|
 
- 积分
- 429
- 威望
- 429
- 包包
- 1768
|
本帖最后由 qianqianlaile 于 2011-3-22 22:26 编辑 6 P3 f) [6 @: s! u! o
% P! F7 E7 _: G2 n8 L) l9 B* F
MATERIALS AND METHODS 6 W( H ~) c: G. I& B- \
Isolation of Dental-Derived Stem Cells (PDLSCs, SHEDs)
. I% t3 e3 `1 x% Z0 iPDLSCs and SHEDs were harvested as previously described (Miura et. al, 2003; Seo et. , a8 b, ]/ H4 `& _; U, [
al, 2004). Briefly, PDLSCs were scraped from the root surface of a tooth into a p60 dish
1 D+ x2 z7 G% m+ F/ V: K gcontaining minimum essential alpha medium (DMEM, Gibco) and SHEDs were harvested by
! d8 N m7 G' F9 V5 escraping out the dental pulp tissue from a deciduous tooth into a p60 dish containing DMEM.' N. [; S- I$ k! J+ y0 H4 s$ G
After collection, the cells were centrifuged at 1600 rpm for 5 minutes at room temperature. The ; W0 H' b# Q. f' `& T+ V+ L
supernatant was aspirated and the cells were resuspended in a phosphate buffered saline (PBS;
H/ ^3 Z: e0 D* d& mGibco #14190) solution with 4 mg/ml Dispase II (Roche #04 942 078 001) and 2 mg/ml' P7 c3 ~6 s* d% ~! F3 u4 N1 b
Collagenase Type II (Worthington # LS004196) and incubated at 37°C for 60 minutes. The
. e% p+ g9 X4 M% R% p; j5 zenzyme solution was inactivated with 5 ml of DMEM- 15% FBS- 100µM ascorbic acid 2
" s3 N. _$ X% J) Q7 jphosphate (ASAP, Sigma A-8960) and centrifuged at 1600 rpm for 5 minutes at room1 B- l( t ^8 j7 o1 m; s) k7 }
temperature. Cells were resuspeneded in 5 ml DMEM- 15% FBS- 0.1mM ASAP and transferred ' A8 H( K3 ]8 d2 b8 K* z
to T-25 flasks. Media was changed the next day and then every 2-3 days. 5 D$ a$ |: h7 X. w- B
Cell Culture
" v0 R2 r. @, K/ h3 j# ?0 W* r1 ? Cells were expanded in culture in DMEM, Iscove’s modified Dulbecco’s media (IMDM,
( [, E6 _" L1 O& {$ z2 yGibco-Invitrogen #12571), Gibco Stem Pro Mesenchymal Stem Cell Serum-Free Media
) v% h B+ R6 u6 x/ ]8 i" Y(MSCSFM; Invitrogen# A1033401) or Lonza Therapeak Mesenchymal Stem Cell Growth 2 m1 i6 q/ @ z3 |+ T; y
Media- Chemically Defined (MSCGM-CD; Lonza #00190632) and grown in a 37°C humidified5 D# ]3 p" I7 K( Y8 ?5 M& u$ h1 O1 A8 z
tissue culture incubator at 5% CO2. Media formulations are as follows: DMem (Gibco-
$ E* m- w/ }/ U! J+ S3 V$ sInvitrogen #12571) with 15% FBS (Gibco-Invitrogen-16000), 100µM ASAP and 5 µg/ml
( p# G5 x' ?3 `& ?Gentamicin (Invitrogen # 15750060) (FBS-M); DMem with 2% bovine serum albumin (BSA; " E7 g; l: | x4 G( n5 R+ l
Sigma A7888), 10ug/ml human insulin (Sigma), 4ug/ml low density lipoprotein, 200ug/ml* F, \% @3 ~; a; W4 ?9 m. t
transferrin, 10 nM dexamethasone, 100 uM ASAP, 50 uM ȕ-mercaptoethanol, 5 ug/ml
7 d, A' j( I( j- M3 [9 tgentamicin, 10ng/ml platelet-derived growth factor (PDGF; Sigma), 10ng/ml epidermal growth 3 g2 s9 [+ N& q' Y. E
factor (EGF; R&D Systems), 10ng/ml basic fibroblast growth factor (b-FGF, Sigma) (SDM);) N. i7 E& ?9 K! \: v' U& S
IMDM with 0.2% BSA, SITE 3 (Sigma #S5295), 384µM ASAP, 10 ng/ml PDGF, 10ng/ml4 I/ ~8 ]& f) N& U* q
hydrocortisone 5ng/ml b-FGF, 1 ng/ml EGF, 10-7
% F0 w @5 W) i$ U mgm/ml parathyroid hormone (PTH) and 5
! ~% t& ^* \+ q7 B. _- xµg/ml gentamicin (K-M). Media on the cells were changed every 2 or 3 days. Cells were grown
& Z+ ?- M4 M0 P ?in T-150 flasks to about 80% confluency then media was aspirated from the flasks, cells were
& s: r* o$ ]5 n' V- k" O+ }washed with PBS and trypsinized with TrypLE Express (Gibco#12605) before being split into 12 ^( |+ q) o. }# j$ t
well plates for the assays. 8 Q/ K" |( O- v* l- b7 z9 C; i
Fibronectin Coating of Tissue Culture Plates
, K4 I. |* Z5 C/ ?Fibronectin (FN) was coated on the plates and flasks to provide growth and attachment
8 A2 J" r1 E# }1 g( v* X, ^support for cells grown in the serum-free, IMDM media. For the 12 well plates, 0.1% FN
' h' y% s: @$ p! {$ F8 @solution (Sigma F-1141) was diluted in PBS so that each well received 3.8 micrograms per well 0 a/ m$ W2 K4 J" s. o: ]' D
(1µg FN/cm2). The T-150 flasks were coated so that each received 150 micrograms of FN (1µg
1 A3 E: ]; e+ U' f- M, l: _FN /cm2). The plates and flasks were tilted back and forth to ensure complete coverage of the
' U8 W! I6 W0 MFN solution. The FN coating was allowed to stand at room temperature for 90 minutes. The FN ' W' H& M z$ a. W. Y) S
solution was then aspirated before the resuspended cells were transferred to the flasks and plates.! ~- m) s5 a; B
Proliferation Assays
; Q8 O& A; l/ _# c% I# CAfter trypsinization cells were resuspended in an equal amount of the appropriate media
. l8 I U+ F1 r3 p9 b# B/ abefore an aliquot was removed for counting on a hemocytometer to determine the concentration. p7 a3 F: H' q8 v- a, L
The cells were then centrifuged at ~1600 rpm for 5 minutes at room temperature. Cells were % O9 G1 C1 W9 M8 W1 B3 ^$ I8 N6 A
resuspended in the appropriate media at a concentration of 3800 cells per ml. One milliliter of $ t$ K! c6 |/ H) H. D0 H7 S) {( ^
cells was dispensed into each well of a 12 well plate. K-M plates were precoated with FN ( K9 G0 @7 d% s0 a- O$ u% d- k
solution (as outlined above). Four plates for each cell type and media condition were plated and
( ?6 F9 H* I* c3 R# lcounted on a hemocytometer at days 1, 3, 5 and 7 to determine the cell numbers within each p# ~+ B3 _2 T7 e
well. All experiments were performed in triplicate. & {0 ]# @* b+ V3 h! k" A
RNA Isolation and Purification for MicroArray
/ j" k' i y2 ?; ^! _0 ]" D0 DPDLSCs and SHEDs were grown in T-75 flasks to 80% confluency before the cells were
% \6 \: |. H, U) L0 i; W: Lharvested for RNA. The Trizol method (Invitrogen) was used for RNA isolation. This involved ! T% C6 f8 S! ]" [4 q8 J% i
washing the cell layer with PBS, adding Trizol directly to the cells and transferring this cell
g* q7 k# U4 X2 F( [suspension to polypropylene tubes. RNA was isolated from the cells by a Trizol-choloroform; m0 q: ^, p5 D% V$ H0 J
extraction, isopropanol precipitation, an ethanol rinse and resuspension of theRNA pellet in
' ^' \- i6 b: {" pDiethylpyrocarbonate (DEPC) water. The RNA was further purified by column
% f" Y/ l2 c& U2 b9 [( [$ Bchromatography, following manufacturer’s instructions (Qiagen RNeasy Kit # 74104), and
2 w; q& z1 n. M" R$ aresuspended in DEPC water. RNA concentration was determined by the 260/280 absorbance 9 F. ~, V" _% b3 M4 d. m+ y
measurement using a Beckman DU540 spectrophotometer.
: v" q$ q7 J2 C" |7 _, p- o* g d6 GIn Vitro Multilineage Differentiation 2 ?' C9 q, Z* }! X5 K6 H3 }
Multipotency of PDLSCs and SHEDs was determined through lineage specific 5 i, |4 ~* s5 b
osteogenic, chondrogenic, and adipogenic induction, according to previously described methods
- f1 l" ~' ^- q- \. z4 U! o(Pittenger et. al, 1999). Briefly, cells were plated at a density of 30,000 cells per well in 12 well ) b+ c$ u0 c' x Q: I: s
plates. At 80% confluency cells were induced with osteogenic [Growth media plus 5mM E-
: T2 B( V# C5 p' H+ Oglycerophosphate, 100nM dexamethasone, 50µM ascorbic acid 2-phosphate] or chondrogenic 8 v: A& S6 ^& \
[growth media plus 50µM ascorbic acid 2-phosphate, 100nM dexamethasone, 5 µg/ml human
+ x* [# v1 ]- S8 u ^ q8 ^insulin (Sigma I-9278), 1 ng/ml TGFE, 400µM proline, 1X Non essential amino acids] or
9 q/ d9 d: v& W4 S. b t: T$ madipogenic [growth media plus 0.5mM IBMX, 1 µM dexamethasone, 10 µg/ml human insulin,
& b: I5 J8 ~ n! e200µM indomethacin] induction media. Cells were grown at 37°C in a humidified 5% CO2$ E F1 y3 F: n2 a9 P
incubator. The media was changed every 2-3 days. At three weeks the cells were fixed and / Y2 f6 b7 Z' M, s' M
stained as outlined below.
/ j# | U. M7 ~$ q% c ~( ~Multipotent Staining of PDLSCs and SHEDs
% V4 m8 i- k5 R+ x$ B, cTo identify the mineralized nodules, induced PDLSC, SHED and DPSC were fixed in 4% ) N- }) }& g( q2 p
paraformaldehyde for 30 minutes, immersed in fresh 5% silver nitrate and incubated in the dark 9 q P6 b& I, S
for 30 minutes. After washing in water the PDLSC, SHED and DPSC were exposed to
0 V" \* H: |2 p6 Z( p8 Q4 Z# |ultraviolet light for 30 minutes followed by a four minute incubation in 1% sodium thiosulfate to 4 u3 p: w/ ~+ n$ l. L; e
neutralize the silver nitrate. Cells were washed twice with water before 1 ml of PBS was added ! `4 b K2 C; i" K- }0 \8 m; d
to each well and viewed. Plates were stored at 4°C. . I z' Z" a; p/ ?$ {
To detect chondrogenic differentiation induced PDLSC, SHED and DPSC were fixed in
5 D4 X$ m: Z" N9 L. |# O+ D5 icold 100% methanol for 30 minutes and then exposed to 1% alcian blue in 0.1N HCl for 30 m- f! @% ?$ A2 {: v8 k
minutes. Cells were washed twice with 0.1N HCl before 1 ml of PBS was added to each well + D* n) J/ c9 K
and viewed. Plates were stored at 4°C.# L: y1 r# r6 b) Z3 V) |
To detect adipogenic differentiation by identifying lipid vesicles, induced PDLSC, SHED
& F" K" h% s) y# B) F2 Tand DPSC were fixed in 4% paraformaldehyde for 30 minutes, and then immersed in 0.3% oil
( a$ f; R5 R# Ored O solution for 30 minutes. Cells were washed twice with water before 1 ml of PBS was
! i/ {6 Y& R) [) cadded to each well and viewed. Plates were stored at 4°C. / C, I. T' w, w/ f8 Q5 e# t: x
Alkaline Phosphatase Activity and Detection @# Q7 S% ~3 @" ^/ q
Early osteogenic differentiation was detected and quantified by the alkaline phosphatase
% H) h- i% [* \) E2 C3 \(ALP) enzyme assay. Cells were plated at a density of 30,000 cells per well in 12 well plates.
6 ?7 W" L, Z$ [ }/ l0 _+ p$ A/ [" p4 kAt 80% confluence, cells were induced with osteogenic media as described above. The media5 ?+ i2 T# R( k1 q5 {
was changed every 2-3 days and after one week, ALP activity was measured.1 k- W5 R$ L$ y5 d" }
To detect phosphatase activity, PDLSCs and SHEDs were fixed in 70% ethanol for 30 9 z/ j* P# p' C% A! Q
minutes. They were then incubated with freshly made substrate containing naphthol AS-TR
+ i! f8 k) ?2 c3 D: l5 L( Qphosphate (Sigma) and Fast blue (Sigma) for 30 minutes. Cells were washed twice with PBS then 4 M/ F+ h! E) n9 E
viewed or stored at 4’C.
/ E2 P8 P. O8 bTo quantify the ALP activity and normalize the results, cells were lysed in Passive Lysis
- c4 D% p& p6 u9 l f, jBuffer (Promega) according to manufacturer’s instructions. Cell lysates were then sonicated,
6 ?3 F1 b8 [2 x# t3 K7 W! Gand centrifuged (10,000 rpm for 10 minutes at 4°C). The supernatant was recovered for the
' Y! T- Z4 E- B4 P" M7 N, }; Oquantitative colormetric ALP assay (Manolagas et al., 1981) and the cell pellet was used for
* R) O0 T* c/ p+ T) w6 x n1 }; kDNA isolation and the determination of the DNA concentration using the Quant-iT™ dsDNA - z. D% F/ S& c7 x( f5 {% g8 m2 e
BR Assay (Invitrogen) per the manufacturer’s instructions. $ U! U/ u' N/ @
Reverse Transcriptase Polymerase Chain Reaction (RT-PCR)
/ N1 K; E1 {7 L: CTo confirm chondrogenic and adipogenic differentiation, total PDLSC and SHED cellular
+ X2 P0 R+ z3 b* Y4 _RNA was extracted, reverse transcribed, and amplified using osteoblast specific gene primers.( z1 f. K* K" H v7 t- [) J7 |
Media from the wells of induced and uninduced PDLSCs and SHEDs were aspirated. Cells ! t+ p9 q6 U) k1 m2 e
were immediately resuspended in 1 ml of Trizol (Invitrogen) and RNA was isolated according to
6 S& {0 s3 }; R/ J: w, jthe manufacturer’s instructions. Synthesis of cDNA was performed using Invitrogen’s 5 N4 e3 ?- G% O1 E+ b7 B1 l
SuperScriptII kit and oligo dT. PCR reaction components and concentrations were as described 0 A0 v- Q, u8 P0 T* a6 x
in the Invitrogen Platinum Taq polymerase instructions using the primer sets below. An MJ : o* d7 [3 |) H3 K: g) j. D: W7 f: {
themorcycler was used for the following two PCR reaction conditions:
' y! P5 b( r6 q4 b- f9 m6 H*94°C 2 minutes [94°C 45” 56°C 45” 72°C 1’] X 35 cycles 72°C 15’ A7 r/ w3 F! \2 K- T: K
or: |5 R. Y& A& P9 w/ x( A: B1 C
**94°C 2 minutes [94°C 45” 67°C 45” 72°C 1’] X 35 cycles 72°C 15’
2 s9 W3 s' T8 y9 wPCR Primer Pairs + ~9 z- n5 A( D
Primer Name Primer Sequence Product) y ^+ B ]9 y( N
Size ]6 V8 I R; Q+ H, x7 d. J
Accession
r7 H$ ]% u0 y7 x; r' d( g3 XNumber9 i/ h& d1 v6 H p% ?
*GAPDH FWD AGCCGCATCTTCTTTTGCGTC 815 bp NM_002046
1 l: i/ I' S- G" l |7 E: q' P*GAPDH REV TCATATTTGGCAGGTTTTTCT
- A- u- ^; h/ E5 n" `& N) g$ DPPARJ2 FWD GCTGTGCAGGAGATCACAGA 226 bp NM_0050376 Z+ B6 a Q. a2 z% \' h& Q
PPARJ2 REV GGGCTCCATAAAGTCACCAA
2 T0 D; _; W( s; j5 t! rLipoprotein lipase FWD GTCCGTGGCTACCTGTCATT 212 bp NM_000237+ {# ~# w9 S6 H& P8 g! v' p
Lipoprotein lipase REV TGTCCCACCAGTTTGGTGTA
3 ~/ d: k% E% J9 p) K$ R# ?. YSox 9 FWD TTGAGCCTTAAAACGGTGCT 224 bp NM000346, F1 F1 y' p8 b& ?
Sox 9 REV CTGGTGTTCTGAGAGGCACA; x8 c" h2 Y5 M% Z
Type X collagen FWD TGAGCAGCAACGTAAAAACG 471 bp NM_00049/ E+ n0 X; e+ ^4 l
Type X collagen REV AGGAAATGCCGAGTTTCTCA
: S8 [7 W5 R; O* M5 |Statistical Analysis 0 V: [ E" U9 Z' X/ J' U( L
Statistical analysis was performed with the use of Instat software (GraphPad Software, San 2 ?+ n9 ~0 |# ~5 o
Diego, CA, USA). All data were plotted as mean ± standard error of the mean (SEM), unless
& P+ p; P% \/ Totherwise noted. Statistically significant differences were determined by two-tailed Student t9 n. p2 a" x' A
tests, and statistical significance was defined as p < 0.05. |
|
发表于 2011-3-20 08:21
，脑子里也没有独家生产这个概念
，所以没理解。
