Bone Marrow Lacks a Transplantable Progenitor for Smooth Muscle Type -ActinCExpr - 《stemcells》干细胞学杂志干细胞之家



免疫细胞治疗专区	欢迎关注干细胞微信公众号

12 3 4 5 6 7 8 9 10 ... 28 下一页

返回列表

查看: 510944\|回复: 273	go Bone Marrow Lacks a Transplantable Progenitor for Smooth Muscle Type -ActinCExpr [复制链接]

江边孤钓

版主

Rank: 7 Rank: 7 Rank: 7

积分: 0
威望: 0
包包: 483

楼主

发表于 2009-3-5 00:14 |只看该作者 |倒序浏览 |打印

作者：Takafumi Yokotaa, Yutaka Kawakamib, Yoshinori Nagaia, Jian-xing Mab, Jen-Yue Tsaic, Paul W. Kincadea, Sanai Satob作者单位：a Immunobiology and Cancer Program, Oklahoma Medical Research Foundation, Oklahoma City, Oklahoma;b Department of Medicine, University of Oklahoma Health Science Center, Oklahoma City, Oklahoma;c National Eye Institute, NIH, Bethesda, Maryland, USA
   7 H0 q# }% ?7 f7 B; {) H
   % \- B& c+ `( z' ]
      0 T; R$ _4 i6 c& j& r


         , R+ B' D4 P1 ?  h  V


                  4 V  T. c* {  m# P" _5 A7 ~4 ?



      【摘要】( R( w7 I7 n! P+ @0 t2 f
   While some studies have suggested that hematopoietic stem cells might give rise to other tissue types, others indicate that transdifferentiation would have to be an extremely rare event. We have now exploited smooth muscle type -actin (SMA) promoter¨C driven green fluorescent protein (GFP) transgenic mice (SMA-GFP mice) for bone marrow transplantation to evaluate their potential to generate donor-type tissues in irradiation chimeras. There was a highly restricted pattern of GFP expression in the transgenic mice, marking bone marrow stromal cells and mesangial cells in the kidney. However, these characteristics were not transferable to wild-type animals given transgenic marrow cells even though hematopoietic cells were largely replaced. Our findings support earlier studies suggesting that the bone marrow microenvironment is difficult to transplant and indicate that hematopoietic stem cells are unlikely to give rise to SMA-expressing progeny. 7 |1 u/ M! u0 }
      【关键词】 Hematopoietic stem cells Stromal cells Transdifferentiation Smooth muscle -actin Transgenic green fluorescent protein mouse3 ]* l) y: H  `0 n2 x
   INTRODUCTION

Bone marrow contains hematopoietic stem cells (HSCs) and mesenchymal stem cells (MSCs) . This has raised the hope of developing new stem cell strategies for tissue repair and regeneration.; p+ I1 M2 L$ |2 Q+ ~. {# J8 z/ |" |

Recent studies with nonspecific green fluorescent protein (GFP) transgenic mice have also suggested that bone marrow HSCs may give rise into other tissue/cell types, including vascular smooth muscle cells . To address these issues, the specific identification of the cells of interest and minimizing the potential of false-positive results by cell fusion are crucial.

Recently, we have developed a new transgenic smooth muscle type -actin (SMA)-GFP mouse that carries a GFP gene coupled with SMA regulatory sequence . By utilizing this SMA-GFP mouse as a bone marrow donor, the smooth muscle cells originating from transplanted bone marrow cells can be specifically identified by the expression of GFP. Here, we report that bone marrow of SMA-GFP mouse contains GFP  (SMA-expressing) cells. However, a progenitor for SMA-expressing cells was not transplantable in systemic bone marrow chimeras even when hematopoiesis was successfully reconstituted by transplanted stem cells. Developmental plasticity of HSCs seems to be strictly limited, and the transdifferentiation of HSCs into mesenchymal cells unlikely occurs in vivo.
! _& U/ O/ k4 X( s* m
MATERIALS AND METHODS

SMA-GFP and Tie2-GFP Mice& o- m6 K. D% `" v+ b6 j

The SMA-GFP mice (C57BL6) that express GFP under the control of SMA promoter were produced in the Transgenic Mice Facility of the National Eye Institute, NIH. The SMA promoter was provided by Dr. James A. Fagin of Ohio State University (see Wang et al. .

Tie2-GFP mice that express GFP under endothelial-specific receptor tyrosine kinase (Tek, also called Tie-2) promoter were first described by Motoike et al. .

All experimental procedures involving animals were reviewed by the Institutional Animal Care and Use Committee of University of Oklahoma Health Sciences Center, and animals were cared for in accordance with its guidelines.6 m* d5 P2 n2 P; s" q/ \: Z
6 k* [9 J' U, B+ Z- d2 ?5 I
Bone Marrow Transplantation, J5 c7 e0 s/ H6 A
6 e7 T* T9 V$ O! k
Bone marrow transplantation was performed with SMA-GFP and Tie2-GFP mice as donors and Rag2¨C/¨C mice (T- and B-cell deficient . Unless specifically mentioned, all experiments in this study were conducted at 6 months after the bone marrow transplantation was performed.

Vascular Smooth Muscle Cells
0 E+ v- r0 r0 e8 E
Aortas were obtained from SMA-GFP mice immediately after they were euthanized with carbon dioxide suffocation. The aortas were carefully dissected, and all contaminating tissues were removed under a microscope. The obtained aortas were minced into small pieces with two blades and cultured in Dulbecco¡¯s modified Eagle¡¯s medium (DMEM) supplemented with 10% fetal calf serum (FCS) (Biofluids Inc., Rockville, MD, http://www.biofluids.com) in collagen-coated culture plates (Becton Dickinson Labware, Bedford, MA, http://www.bd.com) under a 5% carbon dioxide atmosphere. The cells were grown from the pieces of aorta attached to the culture plate within a few days and expanded at least up to four to five passages. In this study, the cells were used at four passages. The identity of cells was confirmed by detecting the expression of GFP and immunostaining with antibody against SMA (Sigma-Aldrich, St. Louis, http://www.sigmaaldrich.com). Retinal capillary pericytes were cultured as previously reported .$ a: n) _5 U! V0 ~

Isolation of Renal Glomeruli and Mesangial Cell Cultures
4 C9 E4 `" k1 H7 {$ h' S
Immediately after the mice were killed, kidneys were dissected into cortex and medulla regions. The cortex was minced into small pieces with blades and passed through a 50-mesh stainless steel sieve (sieve opening, 300 µm; VWR International, Bristol, CT, http://www.vwr.com) and a 100-µm nylon cell strainer (BD Biosciences, Franklin Lakes, NJ, http://www.bdbiosciences.com). In this differential sieving, the intact glomeruli retained on the 100-µm nylon cell strainer, whereas many small-tissue debris/fragments went through the strainer. The glomeruli were washed and resuspended in PBS. The purity of glomeruli was confirmed by microscopy.
8 g! J. ^/ [5 e' B1 ~
To culture mesangial cells, the glomeruli were incubated with 750 U/ml collagenase (type IA) (Sigma-Aldrich) in PBS at 37¡ãC for 25 minutes. After being washed with PBS, the digested glomeruli were cultured in DMEM media containing 10% FCS. The identity of cells was confirmed by immunostaining with antibody against SMA.

Antibodies and Cell Sorting
# a3 E% |- D1 X1 }* x, D& X4 V6 ^
The antibodies phycoerythrin (PE)-conjugated Flk-1 and Sca-1 (Ly6A/E; D7) monoclonal antibodies (mAbs) and allophycocyanin (APC)-conjugated CD44, Mac-1, and c-kit (2B8) mABs were all purchased from BD PharMingen (San Diego, http://www.bdbiosciences.com/pharmingen). PE-conjugated anti-Tie2 (TEK) was purchased from eBioscience (San Diego, http://www.ebioscience.com). The stained cells with PE- or APC-conjugated antibodies were subjected to sorting on a MoFlo (DakoCytomation, Fort Collins, CO, http://www.dakocytomation.us). Flow cytometric analysis was performed with a FAC-Scalibur and the Cellquest program (Becton Dickinson Labware).: B- E) l+ B7 i0 d  W/ c

Isolation of Bone Marrow Hematopoietic Stem Cells and Peripheral Mononuclear Cells

Bone marrow cells collected from mice were suspended with Hanks¡¯ medium supplemented with 3% FCS. Cells were incubated with antibodies to lineage markers (Gr-1 and Mac-1 for myeloid cells, anti-CD19 and anti-CD45RA for B lineage cells, and TER-119 for erythroid cells), followed by incubation with goat anti-rat immunoglobulin G-coated magnetic beads (Miltenyi Biotec, Bergisch Gladbach, Germany, http://www.miltenyibiotec.com). Cells attached to beads were removed with a magnetic separator using negative selection columns. The lineage-depleted bone marrow cells were then incubated with a mixture of labeled antibodies to the lineage markers (fluorescein isothiocyanate-conjugated anti-CD3, anti-CD8, anti¨CGr-1, anti¨CMac-1, anti¨CTER-119, anti-CD2, and anti-CD45R) and APC-conjugated anti¨Cc-kit antibody and PE-conjugated anti¨CSca-1 antibody to sort lineage marker¨Cnegative (Lin¨C) c-kit  and Sca-1  populations. In this study, Lin¨C Sca-1  c-kit  cells were used as HSC-enriched cells.
5 z# x8 F0 O  O
Peripheral mononuclear cells were separated from blood by centrifugation on Ficoll/Hypaque (lymphocyte separation medium; Cellgro, Mediatech, Herndon, VA, http://www.cellgro.com).# e: |" A% v. r8 v2 J5 O+ ?

DNA Preparation and Polymerase Chain Reaction* I! H$ g$ ]$ _& ?' ^+ u

DNA isolation was performed with a QIAshredder (Qiagen, Valencia, CA, http://www1.qiagen.com) and a DNA isolation kit (QIAprep mini spin kit, Qiagen). All experiments were conducted according to the manufacturer¡¯s instructions.

PCR was conducted using PuReTaq Ready-To-Go PCR Beads (0.2 ml tubes/plate, Amersham Biosciences, Piscataway, NJ, http://www.amersham.com) on a GeneAmp PCR System 9700 (Applied Biosystems, Foster City, CA, http://www.appliedbiosystems.com). Approximately 50 ng of isolated genomic DNA was amplified in a total volume of 25 µl with PCR beads that contained 2.5 units of Tag DNA polymerase, 10 mM Tris-HCl (pH 9.0), 50 mM KCl, 1.5 mM MgCl2, 200 µ M of dATP, dCTP, dGTP, and dTTP, and RNase/DNase-free bovine serum albumin. The amplification was performed by a total of 32 cycles of denaturation at 95¡ãC for 1 minute, annealing at 55¡ãC for 1 minute, and elongation at 72¡ãC for 30 seconds. The products were visualized by ethidium bromide after electrophoresis on 1% agarose gel. The primers used were AGAACATCATCCCTGCATCC (sense primer) and CTGGGATGGAAATTGTGAGG (antisense primer) for glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (product size, 500 bp) and AAGGGCGAGGAGCTGTTCAC (sense primer) and TTCTGCTGGTAGTGGTCGGC (anti-sense primer) for GFP (product size, 495 bp)./ H0 ]) `( ~/ I+ A$ e

Real-time PCR was conducted on a Smart Cycler II system (Cepheid, Sunnyvale, CA, http://www.cepheid.com) using SYBER Green reverse transcription¨CPCR reagents (Applied Biosystems). The experiments were performed according to the manufacturer¡¯s instructions.
7 J  K+ V# K7 k- m" c, S% u
RESULTS

SMA-GFP Mice Express GFP in Vascular Smooth Muscle Cells Including Renal Glomerular Mesangial Cells
5 X2 b) h2 `( J2 W
SMA-GFP transgenic mice carry a GFP gene regulated by the SMA promoter, and GFP expression is strictly limited to the cells that express SMA , GFP was still detectable in glomeruli isolated from SMA-GFP mice (Fig. 2A). Moreover, in cell culture, mesangial cells all displayed the high levels of GFP expression (Fig. 2B). This indicates that, by using SMA-GFP mice as bone marrow donors, newly formed smooth muscle cells and glomerular mesangial cells of bone marrow origin can be specifically identified.' Q# k- x5 m. R- I8 Q3 T
0 F+ i9 t( R8 G. b  V. [, ]
Figure 1. Green fluorescent protein (GFP) images of flat mount of retina (A) and cultured retinal capillary pericytes (B) from smooth muscle type -actin¨CGFP mice. Note that GFP was expressed only in retinal vasculature. The signals of GFP were stronger in arterioles than venuoles, reflecting the thickness of smooth muscle layers of vessels.& ~1 r/ `3 `' C3 B& R) C

Figure 2. Green fluorescent protein (GFP) expression in renal glomerulus (A) and mesangial cells (B) isolated from smooth muscle type -actin¨CGFP mouse. In (A), GFP image is overlapped on the phase-contrast image of isolated glomerulus.
9 U- ]% \- T# M! a0 i. u
Bone Marrow of SMA-GFP Transgenic Mice Contains a Small Population of GFP  Cells! V6 X$ F' }- ?* i1 t1 D9 I

Using an isolation method for authentic GFP  cells, a small GFP  population (0.02%¨C0.03% of bone marrow mononuclear cells) could be specifically detected and sorted from bone marrow . No GFP  cells were detectable in wild-type mice. Those marrow-derived SMA-GFP  cells were heterogeneous with respect to Sca-1, c-kit, and Mac-1 expression (Fig. 3). Their surface phenotype was Sca-1¨C in 82.2%, c-kit¨C in 70.4%, and Mac-1  in 55.4%, whereas CD44 was detectable on more than 99% of the cells. Those GFP  cells were distinct from endothelial lineage cells because two vascular endothelial cell markers, Tie-2 and Flk-1 (VEGFR2, KDR), were negative. The marrow-derived GFP  cells were also distinct from vascular smooth muscle cells. The cells isolated from aorta of SMA-GFP mice were brighter in GFP intensity and exclusively negative for Mac-1 expression (Fig. 4). Importantly, similar GFP  cells to ones in bone marrow were also detectable in peripheral blood of SMA-GFP mice at very low frequencies (approximately 0.15% of mononuclear cells).
: }- B/ v9 n% l6 N( m
Figure 3. Expression of surface phenotype of green fluorescent protein (GFP)-positive bone marrow cells from smooth muscle type -actin¨CGFP mice.: G4 x3 y+ |% e. |; E+ F2 \
# p' p7 Q; ^+ G. Z
Figure 4. Comparison of green fluorescent protein (GFP)¨Cpositive bone marrow cells (left) and aorta smooth muscle cells (right) isolated from smooth muscle type -actin¨CGFP mice.

Bone Marrow Stromal Cells Derived From SMA-GFP Mice Express GFP
' U% _! z( L, f2 ?
Although SMA is a well-established cell marker for smooth muscle cells and differentiated myofibroblasts . To confirm the SMA expression in stromal cells, we examined whether GFP  cells were detectable in bone marrow cell cultures established from SMA-GFP mice (Fig. 5)." ^" D% x. x  D- ?* z, b
$ C8 h  i  b6 |3 {2 U- B! v
Figure 5. Green fluorescent protein (GFP) expression in bone marrow stromal cells isolated from smooth muscle¨Ctype -actin (SMA)-GFP mice. Bone marrow cells from SMA-GFP mice were cultured in Dulbecco¡¯s modified Eagle¡¯s medium supplemented with 10% fetal calf serum. (A): Phase-contrast image of the cells cultured for 7 days. (B): GFP image of (A). (C): GFP image of the cells after the culture for 14 days. Note that GFP is positive only in the cells (stromal cells) that strongly attached to the culture plate but not in other cell types.6 n4 K) F, ]( C5 p

Bone marrow cells obtained from SMA-GFP mice were cultured in DMEM media supplemented with 10% FCS that had been widely used for the culture of vascular smooth muscle cells and capillary pericytes . Although no obvious GFP  cells were observed at the initiation of culture, cells with high GFP intensity became conspicuous among the cells attached to the culture plate within 1 to 2 weeks. When the culture was continued, GFP  cells gradually dominated among the attached cells. The bone marrow cells were also cultured in Dexter media that can support in long-term the growth of hematopoietic cells as well as stromal cells. GFP expression was detected only in the stromal cells that were strongly attached to culture plates. No hematopoietic cells grown in the same culture showed GFP expression. This indicates that bone marrow contains stromal progenitors that differentiate into cells expressing SMA.& \5 E( l) _; A# W# n- T

Because SMA-GFP mice contain GFP  bone marrow cells, there is a possibility that this small population of GFP  cells can be the source for SMA-expressing (GFP ) stromal cells. To test this possibility, GFP  cells sorted from bone marrow cells of SMA-GFP mice were cultured in DMEM media containing 10% FCS. However, no GFP  stromal cells were detected in culture even after more than 4 weeks. It is also possible that, to differentiate into stromal cells, these cells may require the interaction with some other cell types. To test this possibility, the same GFP  cells were also cultured together with the whole bone marrow cells from wild-type mice. However, stromal cells grown in this culture were all GFP negative. This suggests that SMA-expressing (GFP ) cells are unlikely to be the progenitors for SMA-expressing stromal cells.

SMA-GFP Chimeric Mice Reconstitute Hematopoiesis With Stem Cells Carrying a SMA-GFP Transgene

To test the hypothesis that bone marrow cells can be a source of progenitors for vascular smooth muscle cells or glomerular mesangial cells, we performed bone marrow transplantation to create a chimeric model in which marrow cells from SMA-GFP mice were transferred into wild-type mice (Rag2¨C/¨C mice) that received a lethal dose (950 rads) of irradiation. Because neither granulocytes nor monocytes express SMA, the possible artifact by cell fusion  could be minimized by using SMA-GFP mice as bone marrow donors.
# x& W0 y+ N9 t- j4 s7 t6 E0 B4 H
The long-term reconstitution of hematopoiesis by donor HSCs was confirmed by detecting the GFP transgene in bone marrow cells at 6 months after bone marrow transplantation. In PCR analysis (Fig. 6), the GFP transgene was detected in whole bone marrow cells, sorted Lin¨C c-kit  Sca-1  cells, and peripheral mononuclear cells (MNCs) obtained from the recipients of SMA-GFP marrow transplant. The intensity of PCR product amplified for GFP gene in chimeric mice was comparable to that of SMA-GFP donor mice. Without receiving bone marrow transplants, no PCR products for the GFP gene were detected in the cells of wild-type mice. To estimate the efficiency of transplantation, the GFP transgene was quantified by real-time PCR. The transplantation efficiency (percent) based on the copy number of GFP transgene adjusted by a house-keeping GAPDH gene was 86.8 ¡À 11 (mean ¡À standard deviation, n = 6). This confirms that, at least, HSCs of SMA-GFP transgenic mice were successfully transplanted and the hematopoietic cells were largely replaced with cells carrying the SMA-GFP transgene.) i+ G# ?) p# ]- X

Figure 6. Detection of green fluorescent protein (GFP) transgene by polymerase chain reaction in whole bone marrow cells (A), hematopoietic stem cell-enriched Lin¨C Sca-1  c-kit  cells (B), and peripheral mononuclear cells (C) of smooth muscle type -actin (SMA)-GFP mice (lane 1), wild-type (Rag2¨C/¨C) mice that received bone marrow transplantation from SMA-GFP mice (lane 2), and wild-type (Rag2¨C/¨C) mice without transplantation (lane 3).

To further confirm the replacement of HSCs, we performed bone marrow transplantation using Tie2-GFP mice that express GFP under the control of a Tie-2 promoter. Because HSCs are known to express Tie-2 , Tie2-GFP  cells can be detectable in bone marrow of Tie2-GFP chimeric mice if HSCs are successfully transplanted. In flow cytometric analysis (Fig. 7), Tie2-GFP mice displayed a small population of GFP  cells. This GFP  cell population was also clearly detectable in Tei2-GFP chimeric mice, confirming that HSCs are transplantable with the procedure used for SMA-GFP mice in this study.
8 n$ L9 n# p( T4 f9 b3 S" z
Figure 7. Flow cytometric analysis of bone marrow cells of Tie2¨Cgreen fluorescent protein (GFP) mouse (A), Rag2¨C/¨C mouse (B), and Rag2¨C/¨C mouse receiving bone marrow transplantation from Tie2-GFP mice (C). The numbers in graph indicate the percentages of GFP-positive cells.

SMA-GFP Chimeric Mice Generate Neither GFP  Bone Marrow Cells nor GFP  Stromal Cells  H" t# A3 Y0 K1 F
4 n* \. K; r5 ]% L' i% q! [- R7 f
Because reconstitution of hematopoiesis with stem cells carrying the SMA-GFP gene was confirmed, we examined whether SMAs expressing bone marrow cells and stromal cells were also reconstituted with the cells carrying the SMA-GFP transgene in SMA-GFP chimeric mice.

In flow cytometric analyses, SMA-GFP mice displayed a small population (0.02%¨C0.03%) of GFP  bone marrow cells whereas no GFP  cells were detected in wild-type mice. In SMA-GFP chimeric mice, however, there was no significant increase in the GFP  cell population (Fig. 8). This was true with 20 chimeric mice that successfully received the SMA-GFP bone marrow transplant. The bone marrow cells were also cultured in DMEM containing 10% FCS using six-well plates, and the GFP expression was examined under the fluorescent microscope continuously twice a week until cells reached 60%¨C80% confluence (approximately 106 cells per well). However, no single GFP  cell was detected at any time throughout cell culture (Fig. 9). This means that no single animal among 20 mice showed an increase in GFP  bone marrow cells and no single GFP  cell was detected among 2 x 107 stromal cells examined. This suggests that a progenitor for SMA-expressing (SMA-GFP ) cells is distinct from that for hematopoietic cells. It is also not transplantable.

Figure 8. Green fluorescent protein (GFP)-positive bone marrow cells of smooth muscle type -actin (SMA)-GFP mouse (A), Rag2¨C/¨C mouse (B), and Rag2¨C/¨C mouse received from bone marrow transplantation from SMA-GFP chimeric (Rag2¨C/¨C ) mouse (C) at 6 months after transplantation.+ Q9 n  P5 u* o9 G, {8 {

Figure 9. Phase contrast (left) and green fluorescent protein (GFP) images (right) of bone marrow stromal cells. Bone marrow cells isolated from smooth muscle type -actin (SMA)-GFP mice (A) and a wild-type (Rag2¨C/¨C ) mouse that received bone marrow transplantation from SMA-GFP mice (B) were cultured in Dulbecco¡¯s modified Eagle¡¯s medium containing 10% fetal calf serum for 2 weeks.

No GFP  Glomerular Mesangial Cells Were Generated in SMA-GFP Chimeric Mice1 S* X% S: W3 j6 v

A previous study using nonspecific GFP mice suggested that bone marrow HSCs can generate glomerular mesangial cells . If HSCs differentiate into SMA-expressing mesangial cells, GFP  cells should be detectable in glomeruli of SMA-GFP chimeric mice where hematopoiesis was reconstituted with HSCs carrying the SMA-GFP gene.0 ?9 c# ^, ~' ^( x  j- p
3 W/ p5 W2 r+ P* C* k! @" B, p
Unlike SMA-GFP donor mice, however, no GFP expression was detected in glomeruli of SMA-GFP marrow¨Crecipient mice. It is still possible that, since the expression levels of SMA in normal glomeruli in vivo are generally low, newly formed mesangial cells would not express detectable levels of GFP even though they carried the SMA-GFP gene. To more rigorously explore whether glomeruli contained mesangial cells with the SMA-GFP gene, the isolated glomeruli were digested with collagenase and cultured in DMEM media containing 10% FCS because mesangial cells highly express SMA in vitro  (Fig. 2). If HSCs differentiate into mesangial cells, GFP  cells should have been detectable among the cells grown from glomeruli even if GFP was undetectable in intact glomeruli. With the procedure described here, approximately 10,000 glomeruli were generally recovered from one kidney. GFP expression was also routinely examined under fluorescent microscope until the cells reached near confluence (approximately 106 cells) in six-well plates. This means that nearly 4 x 105 isolated glomeruli and 4 x 107 cultured mesangial cells from 20 mice that successfully received SMA-GFP bone marrow transplants were examined. However, no GFP  cells were detected in either isolated glomeruli or cultured mesangial cells from SMA-GFP chimeric mice despite the fact that the same cells from SMA-GFP donor mice all displayed strong GFP signals (Fig. 10). These findings strongly suggest that the competence of marrow HSCs to generate SMA-expressing cells in the periphery is extremely low. The transdifferentiation of HSCs in vivo, if any, must be an extremely rare event.) v. _6 D5 e( I5 n

Figure 10. Phase-contrast (left) and green fluorescent protein (GFP) images (right) of glomerular mesangial cells isolated from smooth muscle¨Ctype -actin (SMA)-GFP mice (A) and wild-type (Rag2¨C/¨C) mouse that received a bone marrow transplant from SMA-GFP mice (B).

DISCUSSION" x0 X. }& c9 G7 }5 ~

Creating chimeric mice by bone marrow transplantation has been widely used to identify cells of marrow origin, but discrimination of donor-type cells is the key step in this approach. The present study uses a new transgenic SMA-GFP mouse that expresses GFP under control of the SMA promoter as a bone marrow donor to specifically identify donor-type SMA-expressing cells. Because GFP expression is limited to cells that express SMA, GFP  cells are detectable only when the cells from donor mice differentiate into SMA-expressing cells. The principal findings are as follows. First, murine bone marrow contains a small population of SMA-expressing cells, and SMA is present in cultured marrow stromal cells. Second, the progenitor for these SMA-expressing cells is distinct from HSCs and is not systemically transplantable. Third, the plasticity of HSCs is strictly limited, and HSCs unlikely differentiate into mesenchymal cells under physiological conditions.
+ J$ ~. X$ }$ q0 |% _
Bone marrow cells have been shown to differentiate into various mesenchymal cells, although the originating progenitors have not been well defined. Nonspecific GFP mice that express GFP under control of the chicken -actin promoter with a cytomegarovirus enhancer . Whether bone marrow contains a transplantable mesenchymal progenitor is still controversial. Our study clearly demonstrated that no SMA-expressing stromal cells expressed GFP in SMA-GFP chimeric mice even though hematopoiesis was successfully reconstituted with cells carrying a SMA-GFP transgene. This indicates that stem or progenitor cells for SMA-expressing cells and stem/progenitors (HSCs) for hematopoiesis are distinct and that stromal progenitors are not transplantable.

The plasticity of HSCs is another controversial issue  also reported that glomerular mesangial cells were generated from Lin¨C c-kit  Sca-1  CD34¨C cells from a bone marrow donor even without particular tissue injuries, suggesting that HSCs can contribute to physiological turnover of mesangial cells. Our data directly contradict those studies. In this study, the SMA-GFP transgene was clearly detectable in both Lin¨C c-kit  Sca-1  bone marrow cells and peripheral mononuclear cells of SMA-GFP chimeric mice. If HSCs were the source of SMA-expressing cells, some SMA-GFP  cells should have been detectable in either intact glomeruli or cultured mesangial cells. However, not even one GFP  cell was detected in many mice that successfully received SMA-GFP marrow transplants. This indicates that transdifferentiation of HSCs to nonhematopoietic cell types is unlikely to occur in vivo. This also indicates the importance of the use of specific mesenchymal markers for the study of mesenchymal stem/progenitors. The infiltration of inflammatory cells is inevitable in many cases and particularly in injured tissues. Even though "false positives" by cell fusion are carefully excluded, the identification of a small population of real GFP  cells is difficult if many GFP  inflammatory cells are present.5 ?' i% t/ F$ n9 w
' A! y; B6 A9 f1 b* f
The present study also demonstrated that bone marrow contains a small population of GFP  (SMA-expressing) cells and similar GFP  cells were also detectable in peripheral mononuclear cell preparations. These cells were negative for the endothelial cell markers Tie-2 and KDR. They were also different from vascular smooth muscle cells with respect to Mac-1 expression and the intensity of GFP signals. However, these cells are unlikely to be progenitors for SMA-expressing cells. At the very least, they are not the source of SMA-expressing stromal cells in bone marrow cell culture in vitro.
6 f2 T# L! l* W1 q9 g) X
The stromal stem/progenitor for SMA-expressing cells is clearly difficult to transplant. In this study, we used Rag2¨C/¨C mice as bone marrow recipients to enhance the engraftment of such bone marrow minor populations by combining immunodeficiency of Rag2¨C/¨C and lethal doses of irradiation. However, the progenitor for SMA-expressing cells was not transplantable. Whether the efficiency could be improved to transplant the stromal progenitor is an important question relevant to developing new tissue regeneration therapies. New strategies such as direct infusion into the bone cavity may be needed to effectively engraft such cells . SMA-GFP mice should provide an excellent tool for that type of investigation.

ACKNOWLEDGMENTS
$ i+ D! h+ i! m# d' s! c  p& t! l
T.Y. and Y.K. contributed equally to this study. Supported by NIH grant AI 20069 (to P.W.K.).  C+ q8 v$ c4 `! c

DISCLOSURES5 W  y, d1 l3 a$ h/ F8 h7 y' M3 m) p
. Z3 F- c( T% E' Y* Q6 u
The authors indicate no potential conflicts of interest.  B; o) g) F- c6 ~  v3 \6 b
      【参考文献】
+ z9 W0 \" o$ o# F8 i4 b/ w/ L
" g( Q- Q! [& s# {- B
Pittenger MF, Mackay AM, Beck SC et al. Multilineage potential of adult human mesenchymal stem cells. Science 1999;284:143¨C147.
6 }7 v" a& f. H( O, y
Fibbe WE. Mesenchymal stem cells. A potential source for skeletal repair. Ann Rheum Dis 2002;61(suppl 2):ii29¨Cii31.
  Z; X" \) e/ u4 i7 |5 o8 f6 B, v9 u# x8 B
Petersen BE, Bowen WC, Patrene KD et al. Bone marrow as a potential source of hepatic oval cells. Science 1999;284:1168¨C1170.
5 X1 u' |$ k$ d7 w9 r; z
Alison MR, Poulsom R, Jeffery R et al. Hepatocytes from non-hepatic adult stem cells. Nature 2000;406:257.

Lagasse E, Connors H, Al-Dhalimy M et al. Purified hematopoietic stem cells can differentiate into hepatocytes in vivo. Nat Med 2000;6:1229¨C1234.+ }6 @) H. R6 |2 a

Asahara T, Murohara T, Sullivan A et al. Isolation of putative progenitor endothelial cells for angiogenesis. Science 1997;275:964¨C967.
* |- I1 p# M$ V0 i9 v! H3 ]
Theise ND, Nimmakayalu M, Gardner R et al. Liver from bone marrow in humans. Hepatology 2000;32:11¨C16.
* _! g: W& f9 V7 N9 ]
Makino S, Fukuda K, Miyoshi S et al. Cardiomyocytes can be generated from marrow stromal cells in vitro. J Clin Invest 1999;103:697¨C705.
. Z. X3 p* f( X  t
Eglitis MA, Mezey E. Hematopoietic cells differentiate into both microglia and macroglia in the brains of adult mice. Proc Natl Acad Sci U S A 1997;94:4080¨C4085.
& N' U& B8 w, f
Ferrari G, Cusella-De Angelis G, Coletta M et al. Muscle regeneration by bone marrow-derived myogenic progenitors. Science 1998;279:1528¨C1530.2 ~) \2 r- _% b3 ?2 q1 v+ ^1 q% v9 e

Gussoni E, Soneoka Y, Strickland CD et al. Dystrophin expression in the mdx mouse restored by stem cell transplantation. Nature 1999;401:390¨C394.
; x: {9 M, @! E0 W0 ^
Sata M, Saiura A, Kunisato A et al. Hematopoietic stem cells differentiate into vascular cells that participate in the pathogenesis of atherosclerosis. Nat Med 2002;8:403¨C409.( N# A; i7 ]9 Z$ P9 e
: _( q& F5 b+ x2 O+ ~/ J" k
Masuya M, Drake CJ, Fleming PA et al. Hematopoietic origin of glomerular mesangial cells. Blood 2003;101:2215¨C2218.
' T8 C. I' e# T- c' Q9 |. D- {
Wagers AJ, Sherwood RI, Christensen JL et al. Little evidence for developmental plasticity of adult hematopoietic stem cells. Science 2002; 297:2256¨C2259.

Chien KR. Stem cells: lost in translation. Nature 2004;428:607¨C608.

Murry CE, Soonpaa MH, Reinecke H et al. Haematopoietic stem cells do not transdifferentiate into cardiac myocytes in myocardial infarcts. Nature 2004;428:664¨C668.& ~3 k# l5 X/ L

Balsam LB, Wagers AJ, Christensen JL et al. Haematopoietic stem cells adopt mature haematopoietic fates in ischaemic myocardium. Nature 2004;428:668¨C673.

Camargo FD, Finegold M, Goodell MA. Hematopoietic myelomonocytic cells are the major source of hepatocyte fusion partners. J Clin Invest 2004;113:1266¨C1270./ H( [1 X( Z0 U9 z! o! A, M( ?
$ T4 ~5 Q; b4 p' e
Nygren JM, Jovinge S, Breitbach M et al. Bone marrow-derived hematopoietic cells generate cardiomyocytes at a low frequency through cell fusion, but not transdifferentiation. Nat Med 2004;10:494¨C501.6 k6 f& n% g% n& {! {& F' U( h0 t
  V' i# x2 \5 a+ T! d
Camargo FD, Chambers SM, Goodell MA. Stem cell plasticity: from transdifferentiation to macrophage fusion. Cell Prolif 2004;37:55¨C65./ I! M1 k; r, M

Vignery A. Osteoclasts and giant cells: macrophage-macrophage fusion mechanism. Int J Exp Pathol 2000;81:291¨C304.' L' z; q( G: U" U
) c3 o/ ?) @1 T/ R
Willenbring H, Bailey AS, Foster M et al. Myelomonocytic cells are sufficient for therapeutic cell fusion in liver. Nat Med 2004;10:744¨C748.0 T) O' j9 k" [8 z9 `' X( b, K1 I

Pereira RF, O¡¯Hara MD, Laptev AV et al. Marrow stromal cells as a source of progenitor cells for nonhematopoietic tissues in transgenic mice with a phenotype of osteogenesis imperfecta. Proc Natl Acad Sci U S A 1998;95:1142¨C1147.

Simmons PJ, Przepiorka D, Thomas ED et al. Host origin of marrow stromal cells following allogeneic bone marrow transplantation. Nature 1987;328:429¨C432.  r/ x" d2 U/ `6 D
5 l) I) l) D  l1 D2 T! g) {
Bianco P, Gehron Robey P. Marrow stromal stem cells. J Clin Invest 2000;105:1663¨C1668.- W* r6 O" u  g5 r; v% T& D: |7 t: ?/ p
% h0 R' ]8 U" p  d7 B; P
Wang J, Niu W, Nikiforov Y et al. Targeted overexpression of IGF-I evokes distinct patterns of organ remodeling in smooth muscle cell tissue beds of transgenic mice. J Clin Invest 1997;100:1425¨C1439.
0 G( _( r9 k3 v, W. x
Tsai J-Y, Yu Z-X, Wawrousek EF et al. Generation and characterization of SMAA-GFP mice. Invest Ophthalmol Vis Sci 2001;42:2734.0 N9 v, z' N9 z* l7 A9 h; k
9 Z6 L& e7 b) l) ~) ~* z+ A7 j
Tsai J-Y, Yamamoto T, Fariss RN et al. Using SMAA-GFP mice to study pericyte coverage of retinal vessels. Invest Ophthalmol Vis Sci 2002;43: E-abstract 1929.# \3 p) R; j" o' u% q+ e1 @
8 \2 W  p. n1 d$ }7 Z$ S
Motoike T, Loughna S, Perens E et al. Universal GFP reporter for the study of vascular development. Genesis 2000;28:75¨C81.- O: M8 z, b1 R
2 X/ {* T/ D5 F0 {" Z5 s
Pittler SJ, Baehr W. Identification of a nonsense mutation in the rod photoreceptor cGMP phosphodiesterase beta-subunit gene of the rd mouse. Proc Natl Acad Sci U S A 1991;88:8322¨C8326.8 b- B2 {9 {* d7 F$ F9 o3 m

Gimenez E, Montoliu L. A simple polymerase chain reaction assay for genotyping the retinal degeneration mutation (Pdeb(rd1)) in FVB/N-derived transgenic mice. Lab Anim 2001;35:153¨C156.9 |6 _( [* F& o3 U) e0 U
3 [) g) c" I! F- g3 K5 S
Shinkai Y, Rathbun G, Lam KP et al. RAG-2-deficient mice lack mature lymphocytes owing to inability to initiate V(D)J rearrangement. Cell 1992;68:855¨C867.
* T/ Q: G$ C* d, _: Y' R  @
Imasawa T, Utsunomiya Y, Kawamura T et al. The potential of bone marrow-derived cells to differentiate to glomerular mesangial cells. J Am Soc Nephrol 2001;12:1401¨C1409.8 C! L4 T: K0 Z! p1 A
5 c8 Z, }- Y" V& t
Sato S, Secchi EF, Lizak MJ et al. Polyol formation and NADPH-dependent reductases in dog retinal capillary pericytes and endothelial cells. Invest Ophthalmol Vis Sci 1999;40:697¨C704.6 {  l2 s! y1 ~6 q' [5 D' W

Elger M, Drenckhahn D, Nobiling R et al. Cultured rat mesangial cells contain smooth muscle alpha-actin not found in vivo. Am J Pathol 1993;142:497¨C509.

Yokota T, Kouro T, Hirose J et al. Unique properties of fetal lymphoid progenitors identified according to RAG1 gene expression. Immunity 2003;19:365¨C375.
$ [& i# c+ U4 r/ p/ h
Tomasek JJ, Gabbiani G, Hinz B et al. Myofibroblasts and mechano-regulation of connective tissue remodelling. Nat Rev Mol Cell Biol 2002;3:349¨C363.  f2 p0 s* ^% }9 m# x
' d8 @: y  K' W/ x5 }4 O" |$ P, c
Peled A, Zipori D, Abramsky O et al. Expression of alpha-smooth muscle actin in murine bone marrow stromal cells. Blood 1991;78:304¨C309.

Galmiche MC, Koteliansky VE, Briere J et al. Stromal cells from human long-term marrow cultures are mesenchymal cells that differentiate following a vascular smooth muscle differentiation pathway. Blood 1993; 82:66¨C76.
0 q# I0 l8 r9 X1 g1 H
Cai D, Marty-Roix R, Hsu HP et al. Lapine and canine bone marrow stromal cells contain smooth muscle actin and contract a collagen-glycosaminoglycan matrix. Tissue Eng 2001;7:829¨C841." I- O5 L) E0 u, N. P; b
2 g. o4 F7 _4 V5 S, l
Kashiwakura Y, Katoh Y, Tamayose K et al. Isolation of bone marrow stromal cell-derived smooth muscle cells by a human SM22alpha promoter: in vitro differentiation of putative smooth muscle progenitor cells of bone marrow. Circulation 2003;107:2078¨C2081.9 g9 o1 G3 `& }
2 Y8 L5 p6 l: k# r( M
Sakurai S, Alam S, Pagan-Mercado G et al. Retinal capillary pericyte proliferation and c-Fos mRNA induction by prostaglandin D2 through the cAMP response element. Invest Ophthalmol Vis Sci 2002;43:2774¨C2781.

Shaw JP, Basch R, Shamamian P. Hematopoietic stem cells and endothelial cell precursors express Tie-2, CD31 and CD45. Blood Cells Mol Dis 2004;32:168¨C175.' J2 D2 h3 N/ l9 r
& R6 N! T8 J. R
Arai F, Hirao A, Ohmura M et al. Tie2/angiopoietin-1 signaling regulates hematopoietic stem cell quiescence in the bone marrow niche. Cell 2004;118:149¨C161.

Okabe M, Ikawa M, Kominami K et al. "Green mice" as a source of ubiquitous green cells. FEBS Lett 1997;407:313¨C319.

Espinosa-Heidmann DG, Caicedo A, Hernandez EP et al. Bone marrow-derived progenitor cells contribute to experimental choroidal neovascularization. Invest Ophthalmol Vis Sci 2003;44:4914¨C4919.

Ito T, Suzuki A, Imai E et al. Bone marrow is a reservoir of repopulating mesangial cells during glomerular remodeling. J Am Soc Nephrol 2001; 12:2625¨C2635.6 i: s! Y/ _7 f2 J* H
) k4 z3 [3 P* G/ Q4 ^0 S
Imai E, Ito T. Can bone marrow differentiate into renal cells? Pediatr Nephrol 2002;17:790¨C794.- Z+ M$ L& M+ @. ]' n7 ]! x

Gronthos S, Zannettino AC, Hay SJ et al. Molecular and cellular characterisation of highly purified stromal stem cells derived from human bone marrow. J Cell Sci 2003;116:1827¨C1835.
  G! X: x+ y# e+ I7 D" T
Hirschi KK, Majesky MW. Smooth muscle stem cells. Anat Rec 2004; 276A:22¨C33.1 A" |8 X* P' N# S5 a  @0 g

Kushida T, Inaba M, Hisha H et al. Intra-bone marrow injection of allogeneic bone marrow cells: a powerful new strategy for treatment of intractable autoimmune diseases in MRL/lpr mice. Blood 2001;97:3292¨C3299.
8 W& c8 k& |9 D$ E5 d" l. e
Wang J, Kimura T, Asada R et al. SCID-repopulating cell activity of human cord blood-derived CD34-cells assured by intra-bone marrow injection. Blood 2003;101:2924¨C2931.

Burt RK, Verda L, Kim DA et al. Embryonic stem cells as an alternate marrow donor source: engraftment without graft-versus-host disease. J Exp Med 2004;199:895¨C904.

收藏0 分享0 顶0 踩0