|
 
- 积分
- 429
- 威望
- 429
- 包包
- 1768
|
本帖最后由 qianqianlaile 于 2011-3-22 22:26 编辑 * }) Z9 ^$ T5 Z! W- I# f) H9 l5 z
6 @2 L. B* T$ }# \4 s; U6 N, P
MATERIALS AND METHODS
$ Y: u4 C0 C3 a, x; @Isolation of Dental-Derived Stem Cells (PDLSCs, SHEDs)
) b5 {0 _7 P! F4 m9 wPDLSCs and SHEDs were harvested as previously described (Miura et. al, 2003; Seo et. # ^6 i( L9 Q4 o% E
al, 2004). Briefly, PDLSCs were scraped from the root surface of a tooth into a p60 dish
8 a; k" }9 m$ O2 X* Z$ a6 qcontaining minimum essential alpha medium (DMEM, Gibco) and SHEDs were harvested by 3 c2 D( }# F7 d6 W* X
scraping out the dental pulp tissue from a deciduous tooth into a p60 dish containing DMEM.
9 K% X9 L0 c6 wAfter collection, the cells were centrifuged at 1600 rpm for 5 minutes at room temperature. The
1 h \' E, w3 N) l6 h, ysupernatant was aspirated and the cells were resuspended in a phosphate buffered saline (PBS;
/ x7 S7 Q4 H- }Gibco #14190) solution with 4 mg/ml Dispase II (Roche #04 942 078 001) and 2 mg/ml9 Z5 C, q4 C3 r
Collagenase Type II (Worthington # LS004196) and incubated at 37°C for 60 minutes. The % F, }# }% x2 M0 H/ J3 C% B( ^
enzyme solution was inactivated with 5 ml of DMEM- 15% FBS- 100µM ascorbic acid 2
3 f6 ]+ x! G2 h4 Ephosphate (ASAP, Sigma A-8960) and centrifuged at 1600 rpm for 5 minutes at room
, n4 {" O% z8 [: Ztemperature. Cells were resuspeneded in 5 ml DMEM- 15% FBS- 0.1mM ASAP and transferred
' c' d- z' |# J: U- nto T-25 flasks. Media was changed the next day and then every 2-3 days. " B. |" Q5 v& \' Y% [) p& E' m6 z- H% a
Cell Culture
a# G" R# [4 I Cells were expanded in culture in DMEM, Iscove’s modified Dulbecco’s media (IMDM,
4 M- j! f+ h4 YGibco-Invitrogen #12571), Gibco Stem Pro Mesenchymal Stem Cell Serum-Free Media 5 I$ K$ |2 v7 [) Q
(MSCSFM; Invitrogen# A1033401) or Lonza Therapeak Mesenchymal Stem Cell Growth 0 A3 f6 ]( Q5 C0 I3 t
Media- Chemically Defined (MSCGM-CD; Lonza #00190632) and grown in a 37°C humidified
2 x6 H8 }' p S9 r- _, d6 Gtissue culture incubator at 5% CO2. Media formulations are as follows: DMem (Gibco-
) ]7 h2 }; ]: m. T6 r1 OInvitrogen #12571) with 15% FBS (Gibco-Invitrogen-16000), 100µM ASAP and 5 µg/ml4 B* A2 H) t8 Z
Gentamicin (Invitrogen # 15750060) (FBS-M); DMem with 2% bovine serum albumin (BSA; ; \" A4 A! j% Y
Sigma A7888), 10ug/ml human insulin (Sigma), 4ug/ml low density lipoprotein, 200ug/ml9 S3 E* N5 W; d+ D$ z6 r5 p# r
transferrin, 10 nM dexamethasone, 100 uM ASAP, 50 uM ȕ-mercaptoethanol, 5 ug/ml# e8 ~1 I* }) \% V/ O7 n2 h: J! ^" F
gentamicin, 10ng/ml platelet-derived growth factor (PDGF; Sigma), 10ng/ml epidermal growth $ L& r7 u' C% w5 e
factor (EGF; R&D Systems), 10ng/ml basic fibroblast growth factor (b-FGF, Sigma) (SDM);
; q. K7 w+ Q, U1 SIMDM with 0.2% BSA, SITE 3 (Sigma #S5295), 384µM ASAP, 10 ng/ml PDGF, 10ng/ml$ U1 F+ o: O1 ?9 E- g
hydrocortisone 5ng/ml b-FGF, 1 ng/ml EGF, 10-7
$ t' _+ b0 R' d( M mgm/ml parathyroid hormone (PTH) and 5
/ }7 n D5 x9 D/ |# A" |3 Y* ^/ Jµg/ml gentamicin (K-M). Media on the cells were changed every 2 or 3 days. Cells were grown
! r' L- U3 S. Kin T-150 flasks to about 80% confluency then media was aspirated from the flasks, cells were 2 t$ l) \/ Z* p3 O
washed with PBS and trypsinized with TrypLE Express (Gibco#12605) before being split into 123 x1 l' f/ I0 A3 ~( f* t9 q
well plates for the assays. # _- J8 {7 G8 ` n: l0 w1 H
Fibronectin Coating of Tissue Culture Plates8 R! W: @; C9 e) M; n1 y% \
Fibronectin (FN) was coated on the plates and flasks to provide growth and attachment
8 T* e6 F+ t7 I* {' Vsupport for cells grown in the serum-free, IMDM media. For the 12 well plates, 0.1% FN . j8 g' h8 n' Q; Z$ x. f
solution (Sigma F-1141) was diluted in PBS so that each well received 3.8 micrograms per well ) _$ C- j _- K8 P; g! d
(1µg FN/cm2). The T-150 flasks were coated so that each received 150 micrograms of FN (1µg + ^' K/ E2 L4 Z% ]" M7 l
FN /cm2). The plates and flasks were tilted back and forth to ensure complete coverage of the 7 h2 x8 c) N5 \
FN solution. The FN coating was allowed to stand at room temperature for 90 minutes. The FN
1 ?/ y& c8 F) f1 wsolution was then aspirated before the resuspended cells were transferred to the flasks and plates.
: T: m0 ^( W1 e5 V: ?5 I7 iProliferation Assays
; t. y$ b) u6 W6 IAfter trypsinization cells were resuspended in an equal amount of the appropriate media' N' M: f" t' |4 s6 w m
before an aliquot was removed for counting on a hemocytometer to determine the concentration." c4 t" L9 s" e) O5 E
The cells were then centrifuged at ~1600 rpm for 5 minutes at room temperature. Cells were 4 H$ I4 G6 Q! b$ v# U
resuspended in the appropriate media at a concentration of 3800 cells per ml. One milliliter of ; g7 b. ? n0 w' \% j+ S
cells was dispensed into each well of a 12 well plate. K-M plates were precoated with FN ) ~0 W6 u" `; W5 u
solution (as outlined above). Four plates for each cell type and media condition were plated and # z9 c' F1 {! D) O3 |# T" f% h
counted on a hemocytometer at days 1, 3, 5 and 7 to determine the cell numbers within each : a4 r1 D1 i7 L2 w1 F
well. All experiments were performed in triplicate.
) l/ i! `8 Q. L7 {3 _, @) g7 i. ERNA Isolation and Purification for MicroArray
% J2 j/ {3 H" s6 v+ e& m _7 RPDLSCs and SHEDs were grown in T-75 flasks to 80% confluency before the cells were + `( n. n X' h
harvested for RNA. The Trizol method (Invitrogen) was used for RNA isolation. This involved
& }* i) j" |; V9 b6 Ewashing the cell layer with PBS, adding Trizol directly to the cells and transferring this cell q' q% z; _5 S$ b; _ h- e* W
suspension to polypropylene tubes. RNA was isolated from the cells by a Trizol-choloroform& p1 ^/ m' h* [7 P" W. y- g- I8 q
extraction, isopropanol precipitation, an ethanol rinse and resuspension of theRNA pellet in
' P, w8 G( l, t7 _3 `3 O" l1 B! cDiethylpyrocarbonate (DEPC) water. The RNA was further purified by column
# N1 I4 t. V2 Xchromatography, following manufacturer’s instructions (Qiagen RNeasy Kit # 74104), and
- t5 I5 \, c* L0 Tresuspended in DEPC water. RNA concentration was determined by the 260/280 absorbance
9 O4 k+ i' t% `, S4 N/ |measurement using a Beckman DU540 spectrophotometer.
& R2 `; v, R8 B/ lIn Vitro Multilineage Differentiation
& [# T7 l3 N, X+ }8 D7 dMultipotency of PDLSCs and SHEDs was determined through lineage specific
5 H; z' T$ U: X8 l3 |osteogenic, chondrogenic, and adipogenic induction, according to previously described methods0 m4 m p) T1 p0 n: q2 `
(Pittenger et. al, 1999). Briefly, cells were plated at a density of 30,000 cells per well in 12 well
, m+ h5 j0 f) Splates. At 80% confluency cells were induced with osteogenic [Growth media plus 5mM E-. r& Z0 X# c0 x6 E& s% p
glycerophosphate, 100nM dexamethasone, 50µM ascorbic acid 2-phosphate] or chondrogenic
, S* d( m' q0 c; d, d# O[growth media plus 50µM ascorbic acid 2-phosphate, 100nM dexamethasone, 5 µg/ml human
' Z8 h$ N- t! Vinsulin (Sigma I-9278), 1 ng/ml TGFE, 400µM proline, 1X Non essential amino acids] or
+ ?! G! _ `5 J7 Eadipogenic [growth media plus 0.5mM IBMX, 1 µM dexamethasone, 10 µg/ml human insulin,
# e1 }$ ~2 \9 U200µM indomethacin] induction media. Cells were grown at 37°C in a humidified 5% CO2
$ B( w" l8 m. c' K, Nincubator. The media was changed every 2-3 days. At three weeks the cells were fixed and
2 X5 ~9 q" |7 G" v; V+ \stained as outlined below. 8 @& I4 E* Y* C0 f
Multipotent Staining of PDLSCs and SHEDs
3 }/ E+ M- q$ ETo identify the mineralized nodules, induced PDLSC, SHED and DPSC were fixed in 4% 7 e* ?, x$ ]- a4 b) E$ T
paraformaldehyde for 30 minutes, immersed in fresh 5% silver nitrate and incubated in the dark & Y6 `7 p1 X1 d Y, j' n c9 z
for 30 minutes. After washing in water the PDLSC, SHED and DPSC were exposed to
H4 W$ E8 J5 o+ T+ multraviolet light for 30 minutes followed by a four minute incubation in 1% sodium thiosulfate to
8 I. i5 B! @. u1 J! dneutralize the silver nitrate. Cells were washed twice with water before 1 ml of PBS was added
9 S# E, X* ?* m! xto each well and viewed. Plates were stored at 4°C.
) U. t) j& F3 O! V$ g2 ?2 H7 qTo detect chondrogenic differentiation induced PDLSC, SHED and DPSC were fixed in
) Z6 z. l3 a1 x5 a) Ocold 100% methanol for 30 minutes and then exposed to 1% alcian blue in 0.1N HCl for 30
# M0 ]) [3 J% k# J1 rminutes. Cells were washed twice with 0.1N HCl before 1 ml of PBS was added to each well % q" k. u0 g+ m8 F7 X# g: F
and viewed. Plates were stored at 4°C., s6 Y/ W+ Y0 }4 K
To detect adipogenic differentiation by identifying lipid vesicles, induced PDLSC, SHED
! a. l& @2 E) c' Hand DPSC were fixed in 4% paraformaldehyde for 30 minutes, and then immersed in 0.3% oil 5 F1 N1 R0 B& R) ~# _3 C- x: d
red O solution for 30 minutes. Cells were washed twice with water before 1 ml of PBS was 5 y: {2 d7 ~6 Y. Y
added to each well and viewed. Plates were stored at 4°C. 2 P N' |0 ?8 |8 r |3 k2 A* {
Alkaline Phosphatase Activity and Detection+ d" n" }( }7 A5 j0 _1 |# I5 T3 P/ E0 ^3 Q
Early osteogenic differentiation was detected and quantified by the alkaline phosphatase
" M" D( I2 t% O, w# r(ALP) enzyme assay. Cells were plated at a density of 30,000 cells per well in 12 well plates.
* ^( Z7 i( i2 q+ @- s4 VAt 80% confluence, cells were induced with osteogenic media as described above. The media' _, d! V4 G! n' `: I7 x
was changed every 2-3 days and after one week, ALP activity was measured.; \ w9 o/ E4 h2 B5 `
To detect phosphatase activity, PDLSCs and SHEDs were fixed in 70% ethanol for 30
5 f: o* q4 ~: d i2 Iminutes. They were then incubated with freshly made substrate containing naphthol AS-TR
1 ~7 A/ i9 w; A. g& Kphosphate (Sigma) and Fast blue (Sigma) for 30 minutes. Cells were washed twice with PBS then % A8 p0 t2 a i* h% x' B2 ?0 x
viewed or stored at 4’C.8 S! y$ _+ A4 M
To quantify the ALP activity and normalize the results, cells were lysed in Passive Lysis 6 C( ^7 } D% \: r0 J% k9 [4 W
Buffer (Promega) according to manufacturer’s instructions. Cell lysates were then sonicated, $ ~: B3 N0 l$ y4 ^0 @) j: k) L) l
and centrifuged (10,000 rpm for 10 minutes at 4°C). The supernatant was recovered for the % l; a3 b' Y* c
quantitative colormetric ALP assay (Manolagas et al., 1981) and the cell pellet was used for 2 N# V/ c! C/ P# ^7 K( e
DNA isolation and the determination of the DNA concentration using the Quant-iT™ dsDNA 5 l9 G0 v% _0 ? f6 H
BR Assay (Invitrogen) per the manufacturer’s instructions. 8 n `( p5 w- h( s- n+ r5 s
Reverse Transcriptase Polymerase Chain Reaction (RT-PCR) * G! ] I6 E6 S2 P8 h( U
To confirm chondrogenic and adipogenic differentiation, total PDLSC and SHED cellular & S4 V& A0 w/ Z
RNA was extracted, reverse transcribed, and amplified using osteoblast specific gene primers.
, `8 @( W' p4 t" ^Media from the wells of induced and uninduced PDLSCs and SHEDs were aspirated. Cells
) }0 F8 P% s- W% T. v: fwere immediately resuspended in 1 ml of Trizol (Invitrogen) and RNA was isolated according to 7 D/ k" k5 A! J8 P
the manufacturer’s instructions. Synthesis of cDNA was performed using Invitrogen’s 9 y' W. Y: Z. i9 z
SuperScriptII kit and oligo dT. PCR reaction components and concentrations were as described
9 I8 x. b9 l- k `, D4 Ein the Invitrogen Platinum Taq polymerase instructions using the primer sets below. An MJ ! X- I" o7 Y B; d( Z& w0 l6 s
themorcycler was used for the following two PCR reaction conditions: - s4 r8 m/ r) c V6 Y/ t- y
*94°C 2 minutes [94°C 45” 56°C 45” 72°C 1’] X 35 cycles 72°C 15’
6 ]# q6 M, V- B# w* k3 Ror5 y4 x5 o9 O" q7 Z! k
**94°C 2 minutes [94°C 45” 67°C 45” 72°C 1’] X 35 cycles 72°C 15’
( h) ?7 F1 m+ x) ?) O y" L- C6 gPCR Primer Pairs
, r0 D5 M+ [% C. l( `Primer Name Primer Sequence Product
+ C; N% T. s* Y' Y+ }Size
! g5 f4 {0 x1 R8 @- fAccession3 b8 ^* w( n& f. Z/ L, F
Number
( S# g1 w, w& U, i" w*GAPDH FWD AGCCGCATCTTCTTTTGCGTC 815 bp NM_002046
( I, @3 h; Z) m g" A*GAPDH REV TCATATTTGGCAGGTTTTTCT
# F/ d/ s; f# j4 q6 z/ \PPARJ2 FWD GCTGTGCAGGAGATCACAGA 226 bp NM_005037
& V8 x6 x7 B# h, y# VPPARJ2 REV GGGCTCCATAAAGTCACCAA
& b6 h% Q# A. \% R# Z: k; lLipoprotein lipase FWD GTCCGTGGCTACCTGTCATT 212 bp NM_000237
" h) F9 M c1 ]% E' tLipoprotein lipase REV TGTCCCACCAGTTTGGTGTA
0 q, A4 r' ^ g2 M$ q" I5 F9 S7 RSox 9 FWD TTGAGCCTTAAAACGGTGCT 224 bp NM0003465 v/ W* `# T( u4 O+ j
Sox 9 REV CTGGTGTTCTGAGAGGCACA
0 a& ^. u) @1 ^: L- M3 O: R0 LType X collagen FWD TGAGCAGCAACGTAAAAACG 471 bp NM_00049
1 p1 R% _; F& G3 qType X collagen REV AGGAAATGCCGAGTTTCTCA7 h. C' K5 v" Z- @1 t! `/ M
Statistical Analysis 0 R1 Z9 q1 z4 ?' l( x* o
Statistical analysis was performed with the use of Instat software (GraphPad Software, San
* H2 G! q, n. S( k% {/ wDiego, CA, USA). All data were plotted as mean ± standard error of the mean (SEM), unless " P/ f- v' h2 T2 k$ L% ^
otherwise noted. Statistically significant differences were determined by two-tailed Student t
0 H5 B! n+ a8 I& `tests, and statistical significance was defined as p < 0.05. |
|
发表于 2011-3-20 08:21
，脑子里也没有独家生产这个概念
，所以没理解。( G9 n8 a4 c% G% O
