|
 
- 积分
- 429
- 威望
- 429
- 包包
- 1768
|
本帖最后由 qianqianlaile 于 2011-3-22 22:26 编辑 : ~2 p% F4 d# h8 R* |2 Y
+ c1 o! K# g2 E, w
MATERIALS AND METHODS 7 \% q6 b/ b5 T. a
Isolation of Dental-Derived Stem Cells (PDLSCs, SHEDs)
; C* [; k: I! M# ^. }PDLSCs and SHEDs were harvested as previously described (Miura et. al, 2003; Seo et.
) w1 d6 I, r9 y$ C+ S! y& Oal, 2004). Briefly, PDLSCs were scraped from the root surface of a tooth into a p60 dish
3 P/ s, b, r* y6 I: v2 {) _containing minimum essential alpha medium (DMEM, Gibco) and SHEDs were harvested by ( d9 d3 x) b3 e5 f0 U! ?
scraping out the dental pulp tissue from a deciduous tooth into a p60 dish containing DMEM.
# b2 ?) V' L2 YAfter collection, the cells were centrifuged at 1600 rpm for 5 minutes at room temperature. The
$ ?$ O" Q' D3 _supernatant was aspirated and the cells were resuspended in a phosphate buffered saline (PBS; ' a0 v, V# B0 Q% s% n- P. L
Gibco #14190) solution with 4 mg/ml Dispase II (Roche #04 942 078 001) and 2 mg/ml/ n" D8 k& P' H+ a, _( p
Collagenase Type II (Worthington # LS004196) and incubated at 37°C for 60 minutes. The
! j- a5 b1 _: o) }3 Senzyme solution was inactivated with 5 ml of DMEM- 15% FBS- 100µM ascorbic acid 2
* F: e4 v' w+ x: P9 |; [, F8 b0 d! K0 xphosphate (ASAP, Sigma A-8960) and centrifuged at 1600 rpm for 5 minutes at room% E) E* J) b9 F
temperature. Cells were resuspeneded in 5 ml DMEM- 15% FBS- 0.1mM ASAP and transferred 9 X2 @' p0 \( r, M4 m
to T-25 flasks. Media was changed the next day and then every 2-3 days. ; ]# `2 g' }/ J% P
Cell Culture
5 N' m r( d8 { Cells were expanded in culture in DMEM, Iscove’s modified Dulbecco’s media (IMDM,
& k D* R% R# Y. z$ K9 ~Gibco-Invitrogen #12571), Gibco Stem Pro Mesenchymal Stem Cell Serum-Free Media 6 G+ f8 H' l" i
(MSCSFM; Invitrogen# A1033401) or Lonza Therapeak Mesenchymal Stem Cell Growth ) }5 ]" d: B7 }
Media- Chemically Defined (MSCGM-CD; Lonza #00190632) and grown in a 37°C humidified; `0 N1 \3 @; z2 Z
tissue culture incubator at 5% CO2. Media formulations are as follows: DMem (Gibco-
$ t) A% d2 h% S& [" [Invitrogen #12571) with 15% FBS (Gibco-Invitrogen-16000), 100µM ASAP and 5 µg/ml3 ~& `) z7 d, O' g N# J; r" Y
Gentamicin (Invitrogen # 15750060) (FBS-M); DMem with 2% bovine serum albumin (BSA;
5 M! s3 k3 e" y' rSigma A7888), 10ug/ml human insulin (Sigma), 4ug/ml low density lipoprotein, 200ug/ml$ ~. B2 ?% w+ ` h C
transferrin, 10 nM dexamethasone, 100 uM ASAP, 50 uM ȕ-mercaptoethanol, 5 ug/ml
/ S6 u. n7 n+ b3 wgentamicin, 10ng/ml platelet-derived growth factor (PDGF; Sigma), 10ng/ml epidermal growth
% _$ W+ I% o! O) _& [factor (EGF; R&D Systems), 10ng/ml basic fibroblast growth factor (b-FGF, Sigma) (SDM);
/ P2 Y$ Q0 m% \' u2 v6 iIMDM with 0.2% BSA, SITE 3 (Sigma #S5295), 384µM ASAP, 10 ng/ml PDGF, 10ng/ml
. h* o" U: O% ]2 a B+ Ahydrocortisone 5ng/ml b-FGF, 1 ng/ml EGF, 10-7
* d7 H' ^+ b) L' n- A* r mgm/ml parathyroid hormone (PTH) and 5 0 ^$ J* q, i1 r. X5 i3 k
µg/ml gentamicin (K-M). Media on the cells were changed every 2 or 3 days. Cells were grown
8 Z' i- X+ {. ^0 x4 g+ t3 ~in T-150 flasks to about 80% confluency then media was aspirated from the flasks, cells were 9 B# H! P/ H/ r( }, T. ?) r
washed with PBS and trypsinized with TrypLE Express (Gibco#12605) before being split into 126 v) {" S, Z- Y* A8 k x6 P7 e0 `
well plates for the assays. . k+ c& X4 y/ Q
Fibronectin Coating of Tissue Culture Plates
- V, w5 l8 ^; G$ ~! ?Fibronectin (FN) was coated on the plates and flasks to provide growth and attachment
( u. l5 f, Y, F$ s* @, ]6 xsupport for cells grown in the serum-free, IMDM media. For the 12 well plates, 0.1% FN
# l3 R" g4 A0 m) E. h5 f; |solution (Sigma F-1141) was diluted in PBS so that each well received 3.8 micrograms per well : L6 Z @: E" C1 X
(1µg FN/cm2). The T-150 flasks were coated so that each received 150 micrograms of FN (1µg
/ ~3 D2 b6 d. W% U) U: sFN /cm2). The plates and flasks were tilted back and forth to ensure complete coverage of the : \- z4 U: c# H9 @3 V
FN solution. The FN coating was allowed to stand at room temperature for 90 minutes. The FN " F: q4 y# H9 y# @
solution was then aspirated before the resuspended cells were transferred to the flasks and plates.1 ]. I4 l& A7 Y C5 q# J
Proliferation Assays
+ E4 v8 _) a8 w) c- ~1 M& Y2 nAfter trypsinization cells were resuspended in an equal amount of the appropriate media. _. ?+ t: D& s8 _5 S
before an aliquot was removed for counting on a hemocytometer to determine the concentration.
% k6 V3 S0 L3 f1 ^4 A `9 \The cells were then centrifuged at ~1600 rpm for 5 minutes at room temperature. Cells were ( _6 W& v; e5 k) `/ B
resuspended in the appropriate media at a concentration of 3800 cells per ml. One milliliter of
/ m" B/ q! J: N8 acells was dispensed into each well of a 12 well plate. K-M plates were precoated with FN
( X4 Z) }; d# w. m7 d* d Bsolution (as outlined above). Four plates for each cell type and media condition were plated and . s7 |- @+ f0 f( \9 x: Y
counted on a hemocytometer at days 1, 3, 5 and 7 to determine the cell numbers within each 4 D( u' r( s* ]4 X. E( L
well. All experiments were performed in triplicate.
& F: ]# j+ P8 U3 Q9 U; {RNA Isolation and Purification for MicroArray * h, Z$ @* v: j* Q/ N: G: Q/ K
PDLSCs and SHEDs were grown in T-75 flasks to 80% confluency before the cells were 3 x X6 q4 A M) o
harvested for RNA. The Trizol method (Invitrogen) was used for RNA isolation. This involved 6 K& s! o' I; l' g. _ ~8 {
washing the cell layer with PBS, adding Trizol directly to the cells and transferring this cell
* |; ~& s/ G3 L. b! ssuspension to polypropylene tubes. RNA was isolated from the cells by a Trizol-choloroform
9 T- U, f0 h1 I" y+ t* ~extraction, isopropanol precipitation, an ethanol rinse and resuspension of theRNA pellet in 1 v' T6 ~/ x; D8 t* K: V
Diethylpyrocarbonate (DEPC) water. The RNA was further purified by column
2 w& d* }; _& l. R4 jchromatography, following manufacturer’s instructions (Qiagen RNeasy Kit # 74104), and
e$ c4 M# D7 }resuspended in DEPC water. RNA concentration was determined by the 260/280 absorbance ( s6 }( Z4 D( ~- f( d U% E
measurement using a Beckman DU540 spectrophotometer.
; r1 T% H% n% o/ Y7 iIn Vitro Multilineage Differentiation
0 v: S, S/ X4 WMultipotency of PDLSCs and SHEDs was determined through lineage specific
( B3 U* E- J' E8 [. X' {osteogenic, chondrogenic, and adipogenic induction, according to previously described methods
! v0 u! ^& y- c! {8 ~(Pittenger et. al, 1999). Briefly, cells were plated at a density of 30,000 cells per well in 12 well
4 R# u- w8 c2 u: b( J7 Qplates. At 80% confluency cells were induced with osteogenic [Growth media plus 5mM E-0 v- x- C2 E2 Q1 h
glycerophosphate, 100nM dexamethasone, 50µM ascorbic acid 2-phosphate] or chondrogenic
3 |9 Y$ H/ S( E! [[growth media plus 50µM ascorbic acid 2-phosphate, 100nM dexamethasone, 5 µg/ml human% p: ~) X- R A! \' l0 s0 O$ F4 x
insulin (Sigma I-9278), 1 ng/ml TGFE, 400µM proline, 1X Non essential amino acids] or
: ~6 o5 k# p1 Y7 d5 F- [$ ^adipogenic [growth media plus 0.5mM IBMX, 1 µM dexamethasone, 10 µg/ml human insulin,
# Z$ e+ }$ k! u" U& c# ?0 ~- M1 n. ?200µM indomethacin] induction media. Cells were grown at 37°C in a humidified 5% CO2
" U& c! X" v S7 a& tincubator. The media was changed every 2-3 days. At three weeks the cells were fixed and 0 e: C( \% E c& j* E/ e/ k
stained as outlined below.
& @) w) c0 Q9 x& w- Q% v8 Z) eMultipotent Staining of PDLSCs and SHEDs ' _. U+ Q5 Y. B( W: n
To identify the mineralized nodules, induced PDLSC, SHED and DPSC were fixed in 4%
7 T! z( x4 r! S4 [: H% Fparaformaldehyde for 30 minutes, immersed in fresh 5% silver nitrate and incubated in the dark
% W- ?; P) C: Sfor 30 minutes. After washing in water the PDLSC, SHED and DPSC were exposed to , R* n3 @/ [' p- K* m
ultraviolet light for 30 minutes followed by a four minute incubation in 1% sodium thiosulfate to
* p( Q% w* l; D ?+ j: s* i- Jneutralize the silver nitrate. Cells were washed twice with water before 1 ml of PBS was added
) H, v. f7 [# K8 m% Eto each well and viewed. Plates were stored at 4°C. ! O! C. D. [) m2 z. n
To detect chondrogenic differentiation induced PDLSC, SHED and DPSC were fixed in % _. f' I* n' j
cold 100% methanol for 30 minutes and then exposed to 1% alcian blue in 0.1N HCl for 30
6 ~+ _; Y" d4 o! M' l, @: g* h, lminutes. Cells were washed twice with 0.1N HCl before 1 ml of PBS was added to each well
) X3 Z; u! l c- Band viewed. Plates were stored at 4°C.
& L% S' [( }- x7 x3 ?To detect adipogenic differentiation by identifying lipid vesicles, induced PDLSC, SHED C9 z7 H% o7 C& L8 k5 M) u
and DPSC were fixed in 4% paraformaldehyde for 30 minutes, and then immersed in 0.3% oil
$ L j9 i+ T: Xred O solution for 30 minutes. Cells were washed twice with water before 1 ml of PBS was s, |6 Z# f: u9 K. Y; n$ c
added to each well and viewed. Plates were stored at 4°C.
$ ~: s T, E4 m) l4 h! b0 HAlkaline Phosphatase Activity and Detection3 _1 Y5 L- v- [% g9 B- n
Early osteogenic differentiation was detected and quantified by the alkaline phosphatase
: e$ N+ s6 B1 i. M& j- x(ALP) enzyme assay. Cells were plated at a density of 30,000 cells per well in 12 well plates.3 c \! L1 c9 @3 o8 ^5 d5 p
At 80% confluence, cells were induced with osteogenic media as described above. The media
! K1 W$ M$ `( H% I+ nwas changed every 2-3 days and after one week, ALP activity was measured.' |8 J9 _. C# m8 K0 d
To detect phosphatase activity, PDLSCs and SHEDs were fixed in 70% ethanol for 30
1 S; \# F1 j/ E8 k- z9 j, B* A, \4 Pminutes. They were then incubated with freshly made substrate containing naphthol AS-TR % ~5 a/ j+ ~! t3 A& Y
phosphate (Sigma) and Fast blue (Sigma) for 30 minutes. Cells were washed twice with PBS then
, _! d3 H& D# F. Hviewed or stored at 4’C." x5 N4 x0 e) q& `* {9 c
To quantify the ALP activity and normalize the results, cells were lysed in Passive Lysis ) u8 c4 {- b$ r) u
Buffer (Promega) according to manufacturer’s instructions. Cell lysates were then sonicated,
& T1 a/ o/ d2 n% q5 Xand centrifuged (10,000 rpm for 10 minutes at 4°C). The supernatant was recovered for the 1 W3 R$ Q' d+ p+ N) B5 o1 ^9 H
quantitative colormetric ALP assay (Manolagas et al., 1981) and the cell pellet was used for . |9 T) ~+ E1 w
DNA isolation and the determination of the DNA concentration using the Quant-iT™ dsDNA
! u6 c5 M0 z1 x0 E/ y% j' yBR Assay (Invitrogen) per the manufacturer’s instructions.
- w0 r! s9 N6 cReverse Transcriptase Polymerase Chain Reaction (RT-PCR)
0 y1 _- T; C" d8 ~7 N( u/ Y4 h! {To confirm chondrogenic and adipogenic differentiation, total PDLSC and SHED cellular
0 C- z, N. }" p/ ^1 P) LRNA was extracted, reverse transcribed, and amplified using osteoblast specific gene primers.6 k8 H7 V, c E4 t
Media from the wells of induced and uninduced PDLSCs and SHEDs were aspirated. Cells 7 l. v2 A6 B+ D# T7 j+ e
were immediately resuspended in 1 ml of Trizol (Invitrogen) and RNA was isolated according to
4 M1 L( T! @: j+ o' wthe manufacturer’s instructions. Synthesis of cDNA was performed using Invitrogen’s 7 I. O$ c6 I3 }+ S
SuperScriptII kit and oligo dT. PCR reaction components and concentrations were as described % y" g, }, m( Q/ ?8 h4 p( h# b3 {
in the Invitrogen Platinum Taq polymerase instructions using the primer sets below. An MJ
; O1 r0 ^4 U9 ?8 zthemorcycler was used for the following two PCR reaction conditions: 5 v0 A; u" j8 l" _9 n* S, G6 B6 a
*94°C 2 minutes [94°C 45” 56°C 45” 72°C 1’] X 35 cycles 72°C 15’ + A+ |$ |/ ?5 ], I% a* U
or
M. v, \4 p9 A8 Q**94°C 2 minutes [94°C 45” 67°C 45” 72°C 1’] X 35 cycles 72°C 15’
^* m5 e; s9 l- r1 C8 M b QPCR Primer Pairs
% ^7 p3 S9 L* u# |2 @$ S- YPrimer Name Primer Sequence Product
) q' k6 u& q# {Size6 V) u3 U0 O x. U) }
Accession$ s0 y S+ r+ j9 K' ~; m& ~
Number
6 c, g0 U7 q5 A+ k/ P0 F*GAPDH FWD AGCCGCATCTTCTTTTGCGTC 815 bp NM_0020465 c6 h0 p2 L$ |/ h7 y1 J
*GAPDH REV TCATATTTGGCAGGTTTTTCT0 M: j# ~! U# P7 m9 D) \ H9 \+ u
PPARJ2 FWD GCTGTGCAGGAGATCACAGA 226 bp NM_0050379 x5 J" I! }* E8 _2 ]
PPARJ2 REV GGGCTCCATAAAGTCACCAA
+ n9 [* h+ y8 G* ~$ nLipoprotein lipase FWD GTCCGTGGCTACCTGTCATT 212 bp NM_000237. x2 A+ q2 p# g1 ?$ B) E2 u* m
Lipoprotein lipase REV TGTCCCACCAGTTTGGTGTA
7 @8 Z& D0 F1 G9 rSox 9 FWD TTGAGCCTTAAAACGGTGCT 224 bp NM000346
. v7 {$ m: l3 ESox 9 REV CTGGTGTTCTGAGAGGCACA: F6 p9 T3 S" e- E/ \6 k5 t
Type X collagen FWD TGAGCAGCAACGTAAAAACG 471 bp NM_00049
1 Z! u4 t, ]# U; u$ L, | \/ Z8 ^Type X collagen REV AGGAAATGCCGAGTTTCTCA3 i2 v" ]5 n' J# W9 G9 z- ~
Statistical Analysis ; C. u6 L4 W$ m! N
Statistical analysis was performed with the use of Instat software (GraphPad Software, San ( o# D) Z0 q9 m& |& H7 {6 [0 ?# s) b
Diego, CA, USA). All data were plotted as mean ± standard error of the mean (SEM), unless 1 A- w# w: s1 R& f
otherwise noted. Statistically significant differences were determined by two-tailed Student t0 I |* m/ x1 M2 ^# f( e: a& |- r; b
tests, and statistical significance was defined as p < 0.05. |
|
发表于 2011-3-20 08:21
% O: c6 w0 K2 i0 O
，脑子里也没有独家生产这个概念
，所以没理解。