|
 
- 积分
- 429
- 威望
- 429
- 包包
- 1768
|
本帖最后由 qianqianlaile 于 2011-3-22 22:26 编辑 - g5 {, B; f+ p i' F; [
9 M& {: h7 R) H; BMATERIALS AND METHODS
+ _6 Q/ @' a3 l; H/ uIsolation of Dental-Derived Stem Cells (PDLSCs, SHEDs) 6 i y( Y( U6 Q, h
PDLSCs and SHEDs were harvested as previously described (Miura et. al, 2003; Seo et.
% u+ X$ z: ]0 n& q3 lal, 2004). Briefly, PDLSCs were scraped from the root surface of a tooth into a p60 dish
( X! ]1 u$ i4 l3 ?8 mcontaining minimum essential alpha medium (DMEM, Gibco) and SHEDs were harvested by ; h4 Z2 e4 b& {3 k2 G m
scraping out the dental pulp tissue from a deciduous tooth into a p60 dish containing DMEM.8 _, M- E5 ?% M( P4 [: T" c
After collection, the cells were centrifuged at 1600 rpm for 5 minutes at room temperature. The
5 h- Y7 f! S. p+ O; s% |supernatant was aspirated and the cells were resuspended in a phosphate buffered saline (PBS;
7 u, o: I2 o* pGibco #14190) solution with 4 mg/ml Dispase II (Roche #04 942 078 001) and 2 mg/ml
9 w, c: e7 I4 x8 ~$ aCollagenase Type II (Worthington # LS004196) and incubated at 37°C for 60 minutes. The ; H \: }1 c, e1 ^8 c5 }& Q
enzyme solution was inactivated with 5 ml of DMEM- 15% FBS- 100µM ascorbic acid 2
m3 U" H/ ^* h2 K+ c4 s* L$ pphosphate (ASAP, Sigma A-8960) and centrifuged at 1600 rpm for 5 minutes at room, l2 w* C1 P- ]1 M- n
temperature. Cells were resuspeneded in 5 ml DMEM- 15% FBS- 0.1mM ASAP and transferred 8 H2 L3 }; n" f! ]4 S2 F
to T-25 flasks. Media was changed the next day and then every 2-3 days. 2 z$ V: ?! c7 ~6 M
Cell Culture
' L0 m$ _7 X; Y ] n$ j Cells were expanded in culture in DMEM, Iscove’s modified Dulbecco’s media (IMDM,
+ t1 Y' |! }3 A: B8 tGibco-Invitrogen #12571), Gibco Stem Pro Mesenchymal Stem Cell Serum-Free Media 6 t& }% Q# H9 u' A9 n" g) x. S
(MSCSFM; Invitrogen# A1033401) or Lonza Therapeak Mesenchymal Stem Cell Growth # c9 q- d0 ^ l9 \2 r5 X5 S) B
Media- Chemically Defined (MSCGM-CD; Lonza #00190632) and grown in a 37°C humidified
6 q% W2 U0 k0 e8 utissue culture incubator at 5% CO2. Media formulations are as follows: DMem (Gibco-6 d+ z9 ^$ Y3 z ]
Invitrogen #12571) with 15% FBS (Gibco-Invitrogen-16000), 100µM ASAP and 5 µg/ml
) w/ A1 t- x$ ?4 Q- G% ~' s+ @ BGentamicin (Invitrogen # 15750060) (FBS-M); DMem with 2% bovine serum albumin (BSA; : c# a4 f5 j0 N/ b/ y3 h
Sigma A7888), 10ug/ml human insulin (Sigma), 4ug/ml low density lipoprotein, 200ug/ml
H8 H% w" d% c# y- itransferrin, 10 nM dexamethasone, 100 uM ASAP, 50 uM ȕ-mercaptoethanol, 5 ug/ml
8 q6 |' x( x; |- R9 ^gentamicin, 10ng/ml platelet-derived growth factor (PDGF; Sigma), 10ng/ml epidermal growth " {$ e& q% K; ]
factor (EGF; R&D Systems), 10ng/ml basic fibroblast growth factor (b-FGF, Sigma) (SDM);
8 Q; z6 j# ~5 G: b- |- PIMDM with 0.2% BSA, SITE 3 (Sigma #S5295), 384µM ASAP, 10 ng/ml PDGF, 10ng/ml# B! `! t' {4 s( s, I' t: z
hydrocortisone 5ng/ml b-FGF, 1 ng/ml EGF, 10-7
! F9 z! s7 m" B. b3 K% w& P mgm/ml parathyroid hormone (PTH) and 5
& w$ d% w' a" M9 {6 J, f0 R/ u0 Tµg/ml gentamicin (K-M). Media on the cells were changed every 2 or 3 days. Cells were grown
" k; R/ o6 V7 x% x2 [in T-150 flasks to about 80% confluency then media was aspirated from the flasks, cells were
0 q" g" }4 m* p7 iwashed with PBS and trypsinized with TrypLE Express (Gibco#12605) before being split into 12) z" m; t. _3 U" _+ ?
well plates for the assays.
8 |1 v) o! u6 R4 ^: i. c6 LFibronectin Coating of Tissue Culture Plates
9 Q0 x2 f) d- y* J" D p% hFibronectin (FN) was coated on the plates and flasks to provide growth and attachment8 ]9 l* V7 u6 }5 Z
support for cells grown in the serum-free, IMDM media. For the 12 well plates, 0.1% FN
5 u8 s" ]; E4 x3 o G; W3 v1 Psolution (Sigma F-1141) was diluted in PBS so that each well received 3.8 micrograms per well
, M1 c; J" E' `(1µg FN/cm2). The T-150 flasks were coated so that each received 150 micrograms of FN (1µg
5 b( F: D4 F3 A5 H- F) \FN /cm2). The plates and flasks were tilted back and forth to ensure complete coverage of the
) A# I! H$ }6 e7 nFN solution. The FN coating was allowed to stand at room temperature for 90 minutes. The FN
: i4 E- n+ d0 {- n6 osolution was then aspirated before the resuspended cells were transferred to the flasks and plates.
7 ]" W$ C$ V1 S: b1 `, PProliferation Assays7 p8 W1 k0 {4 W# |$ \% k0 L. g
After trypsinization cells were resuspended in an equal amount of the appropriate media; b. {2 f, a I0 j# @2 x$ V& H
before an aliquot was removed for counting on a hemocytometer to determine the concentration.1 K0 f, E- z, q5 k4 \5 D
The cells were then centrifuged at ~1600 rpm for 5 minutes at room temperature. Cells were & G1 y$ g% ^0 N
resuspended in the appropriate media at a concentration of 3800 cells per ml. One milliliter of 5 A' n) r1 L5 F5 B
cells was dispensed into each well of a 12 well plate. K-M plates were precoated with FN ) C; Q3 c! P% b6 a3 ~
solution (as outlined above). Four plates for each cell type and media condition were plated and 3 x; [# H* q4 [* I
counted on a hemocytometer at days 1, 3, 5 and 7 to determine the cell numbers within each
( f0 K8 _' r1 F( J- j' W/ b& {: Cwell. All experiments were performed in triplicate.
+ Z7 A' t0 X% w: Q1 b6 aRNA Isolation and Purification for MicroArray . v" V; j s! Q- E5 T
PDLSCs and SHEDs were grown in T-75 flasks to 80% confluency before the cells were 4 q5 X1 ^1 l0 M0 I) r
harvested for RNA. The Trizol method (Invitrogen) was used for RNA isolation. This involved
B3 z2 u( z/ l9 h' |3 V2 Cwashing the cell layer with PBS, adding Trizol directly to the cells and transferring this cell
/ c8 H2 y6 e# }" s8 zsuspension to polypropylene tubes. RNA was isolated from the cells by a Trizol-choloroform; L) A& b, L# w# u* }; `( Y9 L
extraction, isopropanol precipitation, an ethanol rinse and resuspension of theRNA pellet in
- ?" x c' m# y$ ~* PDiethylpyrocarbonate (DEPC) water. The RNA was further purified by column( s. H+ Z) `% b' V( x S( P5 W
chromatography, following manufacturer’s instructions (Qiagen RNeasy Kit # 74104), and
2 W# A- S! F% g+ ~- @: w m, |0 j2 [resuspended in DEPC water. RNA concentration was determined by the 260/280 absorbance 5 Q2 ]& m) J8 D) P& E) C# A
measurement using a Beckman DU540 spectrophotometer.
/ N3 M4 a; F4 d- x* a$ J3 ?, xIn Vitro Multilineage Differentiation t& l: A! ]8 c2 e# M" m/ e
Multipotency of PDLSCs and SHEDs was determined through lineage specific
4 Q; _' o8 w# A! V, B& ~ v# Tosteogenic, chondrogenic, and adipogenic induction, according to previously described methods, `% \3 h; j9 Z7 y T: X* F
(Pittenger et. al, 1999). Briefly, cells were plated at a density of 30,000 cells per well in 12 well + J9 D6 T9 |9 ^, G' {; w
plates. At 80% confluency cells were induced with osteogenic [Growth media plus 5mM E- G+ P* q2 [& {$ [& L3 B+ h' a
glycerophosphate, 100nM dexamethasone, 50µM ascorbic acid 2-phosphate] or chondrogenic
, q+ |; s# H7 k0 V) w7 p& @[growth media plus 50µM ascorbic acid 2-phosphate, 100nM dexamethasone, 5 µg/ml human/ N" n0 `9 I" t/ ~$ @
insulin (Sigma I-9278), 1 ng/ml TGFE, 400µM proline, 1X Non essential amino acids] or
9 o( k% M1 N2 G1 S$ Kadipogenic [growth media plus 0.5mM IBMX, 1 µM dexamethasone, 10 µg/ml human insulin, 5 R0 a$ z4 S" N' h4 ^' _' ]% c
200µM indomethacin] induction media. Cells were grown at 37°C in a humidified 5% CO2
- \! q! N" ]: H8 H5 S- s2 o: ?incubator. The media was changed every 2-3 days. At three weeks the cells were fixed and
6 J. j& u! |$ j6 [stained as outlined below.
6 l5 }: q3 K1 H7 CMultipotent Staining of PDLSCs and SHEDs
) z S/ i; @, K8 H" t! s9 eTo identify the mineralized nodules, induced PDLSC, SHED and DPSC were fixed in 4% $ O/ h; i- P' W5 ]! N
paraformaldehyde for 30 minutes, immersed in fresh 5% silver nitrate and incubated in the dark # k, S" R7 Y+ S0 S1 D% P
for 30 minutes. After washing in water the PDLSC, SHED and DPSC were exposed to
8 c9 J$ ?$ y; D; s. A1 d# C/ sultraviolet light for 30 minutes followed by a four minute incubation in 1% sodium thiosulfate to 8 ]4 Z8 _' H2 W: k
neutralize the silver nitrate. Cells were washed twice with water before 1 ml of PBS was added : _* j7 z- c4 n( i. g1 k: {& ~/ ]2 e
to each well and viewed. Plates were stored at 4°C. + W0 f1 X. t% Z7 Z
To detect chondrogenic differentiation induced PDLSC, SHED and DPSC were fixed in
9 _/ V2 a* F5 hcold 100% methanol for 30 minutes and then exposed to 1% alcian blue in 0.1N HCl for 30
6 D5 Y7 K8 {5 C6 a; |minutes. Cells were washed twice with 0.1N HCl before 1 ml of PBS was added to each well
; n0 [, ? j% eand viewed. Plates were stored at 4°C." D& c3 s! n) j# p! M' J. u; s7 z {
To detect adipogenic differentiation by identifying lipid vesicles, induced PDLSC, SHED
4 b/ Z' p+ z" K& e* Uand DPSC were fixed in 4% paraformaldehyde for 30 minutes, and then immersed in 0.3% oil
# r, A, c/ Q+ k% k7 V- xred O solution for 30 minutes. Cells were washed twice with water before 1 ml of PBS was
9 k3 Q* e: y9 {/ q( p: K4 Y/ b. L1 qadded to each well and viewed. Plates were stored at 4°C.
1 x* g0 C/ Q! X+ T9 gAlkaline Phosphatase Activity and Detection3 u) v- M7 \! F
Early osteogenic differentiation was detected and quantified by the alkaline phosphatase , ~$ y/ A8 F. M) j6 Z; B5 ^# s
(ALP) enzyme assay. Cells were plated at a density of 30,000 cells per well in 12 well plates.* d/ D. R# I# J' J2 y/ V
At 80% confluence, cells were induced with osteogenic media as described above. The media
1 {0 d+ D8 G! Q5 M" [1 s; W+ ^was changed every 2-3 days and after one week, ALP activity was measured.
2 H2 w3 \- D |0 n0 U" w! hTo detect phosphatase activity, PDLSCs and SHEDs were fixed in 70% ethanol for 30 # I+ L6 h1 v3 ]5 K
minutes. They were then incubated with freshly made substrate containing naphthol AS-TR
. k$ r& B: q4 x. Y' D3 }+ p: Pphosphate (Sigma) and Fast blue (Sigma) for 30 minutes. Cells were washed twice with PBS then . B& E" o2 i( o# g
viewed or stored at 4’C.- d) d- I1 {- r8 {- E+ ~
To quantify the ALP activity and normalize the results, cells were lysed in Passive Lysis
+ }9 m) X! X5 S, H% G" zBuffer (Promega) according to manufacturer’s instructions. Cell lysates were then sonicated,
% j7 `; |- d- `! k3 L! G: `and centrifuged (10,000 rpm for 10 minutes at 4°C). The supernatant was recovered for the : [" d/ y3 B" L5 |2 a9 U# f
quantitative colormetric ALP assay (Manolagas et al., 1981) and the cell pellet was used for
. \+ R% L$ j( ~' n, `DNA isolation and the determination of the DNA concentration using the Quant-iT™ dsDNA
5 Y6 z7 X5 O0 n$ EBR Assay (Invitrogen) per the manufacturer’s instructions.
; d9 R/ K1 k/ [3 bReverse Transcriptase Polymerase Chain Reaction (RT-PCR) , X! e9 f% R5 v1 m; N C# c
To confirm chondrogenic and adipogenic differentiation, total PDLSC and SHED cellular
$ }# ~: P* M6 B+ |1 v% mRNA was extracted, reverse transcribed, and amplified using osteoblast specific gene primers.3 n; i: g) C, s4 ^! Y
Media from the wells of induced and uninduced PDLSCs and SHEDs were aspirated. Cells 6 t& T: B( f7 m
were immediately resuspended in 1 ml of Trizol (Invitrogen) and RNA was isolated according to 9 `- @% W7 d" s8 M
the manufacturer’s instructions. Synthesis of cDNA was performed using Invitrogen’s ! {, z' S* f, W8 z/ R* P
SuperScriptII kit and oligo dT. PCR reaction components and concentrations were as described
t6 m6 Q) [0 ^; n) @1 win the Invitrogen Platinum Taq polymerase instructions using the primer sets below. An MJ
4 s$ W) |% U0 Z) n1 mthemorcycler was used for the following two PCR reaction conditions: 1 E7 [8 A4 D; V+ x. ?3 \
*94°C 2 minutes [94°C 45” 56°C 45” 72°C 1’] X 35 cycles 72°C 15’
6 o: M+ O- _/ L w3 z7 S" Ior
& B; {/ l: y$ F**94°C 2 minutes [94°C 45” 67°C 45” 72°C 1’] X 35 cycles 72°C 15’
p' h9 a" A( Q; u# ^# F; [PCR Primer Pairs
; `5 n4 i; `* j8 U: J2 G( ]Primer Name Primer Sequence Product, K' o' [" W, i# f- L0 r
Size
5 v( P3 M ?/ G4 X* KAccession- |) x7 b5 Z* \ l- m
Number
5 m7 z) R4 s) g3 a1 u*GAPDH FWD AGCCGCATCTTCTTTTGCGTC 815 bp NM_002046
1 _* l |: A: k2 l, a4 g*GAPDH REV TCATATTTGGCAGGTTTTTCT4 a7 C. P) G' k3 W! C* j$ g- s
PPARJ2 FWD GCTGTGCAGGAGATCACAGA 226 bp NM_0050373 C3 z; z* l' K, u* Z4 r, {
PPARJ2 REV GGGCTCCATAAAGTCACCAA
: c# s8 ~0 w8 d5 |# Q. ?" o5 wLipoprotein lipase FWD GTCCGTGGCTACCTGTCATT 212 bp NM_000237
! p7 }+ r3 U% f0 ~) y/ BLipoprotein lipase REV TGTCCCACCAGTTTGGTGTA
' y$ A5 Z: z5 I. Y. N% u& pSox 9 FWD TTGAGCCTTAAAACGGTGCT 224 bp NM000346
8 f. i( k/ x" wSox 9 REV CTGGTGTTCTGAGAGGCACA3 y; \. C5 ~& Q# V/ j' I# k4 L
Type X collagen FWD TGAGCAGCAACGTAAAAACG 471 bp NM_00049
- {; V# Y [5 Q2 K8 s5 FType X collagen REV AGGAAATGCCGAGTTTCTCA2 K1 p, H8 R$ \* q
Statistical Analysis # e) c* U+ d& \: V
Statistical analysis was performed with the use of Instat software (GraphPad Software, San
+ T4 h7 g1 P2 L; j, cDiego, CA, USA). All data were plotted as mean ± standard error of the mean (SEM), unless 4 c2 A$ E& E2 g5 h0 Z
otherwise noted. Statistically significant differences were determined by two-tailed Student t* [* W" r8 v7 ?% R& p* D- J8 a5 M
tests, and statistical significance was defined as p < 0.05. |
|
发表于 2011-3-20 08:21
，脑子里也没有独家生产这个概念
，所以没理解。+ ~/ k; `& G$ w9 {4 J" {' N% S
( o" H/ O+ W. v' Z. V4 L