltage-dependent Na  channels and L-type Ca2  channels. Non–L-type currents were elicited by 500-ms voltage clamp ramps from –60 to 90 mV with 1-min intervals and by 100-ms-long voltage pulses from –60 to 0 mV (Fig. 6 B). Here, capacitative and tail currents were subtracted after the experiment. The sizes of RRPs were measured according to published procedures (Rosenmund and Stevens, 1996; Han et al., 2006). In short, 500 mM sucrose was applied directly onto the recorded autaptic neurons for 4 s by using a fast-flow perfusion system (ALA Scientific). The EPSC and RRP charge was calculated by integrating the currents elicited by the single AP or the sucrose application.5 n3 c0 S  a5 S: S1 `. [; W- r% M
9 l$ L1 {2 X, V' P+ i
The asynchronous and phasic release was calculated as described in Otsu et al. (2004). In brief, we estimated the phasic release by integrating the EPSC after each pulse within the 20-Hz stimulation protocol after subtraction of a baseline value measured 1 ms before each test pulse. The asynchronous release was calculated by subtracting the phasic release from the total integrated current for each EPSC. The holding current was subtracted before integration in every experiment. Statistical significance throughout the experiments was evaluated with analysis of variance using Igor Pro software (Wavemetrics). Standard errors are mean ± SEM.
' j  Q- ]/ c- D2 p* G1 v2 l- ~
Quantitative real-time PCR3 ~* S, p+ S- h7 z! O8 }
  M% @8 n9 E( q/ J6 d6 }# i
107 cells of acutely dissociated hippocampal neurons were plated on poly-D-lysine–collagen–coated plates for continental culture as described in the Cell culture section. The total RNA was subtracted from 14-d in vitro–cultured neurons with the RNeasy Mini kit (QIAGEN) and purified with on-column DNase digestion using the RNase-Free DNase Set (QIAGEN). For RT-PCR, 1 μg RNA was used for reverse transcription with the Advantage RT-for-PCR kit (BD Biosciences) to generate 100 μl cDNA, and 3 μl of the final RT product was used for real-time PCR of each Cav? subunit. Real-time PCR quantification was performed on the iCycler Iq Detection System (Bio-Rad Laboratories) with CYBR green assay (Bio-Rad Laboratories). The DNA fragments of Cav?1b, Cav?2a, Cav?3, and Cav?4b were amplified from cDNA with the following primer pairs: Cav?1b forward (GGCTGTGAGGTTGGTTTCAT) and Cav?1b backward (TGTCACCTGACTTGCTGGAG); Cav?2 forward (CATGAGACCAGTGGTGTTGG) and Cav?2 backward (CAGGGAGATGTCAGCAGTGA); Cav?3 forward (CAGGTTTGATGGCAGGATCT) and Cav?3 backward (GTGTCAGCATCCAACACCAC); Cav?4 forward (GAGAGCGAAGTCCAAACCTG) and Cav?4 backward (TCACCAGCCTTCCTATCCAC); and 18S forward (AAACGGCTACCACATCCAAG) and 18S backward (CCTCCAATGGATCCTCGTTA).

The specificity of RT-PCR products was documented with gel electrophoresis and resulted in a single product with desired length. The melt curve analysis showed that each primer pair had a single product- specific melting temperature. All primer pairs have at least 95% of PCR efficiency, as reported from the slopes of the standard curves generated by iQ software (version 3.1; Bio-Rad Laboratories). The PCR reactions used a modified two-step profile with initial denaturation for 3 min at 95°C, 40 cycles of 95°C for 15 s, and at 57°C for 25 s. Relative gene expression data were analyzed with the 2-CT method (Livak and Schmittgen, 2001)./ U- k$ m; `2 o) F8 Q1 R7 Y8 L

Electron microscopy$ m8 m$ v  u+ R. j) a
; I, m( K, y+ ~- w$ s- j
For immunoelectron microscopy of the cultured hippocampal neurons, 14-d in vitro neurons were infected with GFP-tagged Cav?2a or Cav?4b subunits with the Semliki Forest virus (SFV) expression system for 12 h before fixing with 4% PFA in 1x PBS for 20 min at 4°C. Cells were washed with 1x PBS containing 0.05% (vol/vol) Triton X-100, blocked with 10% goat serum (Invitrogen), and incubated with polyclonal rabbit anti-GFP antibody (Invitrogen) at 4°C overnight. The neurons were then rinsed five times with PBS/0.05% Triton X-100 for 3 min and incubated with goat anti–rabbit IgG conjugated with 10-nm gold particles (Electron Microscopy Sciences) for 2 h at room temperature on a shaker. After rinsing, neurons were fixed with 2% glutaraldehyde and 4% PFA in 0.1 M cacodylate buffer at 4°C overnight. After postfixing with 1% osmium tetroxide and staining with 1% uranyl acetate, neurons were dehydrated through an ethanol series from 50 to 100% ethanol and were transferred to propylene oxide, infiltrated with Embed 812 (Electron Microscopy Sciences) for 12 h, and hardened for 24 h at 60°C. Coverslips were removed, and 60-nm sections were cut on an ultramicrotome (Ultracut E; Reichert-Jung. The slices were recovered on Formvar-coated single slot copper grids and examined in a electronic microscope (JEM-1200EX; JEOL) at 80 kV.
6 h$ G" H" }* A8 x8 D  V( T# l+ ~" \
For the brain slice immunoelectron microscopy, 100-nm-thick adult rat brain slices were prepared on a vibrating blade microtome (VT 1000S; Leica) and immediately infected with GFP-tagged Cav?2a or Cav?4b subunits with the SFV expression system for 12 h in an incubator with 5% CO2 at 37°C. The expression of the subunits was verified by the GFP fluorescent signals before the slices were fixed with 4% PFA in 1x PBS at 4°C overnight. The slices were rinsed with 1x PBS containing 0.05% (vol/vol) Triton X-100 five times for 3 min, blocked with 10% goat serum (Invitrogen), and incubated with a polyclonal rabbit anti-GFP antibody (Invitrogen) overnight at 4°C. Procedures and conditions for the second antibody, postfixation, and embedding, etc., were the same as for cultured neurons.
; `" h2 Y/ e: c
cDNAs and virus production

Rat Cav?1b, Cav?2a, Cav?3, and Cav?4b were gifts from T. Snutch (University of British Columbia, Vancouver, Canada) and E. Perez-Reyes (University of Virginia, Charlottesville, VA). They were cloned in frame into pEGFP-C1–3 vectors (CLONTECH Laboratories, Inc.) and then into the Semliki forest virus vector pSFV1 (Life Technologies) for virus production. Thus, the GFP tag is located on the N terminus of the Cav? subunits.

Membrane fractionation
7 V  o* b- O; I( Y
About 8 x 106 hippocampal neurons were cultured on four collagen/poly-D-lysine–coated 100-mm culture dishes for 14 d and infected with GFP-tagged Cav?1b, Cav?2a, Cav?3, and Cav?4b carrying virus for 13–16 h. Infected or noninfected cells were scraped in 0.32 M sucrose-TBS (0.15 M NaCl and 0.05 Tris, pH 7.4) containing 1x Complete Mini protease inhibitor (Roche) and were homogenized for 50 strokes with Dounce tissue grinder (Wheaton Millville) before promptly being loaded on of freshly prepared 0.8 M/1.2 M sucrose-TBS gradient for centrifugation. Centrifugation was performed in a J-2-21 M/E ultracentrifuge (Beckman Coulter) at 3 x 104 rpm with a SW25.1 rotor for 45 min at 4°C. Equal volumes of the cytosol and membrane fractions were used for Western blots, which were performed according to standard procedures (Mark et al., 1995).
, ~; f( G* `0 J$ _0 I8 L6 E( D
Online supplemental material0 |0 N& N0 V3 q* u5 q
8 D. f- I* |4 {* `% R! m
Fig. S1 shows that the AP amplitude during 20-Hz stimulations is not reduced in noninfected or Cav?2a and Cav? 4b subunits expressing hippocampal neurons. Fig. S2 shows that Cav? subunits expressed in hippocampal neurons do not change the relative contribution of N- and P/Q-type channels to non–L-type currents and EPSCs. Fig. S3 shows that the N terminus of Cav?4b interferes with synaptic transmitter release in hippocampal neurons. Online supplemental material is available at http://www.jcb.org/cgi/content/full/jcb.200702072/DC1.

Acknowledgments

We would like to thank Dr. L. Landmesser for reading the manuscript, Drs. L. Landmesser, R. Miller, and A. Malouf for helpful discussions, and Dr. R. Miller for help with the immunoelectron microscopy.
9 m( i1 f8 E' b
This work was supported by National Institutes of Health grants NS0447752 and NS42623 to S. Herlitze.: z- |' ~, Y  N! B* D( B7 c8 u
      【参考文献】
Ahmari, S.E., J. Buchanan, and S.J. Smith. 2000. Assembly of presynaptic active zones from cylasmic transport packets. Nat. Neurosci. 3:445–451.! E1 u5 u' K2 u! x) J- y

7 o+ E2 m* G6 |
* K& E, W4 V" D
Atluri, P.P., and W.G. Regehr. 1998. Delayed release of neurotransmitter from cerebellar granule cells. J. Neurosci. 18:8214–8227.4 @4 p+ {) I% T  z2 n
* J" R" K1 |$ ~9 D: f

8 N5 i# c* s( c  g0 V
Bekkers, J.M., and C.F. Stevens. 1991. Excitatory and inhibitory autaptic currents in isolated hippocampal neurons maintained in cell culture. Proc. Natl. Acad. Sci. USA. 88:7834–7838.2 ?2 ~! N& ]! B( g. I  `* [, f

' e& |0 P1 X6 m" V1 j4 V+ W
Berggren, P.O., S.N. Yang, M. Murakami, A.M. Efanov, S. Uhles, M. Kohler, T. Moede, A. Fernstrom, I.B. Appelskog, C.A. Aspinwall, et al. 2004. Removal of Ca2  channel beta3 subunit enhances Ca2  oscillation frequency and insulin exocytosis. Cell. 119:273–284.  x* j! E) Z3 g9 o+ K) k$ u6 h* `

; _8 m3 ]' T- m/ D$ Q' E, Z+ S
Bichet, D., V. Cornet, S. Geib, E. Carlier, S. Volsen, T. Hoshi, Y. Mori, and M. De Waard. 2000. The I-II loop of the Ca2  channel alpha1 subunit contains an endoplasmic reticulum retention signal antagonized by the beta subunit. Neuron. 25:177–190.

/ j+ E/ B1 i5 R* o( @3 \/ ?
3 v) g! y) a0 T4 f
Bogdanov, Y., N.L. Brice, C. Canti, K.M. Page, M. Li, S.G. Volsen, and A.C. Dolphin. 2000. Acidic motif responsible for plasma membrane association of the voltage-dependent calcium channel beta1b subunit. Eur. J. Neurosci. 12:894–902.
+ ]$ r0 ^+ u  ?8 N5 I7 V' |+ w. O( [

- O% o/ X7 ?% L( m) i) w% {1 J
Brody, D.L., and D.T. Yue. 2000. Release-independent short-term synaptic depression in cultured hippocampal neurons. J. Neurosci. 20:2480–2494.

Burgess, D.L., and J.L. Noebels. 1999. Voltage-dependent calcium channel mutations in neurological disease. Ann. NY Acad. Sci. 868:199–212.
- Q2 p) G5 g/ y  C

0 `8 j) C, V0 y: B* W
Caddick, S.J., C. Wang, C.F. Fletcher, N.A. Jenkins, N.G. Copeland, and D.A. Hosford. 1999. Excitatory but not inhibitory synaptic transmission is reduced in lethargic (Cacnb4(lh)) and tottering (Cacna1atg) mouse thalami. J. Neurophysiol. 81:2066–2074.
5 X+ p3 N7 }" l  R0 ^# h

: J2 e* l% U7 ?+ X8 [0 V1 J0 `
Catterall, W.A. 2000. Structure and regulation of voltage-gated Ca2  channels. Annu. Rev. Cell Dev. Biol. 16:521–555." ]* o. E- w4 _. Y
1 P' P# W9 \( W% [

Chen, Y.H., M.H. Li, Y. Zhang, L.L. He, Y. Yamada, A. Fitzmaurice, Y. Shen, H. Zhang, L. Tong, and J. Yang. 2004. Structural basis of the alpha1-beta subunit interaction of voltage-gated Ca2  channels. Nature. 429:675–680.
. r4 j3 [+ B( w  [
' |$ w6 `( q2 H0 c* P2 e
" c% T' F( i2 V- j: Z
Chien, A.J., T. Gao, E. Perez-Reyes, and M.M. Hosey. 1998. Membrane targeting of L-type calcium channels. Role of palmitoylation in the subcellular localization of the beta2a subunit. J. Biol. Chem. 273:23590–23597.6 Z) W  E$ X9 `
3 g0 e9 }, k1 \/ c
7 R( j) x0 |6 S; o
  p" N! f" ?( G$ h+ m9 c
Dolphin, A.C. 2003. Beta subunits of voltage-gated calcium channels. J. Bioenerg. Biomembr. 35:599–620.  k/ E2 x+ X. [9 \+ ]+ P$ @) w8 s

, |  D# I# d+ L$ m; V& E1 Q
, E7 u& V, ?. d: ~4 z
Fellin, T., S. Luvisetto, M. Spagnolo, and D. Pietrobon. 2004. Modal gating of human CaV2.1 (P/Q-type) calcium channels: II. the b mode and reversible uncoupling of inactivation. J. Gen. Physiol. 124:463–474.

# D3 [$ N; j4 L9 S( |
3 u4 c! ^) _' q- }& J4 g8 B
Han, J., M.D. Mark, X. Li, M. Xie, S. Waka, J. Rettig, and S. Herlitze. 2006. RGS2 determines short-term synaptic plasticity in hippocampal neurons by regulating Gi/o mediated inhibition of presynaptic Ca2  channels. Neuron. 51:575–586.+ `4 f; Q5 @: H4 ^( Z
. D( l, O. Q9 i. l9 Q$ s9 x! o
+ s  M( U# ?0 G: \  U. u7 ~

Hanlon, M.R., N.S. Berrow, A.C. Dolphin, and B.A. Wallace. 1999. Modelling of a voltage-dependent Ca2  channel beta subunit as a basis for understanding its functional properties. FEBS Lett. 445:366–370.

Herlitze, S., and M.D. Mark. 2005. Distribution and targeting mechanisms of voltage activated Ca2  channels. In Voltage-Gated Calcium Channels. G.W. Zamponi, editor. Kluwer Academic/Plenum Publishing Corp., New York. 113–40./ d& y4 g* p2 i5 n) `4 L4 x' c
) B$ N# G( _+ x

Herlitze, S., D.E. Garcia, K. Mackie, B. Hille, T. Scheuer, and W.A. Catterall. 1996. Modulation of Ca2  channels by G-protein beta gamma subunits. Nature. 380:258–262.
7 h2 R4 G6 R7 X1 n: `
+ ^% Y+ F4 @( g# @- E- @6 [

Herlitze, S., G.H. Hockerman, T. Scheuer, and W.A. Catterall. 1997. Molecular determinants of inactivation and G protein modulation in the intracellular loop connecting domains I and II of the calcium channel alpha1A subunit. Proc. Natl. Acad. Sci. USA. 94:1512–1516.

. @8 |0 a- U* C
* r& ?7 ~& U" T- u8 V) Q
Herlitze, S., H. Zhong, T. Scheuer, and W.A. Catterall. 2001. An allosteric mechanism for modulation of Ca2  channels by G proteins, voltage-dependent facilitation, protein kinase C, and Cavb subunits. Proc. Natl. Acad. Sci. USA. 98:4699–4704.

Herlitze, S., M. Xie, J. Jan, A. Hümmer, K.V. Melnik-Martinez, R.L. Moreno, and M.D. Mark. 2003. Targeting mechanisms of high voltage-activated Ca2  channels. J. Bioenerg. Biomembr. 35:621–637.
+ r& \8 W% n) H7 x7 @: P

Hibino, H., R. Pironkova, O. Onwumere, M. Rousset, P. Charnet, A.J. Hudspeth, and F. Lesage. 2003. Direct interaction with a nuclear protein and regulation of gene silencing by a variant of the Ca2 -channel beta 4 subunit. Proc. Natl. Acad. Sci. USA. 100:307–312.1 v  D$ t$ W! Z4 i; t
' u( |/ z' ^+ N/ F

Li, X., A. Hummer, J. Han, M. Xie, K. Melnik-Martinez, R.L. Moreno, M. Buck, M.D. Mark, and S. Herlitze. 2005. G protein beta2 subunit-derived peptides for inhibition and induction of G protein pathways. Examination of voltage-gated Ca2  and G protein inwardly rectifying K  channels. J. Biol. Chem. 280:23945–23959.

! A& M' M9 j  Y7 c  @$ `3 B8 q
Livak, K.J., and T.D. Schmittgen. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 25:402–408.% |0 F' x7 ?% j2 U

) \; W  Y$ h1 O9 f
Luvisetto, S., T. Fellin, M. Spagnolo, B. Hivert, P.F. Brust, M.M. Harpold, K.A. Stauderman, M.E. Williams, and D. Pietrobon. 2004. Modal gating of human CaV2.1 (P/Q-type) calcium channels: I. The slow and the fast gating modes and their modulation by ? subunits. J. Gen. Physiol. 124:445–461.# x7 R7 Q/ l( V
' O/ F% v6 D) u" a$ Y$ Z, Z. _; Q6 X7 g

8 T* Z- @0 h4 y
Mark, M.D., Y. Liu, S.T. Wong, T.R. Hinds, and D.R. Storm. 1995. Stimulation of neurite outgrowth in PC12 cells by EGF and KCl depolarization: a Ca(2 )-independent phenomenon. J. Cell Biol. 130:701–710.

7 d/ B7 x# o: Y0 Y# s. \  v' e

Mark, M.D., S. Wittemann, and S. Herlitze. 2000. G protein modulation of recombinant P/Q-type calcium channels by regulators of G protein signalling proteins. J. Physiol. 528:65–77.

8 T$ X' {+ M  C' I2 ?0 o) w2 C
/ G1 ^/ j' {8 z6 w- k
Maximov, A., and I. Bezprozvanny. 2002. Synaptic targeting of N-type calcium channels in hippocampal neurons. J. Neurosci. 22:6939–6952.

McGee, A.W., D.A. Nunziato, J.M. Maltez, K.E. Prehoda, G.S. Pitt, and D.S. Bredt. 2004. Calcium channel function regulated by the SH3-GK module in beta subunits. Neuron. 42:89–99.

Opatowsky, Y., C.C. Chen, K.P. Campbell, and J.A. Hirsch. 2004. Structural analysis of the voltage-dependent calcium channel beta subunit functional core and its complex with the alpha 1 interaction domain. Neuron. 42:387–399.6 \) `) `; o/ ~* Z! V2 x

, A- j& A/ U1 [: C
6 c0 u: K7 d5 j3 P
Otsu, Y., V. Shahrezaei, B. Li, L.A. Raymond, K.R. Delaney, and T.H. Murphy. 2004. Competition between phasic and asynchronous release for recovered synaptic vesicles at developing hippocampal autaptic synapses. J. Neurosci. 24:420–433.$ z: S/ H, A2 w( ^8 G
$ \1 M3 Q4 v, a* K7 [, Y- U+ q6 Z

Reid, C.A., J.M. Bekkers, and J.D. Clements. 1998. N- and P/Q-type Ca2  channels mediate transmitter release with a similar cooperativity at rat hippocampal autapses. J. Neurosci. 18:2849–2855.( p5 o6 p% ?" _7 J! d" s

+ N9 _2 s5 s$ b; J2 W" T

Richards, M.W., A.J. Butcher, and A.C. Dolphin. 2004. Ca2  channel beta-subunits: structural insights AID our understanding. Trends Pharmacol. Sci. 25:626–632.

- G6 I- o2 i$ n7 q% O+ A. F
Rosenmund, C., and C.F. Stevens. 1996. Definition of the readily releasable pool of vesicles at hippocampal synapses. Neuron. 16:1197–1207.5 a8 o3 u. a$ P) `7 x
. ~7 O) ?+ O% b( e) f9 z

Rousset, M., T. Cens, and P. Charnet. 2005. Alone at last! New functions for Ca2  channel beta subunits? Sci. STKE. doi:10.1126/stke.2752005pe11.

Shapira, M., R.G. Zhai, T. Dresbach, T. Bresler, V.I. Torres, E.D. Gundelfinger, N.E. Ziv, and C.C. Garner. 2003. Unitary assembly of presynaptic active zones from Piccolo-Bassoon transport vesicles. Neuron. 38:237–252.( S9 {4 `5 f1 W

Stea, A., W.J. Tomlinson, T.W. Soong, E. Bourinet, S.J. Dubel, S.R. Vincent, and T.P. Snutch. 1994. Localization and functional properties of a rat brain alpha 1A calcium channel reflect similarities to neuronal Q- and P-type channels. Proc. Natl. Acad. Sci. USA. 91:10576–10580.2 l5 A6 N1 v  c* Q" _' b8 O( s
  M. C( E2 T% l& a: v! F- N( n

/ D2 d. o! G, f% t2 o( G
Stevens, C.F., and J.F. Wesseling. 1998. Activity-dependent modulation of the rate at which synaptic vesicles become available to undergo exocytosis. Neuron. 21:415–424.) c1 L! I4 v- b/ w
( Q9 K) Z  O! O- D$ g- J6 D0 n

# ^. `0 u. O* P3 O0 D; n% ?
Tanaka, O., H. Sakagami, and H. Kondo. 1995. Localization of mRNAs of voltage-dependent Ca(2 )-channels: four subtypes of alpha 1- and beta-subunits in developing and mature rat brain. Brain Res. Mol. Brain Res. 30:1–16.

  {" m& d7 Y3 c) u+ c- i4 m, _6 Y9 V

Thomson, A.M. 2000. Facilitation, augmentation and potentiation at central synapses. Trends Neurosci. 23:305–312.5 R6 ?( |2 h, F" i
  A; `. ]! C( @7 u+ s$ J, l' S
& s4 Y7 G  c6 P* E
8 b; g+ @7 d) R6 j0 }+ }
Tottene, A., T. Fellin, S. Pagnutti, S. Luvisetto, J. Striessnig, C. Fletcher, and D. Pietrobon. 2002. Familial hemiplegic migraine mutations increase Ca(2 ) influx through single human CaV2.1 channels and decrease maximal CaV2.1 current density in neurons. Proc. Natl. Acad. Sci. USA. 99:13284–13289.+ ~* K4 ]& Y( J! |. }! B
4 }, H/ ]; g7 G5 e8 v9 T) m% R
3 b2 J6 A" P0 f4 N% i

Van Petegem, F., K.A. Clark, F.C. Chatelain, and D.L. Minor Jr. 2004. Structure of a complex between a voltage-gated calcium channel beta-subunit and an alpha-subunit domain. Nature. 429:671–675.* V6 ?9 u2 T. s% c
- j( j' S5 U# w! ?# C

Vance, C.L., C.M. Begg, W.L. Lee, H. Haase, T.D. Copeland, and M.W. McEnery. 1998. Differential expression and association of calcium channel alpha1B and beta subunits during rat brain ontogeny. J. Biol. Chem. 273:14495–14502.% P1 v8 X  x: l6 @

Vendel, A.C., M.D. Terry, A.R. Striegel, N.M. Iverson, V. Leuranguer, C.D. Rithner, B.A. Lyons, G.E. Pickard, S.A. Tobet, and W.A. Horne. 2006. Alternative splicing of the voltage-gated Ca2  channel beta4 subunit creates a uniquely folded N-terminal protein binding domain with cell-specific expression in the cerebellar cortex. J. Neurosci. 26:2635–2644., @+ e" U' @! f; j2 p( \
" P: X: B" P. F4 r: {; U, A. R" u

Wadel, K., E. Neher, and T. Sakaba. 2007. The coupling between synaptic vesicles and Ca(2 ) channels determines fast neurotransmitter release. Neuron. 53:563–575.

4 B  @( }$ L) }; {4 z% b

Weiss, N. 2006. The calcium channel beta4a subunit: a scaffolding protein between voltage-gated calcium channel and presynaptic vesicle-release machinery? J. Neurosci. 26:6117–6118.5 t) {( _1 Z6 Q! p9 k
5 E4 \: _) z: X

6 F. l' T' [. w7 G; `
Wittemann, S., M.D. Mark, J. Rettig, and S. Herlitze. 2000. Synaptic localization and presynaptic function of calcium channel beta 4-subunits in cultured hippocampal neurons. J. Biol. Chem. 275:37807–37814.
& Z( ~/ t3 ~, F( d& L

% R* U! ]& Y3 H. S
Wu, L.G., R.E. Westenbroek, J.G.G. Borst, W.A. Catterall, and B. Sakmann. 1999. Calcium channel types with distinct presynaptic localization couple differentially to transmitter release in single calyx-type synapses. J. Neurosci. 19:726–736.
/ E' ^3 @# {( [4 V% v7 O9 F9 Z6 r2 S
  x. w: Y' A( N' t

Xu, J., and L.G. Wu. 2005. The decrease in the presynaptic calcium current is a major cause of short-term depression at a calyx-type synapse. Neuron. 46:633–645.

( N( K% x3 {- a- G
Zucker, R.S., and W.G. Regehr. 2002. Short-term synaptic plasticity. Annu. Rev. Physiol. 64:355–405.

收藏0 分享0 顶0 踩0