|
 
- 积分
- 429
- 威望
- 429
- 包包
- 1768
|
本帖最后由 qianqianlaile 于 2011-3-22 22:26 编辑
- T; E4 j2 M# D( k+ U5 t' t# W- A* j9 n% \9 t# _; t1 T
MATERIALS AND METHODS
" z' ?. ?% v% q- E+ FIsolation of Dental-Derived Stem Cells (PDLSCs, SHEDs)
. f6 Y( f4 Z' G% k* E" `! v \/ fPDLSCs and SHEDs were harvested as previously described (Miura et. al, 2003; Seo et.
) J2 t- q' e* s, Yal, 2004). Briefly, PDLSCs were scraped from the root surface of a tooth into a p60 dish o1 X/ Z+ {& H4 _; W7 y1 J
containing minimum essential alpha medium (DMEM, Gibco) and SHEDs were harvested by
3 b( W y* m+ q9 A pscraping out the dental pulp tissue from a deciduous tooth into a p60 dish containing DMEM." m: {- d7 b! v& j# e" K
After collection, the cells were centrifuged at 1600 rpm for 5 minutes at room temperature. The
- g7 C- @' X. M/ i% k; _supernatant was aspirated and the cells were resuspended in a phosphate buffered saline (PBS; - v6 X8 |, B& c# H1 n
Gibco #14190) solution with 4 mg/ml Dispase II (Roche #04 942 078 001) and 2 mg/ml( A, c8 \" G" i* {
Collagenase Type II (Worthington # LS004196) and incubated at 37°C for 60 minutes. The
9 S7 p3 r1 Q: _# Ienzyme solution was inactivated with 5 ml of DMEM- 15% FBS- 100µM ascorbic acid 2 1 \* n) J8 k5 T" T9 m/ q
phosphate (ASAP, Sigma A-8960) and centrifuged at 1600 rpm for 5 minutes at room
0 w1 x# D1 B+ m' i; Atemperature. Cells were resuspeneded in 5 ml DMEM- 15% FBS- 0.1mM ASAP and transferred
1 K% s+ t% f. y7 v! ]* A/ p$ \to T-25 flasks. Media was changed the next day and then every 2-3 days. 7 F; W C* Q2 e1 l9 R0 {
Cell Culture1 v1 G' j/ g8 k! T! s7 X4 T# G
Cells were expanded in culture in DMEM, Iscove’s modified Dulbecco’s media (IMDM,
1 P3 @8 S) z, F- m0 ^2 s EGibco-Invitrogen #12571), Gibco Stem Pro Mesenchymal Stem Cell Serum-Free Media
+ N: m+ ~3 P, ^5 n! M) x5 M(MSCSFM; Invitrogen# A1033401) or Lonza Therapeak Mesenchymal Stem Cell Growth ( F9 p" Y8 i+ r% c5 _" ?- L
Media- Chemically Defined (MSCGM-CD; Lonza #00190632) and grown in a 37°C humidified
- Z; L: c2 E- ftissue culture incubator at 5% CO2. Media formulations are as follows: DMem (Gibco-
/ W7 H0 j! o% JInvitrogen #12571) with 15% FBS (Gibco-Invitrogen-16000), 100µM ASAP and 5 µg/ml% n4 o' h4 L5 ~! b# D7 s
Gentamicin (Invitrogen # 15750060) (FBS-M); DMem with 2% bovine serum albumin (BSA;
b; u: \( `$ Z% Z' c# l! H QSigma A7888), 10ug/ml human insulin (Sigma), 4ug/ml low density lipoprotein, 200ug/ml
/ l7 x! N; }/ m F3 |% _* ~( G( ptransferrin, 10 nM dexamethasone, 100 uM ASAP, 50 uM ȕ-mercaptoethanol, 5 ug/ml* @5 o0 m' z, G4 @: o8 Y
gentamicin, 10ng/ml platelet-derived growth factor (PDGF; Sigma), 10ng/ml epidermal growth & L) k! O* s1 a+ L' a2 u/ |
factor (EGF; R&D Systems), 10ng/ml basic fibroblast growth factor (b-FGF, Sigma) (SDM);% U9 B6 d: o3 B, W
IMDM with 0.2% BSA, SITE 3 (Sigma #S5295), 384µM ASAP, 10 ng/ml PDGF, 10ng/ml
- N* O- _/ r2 U# X3 Q9 @' \( |hydrocortisone 5ng/ml b-FGF, 1 ng/ml EGF, 10-7, p# f" N8 _! C; a% z4 ^3 D4 b
mgm/ml parathyroid hormone (PTH) and 5 ( h& U3 _9 U9 R
µg/ml gentamicin (K-M). Media on the cells were changed every 2 or 3 days. Cells were grown
0 ]0 z" {$ q0 ain T-150 flasks to about 80% confluency then media was aspirated from the flasks, cells were
/ ?$ |" Z) H" q) ]7 N9 L x7 Rwashed with PBS and trypsinized with TrypLE Express (Gibco#12605) before being split into 12
! O: Z6 k1 O, ~& P3 \well plates for the assays.
3 ?4 K5 L1 }1 Z- {5 V1 [$ WFibronectin Coating of Tissue Culture Plates
" S0 s |8 N8 B7 A& dFibronectin (FN) was coated on the plates and flasks to provide growth and attachment
, \- e& c/ v$ A) Dsupport for cells grown in the serum-free, IMDM media. For the 12 well plates, 0.1% FN
X: }0 [$ w+ Z. w4 |solution (Sigma F-1141) was diluted in PBS so that each well received 3.8 micrograms per well ; f+ @3 W% O4 ~' C/ K1 y
(1µg FN/cm2). The T-150 flasks were coated so that each received 150 micrograms of FN (1µg
+ o& Q2 o( Q, t0 A0 {FN /cm2). The plates and flasks were tilted back and forth to ensure complete coverage of the
2 {% r0 I$ l2 A+ C6 f9 j% R( C( xFN solution. The FN coating was allowed to stand at room temperature for 90 minutes. The FN
' ]$ O' d$ p5 R2 }solution was then aspirated before the resuspended cells were transferred to the flasks and plates.! m+ ~8 n/ F5 F- g% R8 Y
Proliferation Assays6 T% P- I1 S1 o. M' {4 P/ l2 `7 i
After trypsinization cells were resuspended in an equal amount of the appropriate media/ K# O' p1 y( }+ h3 X
before an aliquot was removed for counting on a hemocytometer to determine the concentration.' ~& q0 \! f% b. c- g# [! u
The cells were then centrifuged at ~1600 rpm for 5 minutes at room temperature. Cells were
4 A: s* t" H( B' E% J# j3 Dresuspended in the appropriate media at a concentration of 3800 cells per ml. One milliliter of % j/ H3 Q. R* L: k( O
cells was dispensed into each well of a 12 well plate. K-M plates were precoated with FN
9 R' h$ j" U1 g: Vsolution (as outlined above). Four plates for each cell type and media condition were plated and 6 m. d, D+ M* b. H6 S
counted on a hemocytometer at days 1, 3, 5 and 7 to determine the cell numbers within each 1 ?; E0 ^- Y6 z) x2 [
well. All experiments were performed in triplicate.
$ s; A" o( H, S. rRNA Isolation and Purification for MicroArray t9 G. K2 m6 G3 m) r
PDLSCs and SHEDs were grown in T-75 flasks to 80% confluency before the cells were
' W, i; S" C: P! E- Tharvested for RNA. The Trizol method (Invitrogen) was used for RNA isolation. This involved
6 a+ w& m) N0 n7 iwashing the cell layer with PBS, adding Trizol directly to the cells and transferring this cell ) ^# t5 |4 U. O0 S
suspension to polypropylene tubes. RNA was isolated from the cells by a Trizol-choloroform: O3 U8 R: S5 J* l
extraction, isopropanol precipitation, an ethanol rinse and resuspension of theRNA pellet in $ U9 \& \9 O# e$ ]# [
Diethylpyrocarbonate (DEPC) water. The RNA was further purified by column
0 v( h# C- c% s' ?/ `& v/ l4 G" w9 }chromatography, following manufacturer’s instructions (Qiagen RNeasy Kit # 74104), and
1 p6 U2 R, x& Nresuspended in DEPC water. RNA concentration was determined by the 260/280 absorbance
\8 s# z( J$ xmeasurement using a Beckman DU540 spectrophotometer.
' _, o5 R4 B! F0 G# h( F9 W* N! c9 Y! |In Vitro Multilineage Differentiation , v K/ ~3 U* x; m# M& T; L" ~1 y
Multipotency of PDLSCs and SHEDs was determined through lineage specific
& \! Y) {4 n0 D7 {/ w+ ^osteogenic, chondrogenic, and adipogenic induction, according to previously described methods
% g% Z+ V7 u+ c/ _) [( H+ g* O(Pittenger et. al, 1999). Briefly, cells were plated at a density of 30,000 cells per well in 12 well ! }3 g; e, X* s. ]
plates. At 80% confluency cells were induced with osteogenic [Growth media plus 5mM E-+ ]% ?; s9 I1 B ]% e- ^, ~
glycerophosphate, 100nM dexamethasone, 50µM ascorbic acid 2-phosphate] or chondrogenic . M4 q( a4 I3 y# [* T( q, ^
[growth media plus 50µM ascorbic acid 2-phosphate, 100nM dexamethasone, 5 µg/ml human
* J& r+ Z8 P+ b# @0 q+ E4 X7 ?insulin (Sigma I-9278), 1 ng/ml TGFE, 400µM proline, 1X Non essential amino acids] or g8 |: w5 l& B! Y1 _
adipogenic [growth media plus 0.5mM IBMX, 1 µM dexamethasone, 10 µg/ml human insulin,
( U/ [# ]8 G n7 } `' }200µM indomethacin] induction media. Cells were grown at 37°C in a humidified 5% CO2 K0 E. s4 V) E* q+ ]3 a
incubator. The media was changed every 2-3 days. At three weeks the cells were fixed and
! E3 Q3 U) c6 t) U5 k" S- d% I2 Sstained as outlined below. 0 A& }; a" S6 k8 s3 z3 Q
Multipotent Staining of PDLSCs and SHEDs E) R: L" u) T; Q8 S. B
To identify the mineralized nodules, induced PDLSC, SHED and DPSC were fixed in 4%
- ~! x1 e# Q# K6 l1 d% {! ?paraformaldehyde for 30 minutes, immersed in fresh 5% silver nitrate and incubated in the dark
# i! A) Z" _0 @# c: R/ qfor 30 minutes. After washing in water the PDLSC, SHED and DPSC were exposed to
. ^9 H! q1 t8 ~; N6 |ultraviolet light for 30 minutes followed by a four minute incubation in 1% sodium thiosulfate to
! A8 l* S, ~6 e f: d* J: fneutralize the silver nitrate. Cells were washed twice with water before 1 ml of PBS was added
/ G4 P& G; I0 A* Y( \- N4 s2 Bto each well and viewed. Plates were stored at 4°C. : t0 k) y [ Z. m
To detect chondrogenic differentiation induced PDLSC, SHED and DPSC were fixed in / J8 b. G; |) `. B/ }
cold 100% methanol for 30 minutes and then exposed to 1% alcian blue in 0.1N HCl for 30
" Y- C- {" e/ r/ hminutes. Cells were washed twice with 0.1N HCl before 1 ml of PBS was added to each well
3 o9 \; f, q9 N, z) y( G6 w' Gand viewed. Plates were stored at 4°C.
, k, G4 X* b' w5 F2 m# ATo detect adipogenic differentiation by identifying lipid vesicles, induced PDLSC, SHED 6 q, y' D* b" z
and DPSC were fixed in 4% paraformaldehyde for 30 minutes, and then immersed in 0.3% oil 6 _! q# t- ]7 }
red O solution for 30 minutes. Cells were washed twice with water before 1 ml of PBS was & A" ~3 P; O7 N" p! l# F+ w# ~
added to each well and viewed. Plates were stored at 4°C. ; O: W7 ]$ V, z$ I2 t" b M
Alkaline Phosphatase Activity and Detection
# `' g# B @' G4 r0 zEarly osteogenic differentiation was detected and quantified by the alkaline phosphatase , u6 Z% ]4 ^6 l# a3 W) X9 Q
(ALP) enzyme assay. Cells were plated at a density of 30,000 cells per well in 12 well plates., { v+ D4 ~# \9 u5 I; X
At 80% confluence, cells were induced with osteogenic media as described above. The media
" k1 y, b4 E- f" g; Nwas changed every 2-3 days and after one week, ALP activity was measured.
! a3 N" `4 x3 |( }To detect phosphatase activity, PDLSCs and SHEDs were fixed in 70% ethanol for 30 , E/ l$ S* k/ ?$ Q
minutes. They were then incubated with freshly made substrate containing naphthol AS-TR
" K% ~9 d; w2 rphosphate (Sigma) and Fast blue (Sigma) for 30 minutes. Cells were washed twice with PBS then % u" c% W" s; @( U) Y+ w3 f
viewed or stored at 4’C.
4 w4 C) ~4 x. o4 qTo quantify the ALP activity and normalize the results, cells were lysed in Passive Lysis # V5 C$ y. k2 [" ]- g3 x* ^
Buffer (Promega) according to manufacturer’s instructions. Cell lysates were then sonicated,
6 |, t* {. e* n8 R0 @1 aand centrifuged (10,000 rpm for 10 minutes at 4°C). The supernatant was recovered for the $ b, h! v0 {" V* O8 G* |
quantitative colormetric ALP assay (Manolagas et al., 1981) and the cell pellet was used for 9 L! y8 R L7 x" h# N
DNA isolation and the determination of the DNA concentration using the Quant-iT™ dsDNA * d6 {1 a. [4 z4 @- {% n# [# {& I
BR Assay (Invitrogen) per the manufacturer’s instructions. * Q4 C$ O7 W s2 `: y; Z
Reverse Transcriptase Polymerase Chain Reaction (RT-PCR)
" x; e0 L7 V/ X2 @/ v" UTo confirm chondrogenic and adipogenic differentiation, total PDLSC and SHED cellular
* E% y5 ]5 m8 N' y+ IRNA was extracted, reverse transcribed, and amplified using osteoblast specific gene primers.
8 u5 G* E$ g8 g Q+ oMedia from the wells of induced and uninduced PDLSCs and SHEDs were aspirated. Cells - |4 ?6 T0 h9 k+ z
were immediately resuspended in 1 ml of Trizol (Invitrogen) and RNA was isolated according to " ~0 f, P V9 @4 w9 P
the manufacturer’s instructions. Synthesis of cDNA was performed using Invitrogen’s
" T* m5 G5 f2 t3 ^; YSuperScriptII kit and oligo dT. PCR reaction components and concentrations were as described
0 @; x$ k* m' ^! |in the Invitrogen Platinum Taq polymerase instructions using the primer sets below. An MJ % C! f3 |' |4 v( [
themorcycler was used for the following two PCR reaction conditions: # q9 `) Y) T& F+ w
*94°C 2 minutes [94°C 45” 56°C 45” 72°C 1’] X 35 cycles 72°C 15’
7 z1 c* P* Y7 C. f, }$ Mor- p7 {. m, V* @
**94°C 2 minutes [94°C 45” 67°C 45” 72°C 1’] X 35 cycles 72°C 15’
+ V( h o! g, R- L" EPCR Primer Pairs
* i. i9 l$ O0 t9 X/ O1 O" lPrimer Name Primer Sequence Product; k E0 l0 Z( L
Size! z. ?. F+ ^5 P! }. R: z3 L9 ?
Accession t" O! ]& g5 ~
Number U' g! J. f1 `- Q' z
*GAPDH FWD AGCCGCATCTTCTTTTGCGTC 815 bp NM_002046+ E/ ?8 p3 R8 r/ V7 h* R3 \+ }
*GAPDH REV TCATATTTGGCAGGTTTTTCT; w: _" V0 {, } \ l+ C
PPARJ2 FWD GCTGTGCAGGAGATCACAGA 226 bp NM_0050379 v$ n# K, k, G6 |( s% g0 h
PPARJ2 REV GGGCTCCATAAAGTCACCAA. ~5 I1 x2 q: i6 Q6 a9 q0 l
Lipoprotein lipase FWD GTCCGTGGCTACCTGTCATT 212 bp NM_000237
. ~8 M# h$ A" n/ I6 V8 e$ hLipoprotein lipase REV TGTCCCACCAGTTTGGTGTA
7 @# g6 d4 D$ f! t1 BSox 9 FWD TTGAGCCTTAAAACGGTGCT 224 bp NM0003461 C6 C; H0 [/ U" i0 D
Sox 9 REV CTGGTGTTCTGAGAGGCACA( R$ i8 v. G; T
Type X collagen FWD TGAGCAGCAACGTAAAAACG 471 bp NM_00049& B/ j4 l6 q$ J: v! a9 W5 d
Type X collagen REV AGGAAATGCCGAGTTTCTCA
. |. s0 X) b6 oStatistical Analysis
f* _- G% z/ zStatistical analysis was performed with the use of Instat software (GraphPad Software, San / M! s" z4 e; |
Diego, CA, USA). All data were plotted as mean ± standard error of the mean (SEM), unless ' n+ k1 E- U2 W- C; b
otherwise noted. Statistically significant differences were determined by two-tailed Student t/ ]3 l# @( K" p" m+ M' N7 @
tests, and statistical significance was defined as p < 0.05. |
|
发表于 2011-3-20 08:21
/ j9 X0 S0 Z/ U( ~! w: q
，脑子里也没有独家生产这个概念
，所以没理解。+ [* L E( ~) H" ?& r5 R# M( |+ M