|
 
- 积分
- 429
- 威望
- 429
- 包包
- 1768
|
本帖最后由 qianqianlaile 于 2011-3-22 22:26 编辑 , [$ u \8 E' O! A+ C. v
' E9 ~* Q2 S! F* O
MATERIALS AND METHODS 1 a1 E$ G* C, T3 g6 F& @; O
Isolation of Dental-Derived Stem Cells (PDLSCs, SHEDs) 2 F* M8 U1 l/ S. p9 F v
PDLSCs and SHEDs were harvested as previously described (Miura et. al, 2003; Seo et.
8 |: _7 f4 J X4 s: P: ] K0 ?2 zal, 2004). Briefly, PDLSCs were scraped from the root surface of a tooth into a p60 dish
2 o/ c/ L: J- ?+ h5 v7 h6 N, Ocontaining minimum essential alpha medium (DMEM, Gibco) and SHEDs were harvested by . ]" \# R p b6 K4 N# ]
scraping out the dental pulp tissue from a deciduous tooth into a p60 dish containing DMEM.
; }8 W# l# ~* aAfter collection, the cells were centrifuged at 1600 rpm for 5 minutes at room temperature. The ! U8 S7 u8 L% Y3 m
supernatant was aspirated and the cells were resuspended in a phosphate buffered saline (PBS;
: K, ^" n5 x7 r) w: |! G& WGibco #14190) solution with 4 mg/ml Dispase II (Roche #04 942 078 001) and 2 mg/ml
. F* [5 d; a) _( h+ V RCollagenase Type II (Worthington # LS004196) and incubated at 37°C for 60 minutes. The 7 c: @ Z6 P1 z- o0 Q9 V U7 ]
enzyme solution was inactivated with 5 ml of DMEM- 15% FBS- 100µM ascorbic acid 2
5 Y ~' h' g' dphosphate (ASAP, Sigma A-8960) and centrifuged at 1600 rpm for 5 minutes at room! u+ v+ o: _/ g# k) \/ L8 }, H
temperature. Cells were resuspeneded in 5 ml DMEM- 15% FBS- 0.1mM ASAP and transferred
/ V' g1 a2 u: k8 E3 ?5 S3 P0 z: ]to T-25 flasks. Media was changed the next day and then every 2-3 days. ' K% k+ K' ]$ S( Z7 Y
Cell Culture
7 V8 Z8 c6 |) Q7 O, e: ]& | Cells were expanded in culture in DMEM, Iscove’s modified Dulbecco’s media (IMDM, 0 T! Q' x) B2 P- H+ R' P; e
Gibco-Invitrogen #12571), Gibco Stem Pro Mesenchymal Stem Cell Serum-Free Media
: ]; ~ X: ?" u(MSCSFM; Invitrogen# A1033401) or Lonza Therapeak Mesenchymal Stem Cell Growth , o2 N' G: G. N# _0 y$ K
Media- Chemically Defined (MSCGM-CD; Lonza #00190632) and grown in a 37°C humidified' [/ n! d! p! ^& A: k
tissue culture incubator at 5% CO2. Media formulations are as follows: DMem (Gibco-
3 M1 T- Z# j) }% J4 {Invitrogen #12571) with 15% FBS (Gibco-Invitrogen-16000), 100µM ASAP and 5 µg/ml
$ F- i9 h8 m2 r, s# q cGentamicin (Invitrogen # 15750060) (FBS-M); DMem with 2% bovine serum albumin (BSA;
+ m: c+ a8 A# j+ VSigma A7888), 10ug/ml human insulin (Sigma), 4ug/ml low density lipoprotein, 200ug/ml
$ C' O5 R8 B6 O- ztransferrin, 10 nM dexamethasone, 100 uM ASAP, 50 uM ȕ-mercaptoethanol, 5 ug/ml' U8 f! D1 r! z- p, [8 c
gentamicin, 10ng/ml platelet-derived growth factor (PDGF; Sigma), 10ng/ml epidermal growth
Z: x/ k* K {" X9 c, hfactor (EGF; R&D Systems), 10ng/ml basic fibroblast growth factor (b-FGF, Sigma) (SDM);- n; I: Y1 i' o+ i* ]1 |1 X8 F
IMDM with 0.2% BSA, SITE 3 (Sigma #S5295), 384µM ASAP, 10 ng/ml PDGF, 10ng/ml' [/ h1 S4 z1 U# l% ?- A6 F
hydrocortisone 5ng/ml b-FGF, 1 ng/ml EGF, 10-7- @/ R6 {7 {2 j9 M) r
mgm/ml parathyroid hormone (PTH) and 5
$ s% a0 x; a6 ~/ y7 x3 mµg/ml gentamicin (K-M). Media on the cells were changed every 2 or 3 days. Cells were grown7 P5 x! @' L$ k! @# E0 T
in T-150 flasks to about 80% confluency then media was aspirated from the flasks, cells were
5 U2 G2 l* h; S7 _3 M1 b' cwashed with PBS and trypsinized with TrypLE Express (Gibco#12605) before being split into 12* g/ L0 R$ H( k7 W- z7 ^' Z) g& [0 @& T
well plates for the assays.
0 M3 ]* {* B6 ?# N) xFibronectin Coating of Tissue Culture Plates' S: R$ b0 A; y. U8 Q4 Y
Fibronectin (FN) was coated on the plates and flasks to provide growth and attachment
{! Y# ^* j5 usupport for cells grown in the serum-free, IMDM media. For the 12 well plates, 0.1% FN $ R: `& o- n! ^
solution (Sigma F-1141) was diluted in PBS so that each well received 3.8 micrograms per well 6 W/ W% ?4 p& m. D% C3 U
(1µg FN/cm2). The T-150 flasks were coated so that each received 150 micrograms of FN (1µg 9 P3 I( K: k$ _1 r. S: Q9 u3 @" e
FN /cm2). The plates and flasks were tilted back and forth to ensure complete coverage of the 7 a- ?8 d4 y% O( e6 u
FN solution. The FN coating was allowed to stand at room temperature for 90 minutes. The FN
+ H0 o, {; s( j! [0 _, [; V' d- lsolution was then aspirated before the resuspended cells were transferred to the flasks and plates., ~1 p# } A$ l ?7 H1 ^9 t
Proliferation Assays
6 G9 g" n! n6 h( O" ]After trypsinization cells were resuspended in an equal amount of the appropriate media
: }" ^+ A m- J4 i+ {! Wbefore an aliquot was removed for counting on a hemocytometer to determine the concentration.! u- s' t9 v. p5 Y: m% r$ f5 [
The cells were then centrifuged at ~1600 rpm for 5 minutes at room temperature. Cells were " v- o6 w. U9 t: z7 r$ n/ y6 B
resuspended in the appropriate media at a concentration of 3800 cells per ml. One milliliter of ; A+ i0 L7 \/ \1 r( o
cells was dispensed into each well of a 12 well plate. K-M plates were precoated with FN
# K) C* J, ?# |8 w& r- P1 bsolution (as outlined above). Four plates for each cell type and media condition were plated and
7 |8 M9 C' M9 p. I# g- G* f; X( |counted on a hemocytometer at days 1, 3, 5 and 7 to determine the cell numbers within each
% x3 H- V6 o/ z7 d+ C: f0 rwell. All experiments were performed in triplicate.
3 f9 B/ V0 N0 HRNA Isolation and Purification for MicroArray 6 F6 {. @$ d/ U/ h
PDLSCs and SHEDs were grown in T-75 flasks to 80% confluency before the cells were
7 D6 b' @$ [8 `& qharvested for RNA. The Trizol method (Invitrogen) was used for RNA isolation. This involved
. d! k7 a. s# Z1 Pwashing the cell layer with PBS, adding Trizol directly to the cells and transferring this cell
3 u3 B' l; e8 M& q5 Y- Hsuspension to polypropylene tubes. RNA was isolated from the cells by a Trizol-choloroform
4 b* f) D: w0 c0 v, v' A( jextraction, isopropanol precipitation, an ethanol rinse and resuspension of theRNA pellet in 0 f9 C; o* z7 r8 ^: Q% u
Diethylpyrocarbonate (DEPC) water. The RNA was further purified by column3 k8 u( I9 i9 p) A
chromatography, following manufacturer’s instructions (Qiagen RNeasy Kit # 74104), and
! B. ?3 R3 r. n7 ^2 wresuspended in DEPC water. RNA concentration was determined by the 260/280 absorbance
) h. K! ]! K0 H0 R8 r) ~measurement using a Beckman DU540 spectrophotometer.3 p2 z8 ~2 _( }: r7 k. v
In Vitro Multilineage Differentiation
n/ j @6 U: Z \6 y' d6 kMultipotency of PDLSCs and SHEDs was determined through lineage specific 2 r5 Q1 \1 M2 Z
osteogenic, chondrogenic, and adipogenic induction, according to previously described methods7 Z6 \2 F- p E+ M ~8 p: X% Q$ j$ q
(Pittenger et. al, 1999). Briefly, cells were plated at a density of 30,000 cells per well in 12 well
4 D2 n. K; K2 v1 S J: g1 Q) jplates. At 80% confluency cells were induced with osteogenic [Growth media plus 5mM E-
1 W! T9 A% h- d5 Bglycerophosphate, 100nM dexamethasone, 50µM ascorbic acid 2-phosphate] or chondrogenic ! Z( s2 h: k/ x1 f9 ]
[growth media plus 50µM ascorbic acid 2-phosphate, 100nM dexamethasone, 5 µg/ml human
" M$ z$ A# B+ Y5 M, M( J" l# E2 ]3 Winsulin (Sigma I-9278), 1 ng/ml TGFE, 400µM proline, 1X Non essential amino acids] or
3 q% c- c3 {" D1 F$ W, Padipogenic [growth media plus 0.5mM IBMX, 1 µM dexamethasone, 10 µg/ml human insulin, . a) D# c% X- i
200µM indomethacin] induction media. Cells were grown at 37°C in a humidified 5% CO2) `: f A( ^: e4 o K
incubator. The media was changed every 2-3 days. At three weeks the cells were fixed and
3 ^( b) g6 |) v Vstained as outlined below.
' Y6 a' j" L" D$ S( `; f2 XMultipotent Staining of PDLSCs and SHEDs
7 F8 D9 a7 b$ G" ]! nTo identify the mineralized nodules, induced PDLSC, SHED and DPSC were fixed in 4% ; I9 ^. Q: W3 y! A
paraformaldehyde for 30 minutes, immersed in fresh 5% silver nitrate and incubated in the dark
" U7 q4 w }0 u" g! N& y E' X1 s6 Pfor 30 minutes. After washing in water the PDLSC, SHED and DPSC were exposed to 7 h$ ^% [2 O! K
ultraviolet light for 30 minutes followed by a four minute incubation in 1% sodium thiosulfate to 2 X4 Q& r9 A9 |- r5 u4 ]& Y
neutralize the silver nitrate. Cells were washed twice with water before 1 ml of PBS was added
_: T b+ D6 A/ f x* \# \) Gto each well and viewed. Plates were stored at 4°C. ( \% T f+ u& [) j, v. M
To detect chondrogenic differentiation induced PDLSC, SHED and DPSC were fixed in |. C0 I3 t& S, e
cold 100% methanol for 30 minutes and then exposed to 1% alcian blue in 0.1N HCl for 30 8 N: |" p& ~ H# k4 c& L
minutes. Cells were washed twice with 0.1N HCl before 1 ml of PBS was added to each well
$ P* ^$ r) f& R: \: yand viewed. Plates were stored at 4°C.$ \; @- U9 h; `+ {& S ?4 h
To detect adipogenic differentiation by identifying lipid vesicles, induced PDLSC, SHED ) q6 |! k+ A- [8 ]) q
and DPSC were fixed in 4% paraformaldehyde for 30 minutes, and then immersed in 0.3% oil % u: u* I$ T5 L0 j7 i
red O solution for 30 minutes. Cells were washed twice with water before 1 ml of PBS was
0 ^' f0 D, {# m# {added to each well and viewed. Plates were stored at 4°C. ! W5 f3 m( [$ g6 O, p
Alkaline Phosphatase Activity and Detection q/ I' z% t. t
Early osteogenic differentiation was detected and quantified by the alkaline phosphatase
# }- O$ G( F7 K y" ~3 K2 I$ v2 ~& {(ALP) enzyme assay. Cells were plated at a density of 30,000 cells per well in 12 well plates.
; w1 {" t" h# q% @$ b7 q3 g( e7 w' \At 80% confluence, cells were induced with osteogenic media as described above. The media
( l; \( }5 k+ A. Ywas changed every 2-3 days and after one week, ALP activity was measured.
% O+ D3 b9 t o$ X5 d, f" xTo detect phosphatase activity, PDLSCs and SHEDs were fixed in 70% ethanol for 30 p5 y5 A6 V7 R# p" ^: c' X* y4 I+ {
minutes. They were then incubated with freshly made substrate containing naphthol AS-TR
8 r7 Y0 o e3 `/ E# mphosphate (Sigma) and Fast blue (Sigma) for 30 minutes. Cells were washed twice with PBS then
# e- Q* ~5 l. w# O/ j/ cviewed or stored at 4’C.+ m7 |4 O, r0 z* C- j
To quantify the ALP activity and normalize the results, cells were lysed in Passive Lysis
! J' J& E s3 {* aBuffer (Promega) according to manufacturer’s instructions. Cell lysates were then sonicated,
5 v6 z! {0 j7 Hand centrifuged (10,000 rpm for 10 minutes at 4°C). The supernatant was recovered for the
0 h6 B: a0 J- jquantitative colormetric ALP assay (Manolagas et al., 1981) and the cell pellet was used for
( d2 s/ m7 R5 Z: J* x8 L- g' hDNA isolation and the determination of the DNA concentration using the Quant-iT™ dsDNA
{( b9 a/ S9 T) s, U! ~2 uBR Assay (Invitrogen) per the manufacturer’s instructions.
( x j3 H* A8 wReverse Transcriptase Polymerase Chain Reaction (RT-PCR) # U7 n7 i5 D2 t. t Z- \
To confirm chondrogenic and adipogenic differentiation, total PDLSC and SHED cellular
7 E/ J2 G; Q0 J0 e2 ]3 LRNA was extracted, reverse transcribed, and amplified using osteoblast specific gene primers.
) t( h+ x ?9 oMedia from the wells of induced and uninduced PDLSCs and SHEDs were aspirated. Cells . G4 ]$ D' k7 [2 r4 ?- w; g
were immediately resuspended in 1 ml of Trizol (Invitrogen) and RNA was isolated according to 1 v0 G. D7 l: O& M' L$ @
the manufacturer’s instructions. Synthesis of cDNA was performed using Invitrogen’s 3 T$ m- [8 `6 I# `; b* M- g+ m( B
SuperScriptII kit and oligo dT. PCR reaction components and concentrations were as described
- N9 x. u# A+ l) Tin the Invitrogen Platinum Taq polymerase instructions using the primer sets below. An MJ
% y( u/ |# }5 x' N1 G( i1 z- hthemorcycler was used for the following two PCR reaction conditions:
% W) j$ o- E) ^2 H; u' s% T*94°C 2 minutes [94°C 45” 56°C 45” 72°C 1’] X 35 cycles 72°C 15’
( {8 x7 T/ J2 `/ ^& gor
9 ~5 u3 S' q- ?# `9 Q**94°C 2 minutes [94°C 45” 67°C 45” 72°C 1’] X 35 cycles 72°C 15’
* c S7 D3 a ?2 Y* N+ S2 ePCR Primer Pairs
) p! b3 y6 X+ e2 R+ a- i' ]Primer Name Primer Sequence Product: n0 B) N% E. @/ S+ R4 s$ j8 Q
Size( ?, e6 z5 c+ y. a) x
Accession8 s/ O9 A2 C6 ?4 } H+ P
Number9 [0 Y! N0 W1 M/ s0 s+ z
*GAPDH FWD AGCCGCATCTTCTTTTGCGTC 815 bp NM_002046
: t& a7 h, E S' F% f. |2 ?*GAPDH REV TCATATTTGGCAGGTTTTTCT
7 s C3 X+ v# J, dPPARJ2 FWD GCTGTGCAGGAGATCACAGA 226 bp NM_0050372 M% m8 u8 Y" e: a5 y5 V
PPARJ2 REV GGGCTCCATAAAGTCACCAA
. B" o# z4 x: e* CLipoprotein lipase FWD GTCCGTGGCTACCTGTCATT 212 bp NM_000237
8 H+ K5 @9 j' j9 w; y0 o fLipoprotein lipase REV TGTCCCACCAGTTTGGTGTA& i/ E" W- {& S9 M9 O% [
Sox 9 FWD TTGAGCCTTAAAACGGTGCT 224 bp NM000346* B* a* x; F" w8 d& |
Sox 9 REV CTGGTGTTCTGAGAGGCACA
5 D: k. @/ y* B0 ]Type X collagen FWD TGAGCAGCAACGTAAAAACG 471 bp NM_00049. m! R6 I" A# V2 I3 W& y8 l. M
Type X collagen REV AGGAAATGCCGAGTTTCTCA* C" G0 Y( D1 i8 H, H& I* _8 }
Statistical Analysis
) _ w- C/ [$ ], ~1 ~Statistical analysis was performed with the use of Instat software (GraphPad Software, San
4 b8 b I8 q) {6 h, S; g0 ~Diego, CA, USA). All data were plotted as mean ± standard error of the mean (SEM), unless
( `" E B0 t: k: L5 G+ J$ fotherwise noted. Statistically significant differences were determined by two-tailed Student t: d3 r0 J# C+ {5 j, W/ u
tests, and statistical significance was defined as p < 0.05. |
|
发表于 2011-3-21 23:02
