Prevention of Graft-Versus-Host Disease by Intra-Bone Marrow Injection of Donor - 《stemcells》干细胞学杂志干细胞之家



免疫细胞治疗专区	欢迎关注干细胞微信公众号

12 3 4 5 6 7 8 9 10 ... 24 下一页

返回列表

查看: 532328\|回复: 234	go Prevention of Graft-Versus-Host Disease by Intra-Bone Marrow Injection of Donor [复制链接]

江边孤钓

版主

Rank: 7 Rank: 7 Rank: 7

积分: 0
威望: 0
包包: 483

楼主

发表于 2009-3-5 00:54 |只看该作者 |倒序浏览 |打印

作者：Junichi Fukuia,b, Muneo Inabaa,c, Yusuke Uedaa,d, Takashi Miyakea,b, Naoki Hosakaa,c, A-Hon Kwonb, Yutaku Sakaguchia,e, Masanobu Tsudaa,f, Mariko Omaea,g, Yasuo Kamiyamab, Susumu Ikeharaa,c

   % p  t; l. C$ _) P



         ' c, r8 y; ~* W) Y$ \6 n0 r9 \1 P
         * o/ Q1 O: x+ o; ^" S; ]
         ! n7 i% H4 d7 x  z; U& {( m
                  8 k* e2 s# f9 a) N; n
      ; l( N+ O; u- Y& E4 S* a

      + t$ N7 b# h5 l% G5 v3 D
      【摘要】
   We have recently found that intra-bone marrow-bone marrow transplantation (IBM-BMT) can be used to prevent graft-versus-host disease (GvHD), even when intensive donor lymphocyte infusion (DLI) is carried out. In the present study, in conjunction with IBM-BMT, allogeneic splenic T cells as DLI were also injected into the bone marrow cavity of lethally irradiated (8.5 Gy) recipients. The extent of GvHD was compared with that of recipients that had received allogeneic IBM-BMT plus i.v. injection of allogeneic T cells (intravenous DLI ). GvHD in recipients treated with allogeneic IBM-BMT plus IBM-DLI was far milder than in those treated with allogeneic IBM-BMT plus IV-DLI. This was confirmed macroscopically and histopathologically. The frequency of regulatory T cells (Tregs) detected as CD4 CD25  and CD4 Foxp3  cells was significantly higher in recipients treated with IBM-BMT plus IBM-DLI than in those treated with IBM-BMT plus IV-DLI. Donor-derived helper T (Th) cells polarized to Th2 type in recipients treated with IBM-BMT plus IBM-DLI, whereas Th1 cells were dominant in recipients treated with IBM-BMT plus IV-DLI. Furthermore, the production of transforming growth factor-¦Â and hepatocyte growth factor from bone marrow stromal cells was enhanced after IBM-DLI. Thus, IBM-BMT plus IBM-DLI seem to preferentially induce Tregs and Th2, resulting in the prevention of GvHD.

Disclosure of potential conflicts of interest is found at the end of this article. 8 M# @+ D* D$ ~
      【关键词】 Intra-bone marrow Bone marrow transplantation Donor lymphocyte infusion Graft-versus-host disease Bone marrow stromal cells Regulatory T cells Helper T/helper T polarization( Y) R, S' d1 A/ R3 b) B
   INTRODUCTION  ~4 q% X" |2 T( L; r5 I
- i. I- T" v' w) g
Bone marrow transplantation (BMT) is a powerful strategy for the treatment of congenital immunodeficiency, hematological disorders, and metabolic disorders . Therefore, the control or regulation of GvHR is a key element in the success of donor cell engraftment after BMT./ r" f/ G6 \* x  T' e

We have recently found that the injection of donor bone marrow cells (BMCs) directly into the bone marrow cavity (intra-bone marrow ) can survive >100 days after the treatment without showing GvHD. Furthermore, we show that BMSCs might be involved in the prevention of GvHD via the production of transforming growth factor-¦Â (TGF-¦Â) or hepatocyte growth factor (HGF).
7 U3 O: |- k# J
MATERIALS AND METHODS1 f0 K" \- q! K( R" ]

Mice  A4 T% Z* f/ l  Z
% N' w) U; n4 o! w5 Y& Z
C57BL/6 (B6, H-2b), BALB/c (H-2d), and green fluorescent protein (GFP) (B6 background, H-2b) mice were purchased from Japan SLC Inc. (Hamamatsu, Japan, http://www.jslc.co.jp). C57BL/6 mice at the age of 7¨C9 weeks were used as recipients, and BALB/c mice at the age of 7¨C9 weeks were used as donors.

Irradiation- @" V5 _& Y& S1 I! ~, P
- `+ l1 {8 Z2 `6 E
C57BL/6 mice were irradiated at 8.5 Gy (1.0 Gy/minute) from a 137Cs source (Gammacell 40 Exactor; MDS Nordion, Ottawa, http://www.mds.nordion.com) 1 day before the BMT.
8 e2 ^" o6 ^3 q+ ]2 N
BMT and Donor Lymphocyte Infusion7 B; Z7 Q) H# W2 H. p  J5 _4 R( I
# Z6 w3 m" `9 c0 o% B3 |
BMCs were flushed from the femoral and tibial bones of the BALB/c mice and then suspended in RPMI 1640. The BMCs were then filtered through a 70-mm nylon mesh (Becton, Dickinson and Company, Franklin Lakes, NJ, http://www.bd.com), washed, and adjusted to 1.5 x 109 cells per milliliter in RPMI 1640.
% Q, `7 }3 c+ _. H9 A+ K
The BMCs, thus prepared, were injected directly into the bone marrow cavity as described previously . Briefly, the region from the inguen to the knee joint was shaved, and a 5-mm incision was made on the thigh. The knee was flexed to 90 degrees, and the proximal side of the tibia was drawn to the anterior. A 26-gauge needle was inserted into the joint surface of the tibia through the patellar tendon and then inserted into the bone marrow cavity. Using a microsyringe (50 µl; Hamilton Co., Reno, NV, http://www.hamiltoncompany.com) containing the donor BMCs (1.5 x 109 cells per milliliter), the donor BMCs were injected from the bone holes into the bone marrow cavity of the left tibia (107 cells per 7 microliters per tibia). In some groups, BMCs were injected intravenously.
/ ?7 n* o( |2 J: z
T cells were purified from the spleens by positive selection by a magnetic cell sorting system using CD4 and CD8 microbeads (Miltenyi Biotec, Bergisch Gladbach, Germany, http://www.miltenyibiotec.com) after depletion of red blood cells (RBCs) or by an EPICS ALTRA flow cytometer (Beckman Coulter, Fullerton, CA, http://www.beckmancoulter.com) after staining with fluorescein isothiocyanate (FITC)- or phycoerythrin (PE)-conjugated anti-CD4/CD8 monoclonal antibodies (mAbs) (BD Pharmingen, San Diego, http://www.bdbiosciences.com/index_us.shtml). Non-T cells were obtained from the spleens using Dynabeads (Dynal Biotech, Oslo, Norway, http://www.invitrogen.com/dynal) after the treatment with anti-CD4/CD8 mAbs. Splenic T cells were injected into the bone marrow cavity of the right tibia (107 cells per 7 microliters per tibia: intra-bone marrow T-cell injection as DLI; IBM-DLI) or injected intravenously (IV-DLI; 107 cells per 0.5 milliliter) into the recipient mice along with the IBM-BMT. Non-T cells were also injected into the bone marrow cavity as a negative control.1 k% h1 K/ I1 @0 p  G' m
, Y% a5 a$ V' u5 v: B
In some experiments, to examine whether T cells injected into the bone marrow cavity (IBM-DLI) are trapped or die in the bone marrow cavity, BALB/c mice were irradiated, and BMCs from B6 donors were injected into the bone marrow cavity of the left tibia (IBM-BMT). Splenic T cells from GFP mice (B6 background) were injected into the right tibia (107 cells per 7 microliters per tibia: IBM-DLI) or injected intravenously (107 cells per 0.5 milliliter: IV-DLI) into the recipient mice along with the IBM-BMT. Three days after the injection, GFP  cells in the spleen of recipients were flow cytometrically analyzed.

Flow Cytometrical Analyses of Surface Marker Antigens and Intracellular Cytokines" C8 T# B. T6 P: t, E) x

Peripheral blood was collected from the tail vein and stained with FITC-conjugated anti-H-2Kb and PE-conjugated anti-H-2Kd Ab (BD Pharmingen) to differentiate between the donor- and recipient-derived cells after the lysis of RBCs by a BD Pharm Lyse (BD Pharmingen). Furthermore, spleen cells and BMCs were prepared from the recipient mice, and the cell surface phenotypes were analyzed by FITC- or PE-conjugated mAbs against CD45R, CD4, CD8, CD11b, and Gr-1. In some experiments, the cells were stained with anti-CD4 and anti-CD25 mAbs (BD Pharmingen) or anti-CD4 and anti-Foxp3 mAbs to detect regulatory T cells (Tregs). In the case of staining with anti-Foxp3 mAb, cells were stained with FITC-antiCD4 mAb and then fixed and permeabilized with Cytofix/Cytoperm solution (BD Pharmingen). The cells thus treated were intracytoplasmically stained with PE-anti-Foxp3 mAb (eBioscience Inc., San Diego, http://www.ebioscience.com). Furthermore, after staining the spleen cells with FITC-anti-CD4 mAb, intracellular cytokines (tumor necrosis factor -2, IL-4, IL-10) were detected using an Intracellular Cytokine Staining Kit (BD Pharmingen). The stained cells were analyzed by a FACScan (Becton, Dickinson).
! i0 g! L6 e$ z% [; B/ P, }
Preparation of BMSCs
  h7 H9 L9 N; f; ^( x
BMCs from the right tibia, into which T cells had been injected as DLI, were collected from the recipients 3 days after the treatment and cultured in Dulbecco's modified Eagle's medium with 10% fetal calf serum. Two days later, nonadherent cells were removed. Adherent cells were detached using trypsin-EDTA and passaged when 80% confluence was reached and then replated. After 2 weeks, the cultures were discontinued, and BMSCs were harvested and used for further experiments. The BMSCs, thus prepared, were negative for CD45 and CD34 but positive for CD90 and CD106 after staining with FITC- or PE-conjugated mABs. The culture-expanded BMSCs from the recipients of IBM-BMT IBM-DLI, IBM-BMT IV-DLI, or IBM-BMT alone (without DLI) were used for real-time reverse transcription-polymerase chain reaction (RT-PCR) assay.

Real-Time RT-PCR Assay

Cytokine messages of BMSCs were determined by real-time RT-PCR. We prepared two pairs of primers for TGF-¦Â (forward: TTTCGATTCAGCGCTCACTGCTCTTGTGAC, reverse: ATGTTGGACAACTGCTCCACCTTGGGCTTGC) and HGF (forward: AAGAGTGGCATCAAGTGCCAG, reverse: CTGGATTGCTTGTGAAACACC) (Nisshinbo, Tokyo, http://www.nisshinbo.co.jp/english). Real-time RT-PCR was conducted on a DNA Engine Opticon 2 system (MJ Japan Ltd., Tokyo, http://www.labtrade.com/mjr) by using SYBR Green I as a double-stranded DNA-specific binding dye and continuous fluorescence monitoring. The cycling conditions consisted of a denaturation step for 10 minutes at 95¡ãC, 40 cycles of denaturation (94¡ãC for 15 seconds), annealing (60¡ãC for 30 seconds), and extension (72¡ãC for 30 seconds). After amplification, melting curve analysis was performed with denaturation at 95¡ãC then continuous fluorescence measurement from 65¡ãC to 95¡ãC at 0.1¡ãC/second. All reactions were run in duplicate, at least, and included control wells without cDNA.
9 n( I% t. q& I: q9 E" v& z
Assessment of GvHD
- J) \9 H* q2 `4 f* |4 i
To examine GvHD, the body weight of the recipients was measured every other day, and the recipients were also assessed once per week on the clinical findings listed in Table 1. Furthermore, to histopathologically determine GvHD, the liver, spleen, intestine, and skin were removed and fixed in 10% formalin and embedded in paraffin according to standard procedures. Sections were stained with hematoxylin and eosin or Masson-trichrome and examined by the pathologist (N.H.). Scorings of the histopathological changes in the liver and spleen are according to the pathological findings listed in Table 2.! x2 B9 W7 n$ E% w: }

Table 1. Assessment of clinical graft-versus-host disease (GvHD) in transplanted animals

Table 2. Histopathological scoring of graft-versus-host disease (GvHD)* S( r  q- I$ v  M5 j

Statistical Analyses2 @/ j2 d0 B! T/ [
% {7 O3 p* @' P, x
Statistical analyses were performed using Student's t test and log-rank (Mantel-Cox) test.
$ b, N& v' W) K
RESULTS
3 P! n3 B4 A# C: I7 f
Survival Rates and Body Weight of Mice Treated with Various Conditioning Regimens
) d: F$ Q, \5 e, a
As shown in Figure 1, 8.5 Gy-irradiated mice treated with IBM-BMT alone showed a 100% survival rate, although mice treated with IBM-BMT IV-DLI died of acute GvHD by 78 days after the treatment. Surprisingly, mice treated with IV-BMT IBM-DLI showed a 100% survival rate until 100 days after the treatment (Fig. 1A). Furthermore, decreases in body weight due to GvHD were observed in mice treated with IBM-BMT IV-DLI; after day 20, the body weight of thus-treated recipients gradually decreased (Fig. 1B). In contrast, in mice treated with IBM-BMT IBM-DLI, body weight gradually increased and reached the normal level on day 14. It should be noted that decreases in the body weight (due to GvHD) of mice treated with IV-BMT IBM-DLI were not as striking as in mice treated with IV-BMT IV-DLI. When non-T-cells were injected into the bone marrow cavity with IBM-BMT (data not shown), the recipients showed a 100% survival rate until 100 days, as observed in control recipients treated with IBM-BMT or IV-BMT alone.* Y( ^  Z% X9 u

Figure 1. Survival rates and changes in body weight of recipients treated with IBM-BMT IBM-DLI. (A): B6 mice were irradiated with 8.5 Gy 1 day before BMT. Bone marrow cells (BMCs) (1 x 107) from BALB/c mice were injected into the bone cavity (IBM-BMT alone; ) or intravenously (IV-BMT alone; ). The recipients were further injected with splenic T cells (1 x 107) from BALB/c mice to induce graft-versus-host disease via the bone cavity (IBM-BMT IBM-DLI; ) or the tail vein (IBM-BMT IV-DLI; ). The recipients that had been intravenously injected with BMCs were further prepared, and splenic T cells were injected via the bone cavity (IV-BMT IBM-DLI; ) or the tail vein (IV-BMT IV-DLI; ). Statistical analyses were carried out by the log-rank (Mantel-Cox) test (*, p
5 t1 {: G# z+ y" j) a
Macroscopical and Microscopical Findings of GvHD

GvHD was assessed by not only the loss of body weight but also macroscopical (items examined are included in Table 1) and histopathologic findings (scoring of histologic changes as indices of tissue injury; items examined are listed in Table 2). As shown in Figure 2, the clinical GvHD score of recipients treated with IBM-BMT IV-DLI was significantly higher (4.8 ¡À 2.05) than that of recipients treated with IBM-BMT IBM-DLI or IBM-BMT alone (no clinical signs of GvHD) on day 35.

Figure 2. Macroscopical findings after induction of GvHD. Items listed in Table 1 were macroscopically examined once per week in the recipients treated with IBM-BMT IBM-DLI or IV-DLI, and GvHD was determined using clinical GvHD scores. The representative results at 35 days (all the mice used in the experiments were alive at 35 days, and thereafter some recipients died by GvHD) are shown in this figure. Columns and bars in the figure represent the mean ¡À SD of five mice. The results are representative of two replicate experiments. Abbreviations: BMT, bone marrow transplantation; DLI, donor lymphocyte infusion; GvHD, graft-versus-host disease; IBM, intra-bone marrow; IV, intravenous.

Tissue injury scores (listed in Table 2) were next examined. As shown in Figure 3, although the infiltration of lymphocytes in the Glisson's sheath and the destruction or dysplasia of bile duct epithelia were observed both in recipients treated with IBM-BMT IBM-DLI or IBM-BMT IV-DLI (Fig. 3A, 3B), the tissue injury observed in the latter (Fig. 3B) was more severe than that in the former (Fig. 3A). The atrophy of the white pulp and the appearance of epithelioid cells were clearly observed in recipients treated with IBM-BMT IV-DLI (Fig. 3H) when compared with that in recipients treated with IBM-BMT IBM-DLI (Fig. 3G). It should be noted that no tissue injury was observed in the recipients treated with IBM-BMT alone, as shown in Figure 3C, 3F, and 3I. The appearance of single cell necrosis in the skin and intestine, or the appearance of crypt dropout in the intestine, were not observed in any of the recipient mice. Tissue injury scores are summarized in Figure 3J and 3K; as seen in the clinical GvHD scores, the tissue injury scores of the liver (Fig. 3J) and spleen (Fig. 3K) were significantly higher in recipients treated with IBM-BMT IV-DLI at 14 and 21 days than in recipients treated with IBM-BMT IBM-DLI. It is noted that recipients treated with IBM-BMT alone or those with IBM-BMT plus IBM injection of non-T-cells showed no signs of GvHD when macroscopically and histopathologically examined (data not shown). No significant pathological changes were observed in the intestine or skin of the recipients.

Figure 3. Histopathological findings and tissue injury scores of recipient mice after induction of graft-versus-host disease (GvHD). Items listed in Table 2 were microscopically examined at 7, 14, and 21 days in the recipients treated with IBM-BMT IBM-DLI or IV-DLI, and GvHD was determined using tissue injury scores. The figures represent findings at 21 days. (A¨CC): The specimens of liver were stained with HE. (D¨CF): Spleen specimens stained with HE. (G¨CI): Spleen specimens stained with MT. Original magnification x200 for all panels. (J, K): Tissue injury scores are summarized in (J) (liver) and (K) (spleen), and columns and bars in the figures represent the mean ¡À SD of five mice. Statistical analyses were carried out by Student's t test. (*, p
* \/ E$ _' ]) X& D/ J3 s  h% d
Mechanisms Underlying Prevention of GvHD by IBM-BMT IBM-DLI

Both the numbers and frequency of T cells detected in the periphery (spleen) of the recipients treated with IBM-BMT IBM-DLI were similar to those in the recipients treated with IBM-BMT IV-DLI examined using T cells from GFP mice as shown in supplemental online Table 1. This indicates that T cells injected into the bone marrow cavity survive and migrate to the periphery. Therefore, the cells injected into the bone marrow cavity (IBM-DLI) are not trapped or killed by "some artifacts" (like hematoma). Thus, the cells that contribute to the prevention or reduction of GvHD were next analyzed. It is noted that, after IBM-BMT IBM-DLI or IV-DLI, hematolymphoid cells in the recipients were completely reconstituted with those of donor origin when flow cytometrically analyzed after staining with mAbs against CD45R, CD4, CD8, CD11b, and Gr-1 plus anti-H-2d mAb (donor type H-2); >98% of CD4 and CD8 T cells showed donor type H-2d (data not shown). As shown in Figure 4, the frequency of Tregs, detected as CD4 Foxp3  cells, in the spleen of recipients treated with IBM-BMT IBM-DLI was significantly higher than that in the recipients treated with IBM-BMT IV-DLI at 7, 14, and 21 days after the treatment. Conversely, the frequency of CD4 Foxp3  cells in the recipients treated with IBM-BMT IV-DLI was significantly lower than in those treated with IBM-BMT alone (without DLI). Furthermore, the frequency of CD4 CD25  cells in the peripheral blood of the recipients treated with IBM-BMT IBM-DLI was also significantly higher than that in the recipients treated with IBM-BMT IV-DLI at 14 and 21 days after the treatment (data not shown).

Figure 4. Analysis of regulatory T cells. Recipient mice were treated with IBM-BMT IBM-DLI or IBM-BMT IV-DLI, and 7, 14, and 21 days after the treatment, spleen cells in recipient mice were stained with fluorescein isothiocyanate-anti-CD4 monoclonal antibody (mAb) and then fixed and permeabilized with Cytofix/Cytoperm solution. The spleen cells thus treated were intracytoplasmically stained with phycoerythrin-anti-Foxp3 mAb to measure CD4 Foxp3  cells. Columns and bars in the figures represent the mean % ¡À SD of 10 mice. Statistical analyses were carried out using the Student's t test. (*, p

Furthermore, the frequency of IL-4-producing (Fig. 5A) and also IL-10-producing cells (Fig. 5C) was significantly higher in recipients treated with IBM-BMT IBM-DLI than in those treated with IBM-BMT IV-DLI. Conversely, the percentage of IL-2-producing helper T (Th)1 cells was lower in recipients treated with IBM-BMT IBM-DLI than in those treated with IBM-BMT IV-DLI (Fig. 5B). In IFN-- and TNF--producing cells, no significant differences were observed in recipients treated with IBM-BMT IBM-DLI or IV-DLI (data not shown). Thus, the polarization of Th2 response is dominant in recipients treated with IBM-DLI, whereas the polarization of Th1 response is dominant in recipients treated with IV-DLI. An increase in the frequency of IL-10-producing cells in the recipients treated with IBM-BMT IBM-DLI indicates the inhibition of GvHD through the production of the immunosuppressive cytokine IL-10.' w& H6 n7 r4 {% N

Figure 5. Analysis of IL-2-, IL-4-, and IL-10-producing cells of recipient mice after IBM-BMT IBM-DLI. (A¨CC): Recipient mice were treated with IBM-BMT IBM-DLI or IV-DLI, and 7, 14, and 21 days after the treatment, spleen cells were removed and stained with fluorescein isothiocyanate-anti-CD4 monoclonal antibody (mAb). The cells were then intracytoplasmically stained with phycoerythrin-anti-IL-2, IL-4, or IL-10 mAbs to measure IL-2-, IL-4-, or IL-10-producing cells. Columns and bars in the figures represent the mean % ¡À SD of 10 mice. Statistical analyses were carried out using the Student's t test (*, p : d- e& O7 c% G' q; H. w: E
& D) i' f2 r! B
Involvement of BMSCs in Inhibition of GvHD! l4 h6 b: U9 x; t

It has been reported that BMSCs inhibit T-cell proliferation or activation through the production of soluble factors such as TGF-¦Â and HGF . Thus, we next measured the level of TGF-¦Â or HGF in BMSCs to examine, using quantitative real-time RT-PCR, whether the production of these immunosuppressive factors is enhanced after IBM-DLI. As shown in Figure 6A (HGF) and 6B (TGF-¦Â), the relative intensities of HGF and TGF-¦Â were significantly higher in the BMSCs from the recipients of IBM-BMT IBM-DLI than those from the recipients of IBM-BMT IV-DLI or IBM-BMT alone (without DLI). Therefore, T cells directly injected into the bone marrow cavity can induce the production of suppressive cytokines from BMSCs, and BMSCs might exert their inhibitory effect on T-cell activation or proliferation via HGF and/or TGF-¦Â.
) j! y6 q1 Y1 ]2 v
Figure 6. Analyses of cytokine messages. Total RNA extracted from the bone marrow stromal cells (originally from the right tibia, into which T cells had been injected as DLI) was collected from the recipients 3 days after the treatment. After DNase I treatment, cDNA was synthesized, amplified using HGF or TGF-¦Â primer, and visualized with SYBR Green by real-time reverse transcription-polymerase chain reaction. Relative intensity of HGF (A) or TGF-¦Â (B) mRNA was calculated on the basis of glyceraldehyde-3-phosphate dehydrogenase intensity. Data are shown as mean ¡À SD of four mice. Statistical analyses were carried out using the Student's t test (*, p ) p% A) _8 E4 g& H1 y, B

DISCUSSION, v; f9 {( e( ~$ s1 ]6 Q  E

Evidence has been accumulating that allogeneic BMT is an effective treatment not only for congenital immunodeficiency, metabolic disorders, and hematological disorders but also for autoimmune diseases . Furthermore, the potential side effects of the long-term use of immunosuppressants to reduce GvHD include the development of various infections and malignant tumors. Therefore, we have aimed to develop a new strategy for the successful engraftment of donor-derived hematolymphoid cells without developing GvHD even in the presence of T cells in the donor inoculum.

Recently, we have established a new method for BMT (IBM-BMT) that can induce persistent allogeneic donor-specific tolerance without using immunosuppressants . In line with this finding, we have examined whether GvHD could be alleviated if BMCs containing T cells were inoculated into the bone marrow cavity. In allogeneic BMT for human patients, BMCs are usually collected from the donor iliac bone by aspiration, and the bone marrow fluid thus contains a large number of T cells (>20%) because of the contamination with peripheral blood cells. Therefore, to investigate the advantage of IBM-BMT over IV-BMT, we compared the severity of GvHD induced by the i.v. injection of T cells (IV-DLI) with that induced by the IBM injection of T cells (IBM-DLI).

As shown in the present paper, acute GvHD was observed in recipients treated with IBM-BMT IV-DLI, whereas reduced GvHD was seen in those treated with IBM-BMT IBM-DLI, as evidenced from the survival rate, changes in body weight, and macro- and microscopic findings. T cells injected into the bone marrow cavity (IBM-DLI) do not become trapped and do not die in the bone marrow but appear to migrate to the periphery when examined using GFP  T cells (supplemental online Table 1). The mechanism(s) underlying these results cannot be fully explained, but the following two points are possibly related to our findings.& \9 t/ N+ K8 y9 N! K& W* F

The first point is the frequency of Tregs detected as CD4 CD25  and, more convincingly, as CD4 Foxp3  cells. As shown in Figure 4, the numbers of CD4 Foxp3  Tregs in the spleen of recipients treated with IBM-BMT IBM-DLI were significantly higher than those in recipients treated with IBM-BMT IV-DLI, and those in recipients treated with IBM-BMT IV-DLI were significantly lower than those treated with IBM-BMT IBM-DLI. The frequency of Tregs in the DLI population (splenic T cells) was approximately 10%. Therefore, Tregs might be maintained or might even have proliferated in the recipients treated with IBM-BMT IBM-DLI, whereas they were somehow depleted in the recipients treated with IBM-BMT IV-DLI. It should be noted that, at 14 and 21 days after the treatment, the frequency of Tregs in the bone marrow after the IBM-BMT IBM-DLI, IBM-BMT IV-DLI, or IBM-BMT alone was very low, and there was no significant difference among these three groups (data not shown). Therefore, Tregs might migrate out of the bone marrow to the peripheral lymphoid tissues and further proliferate there. Alternatively, Tregs might be newly developed from transplanted BMCs and proliferate in the peripheral lymphoid tissues of the recipients treated with IBM-BMT IBM-DLI. It has been reported that Tregs inhibit GvHD after BMT while preserving graft versus tumor activity .- O& i1 k8 S* n9 t' B3 U; c! f

The second point related to the reduced GvHD is a decrease in the number of IL-2-producing cells and an increase in the number of IL-4-producing and IL-10-producing cells in recipients treated with IBM-BMT IBM-DLI. It has been suggested that the Th1/Th2 polarization of T-helper-cell subsets plays an important role in the development of GvHD. In both mice and humans, there is a correlation between the production of cytokines related to the Th1 phenotype and the development of GvHD . Thus, kinetic changes in these "GvHD-potentiating cytokines" in recipients treated with IBM-DLI should be compared with those treated with IV-DLI.

The difference in the migratory patterns of IBM-DLI T cells and IV-DLI T cells is a possible explanation for the severity of GvHD. Although T cells injected intravenously (IV-DLI) can migrate to the lymphoid organs, IBM-DLI T cells can interact with BMSCs or mesenchymal stem cells (MSCs) in the bone marrow after the inoculation. It has very recently been reported that MSCs in the bone marrow induce T-cell unresponsiveness , could also control the severity of GvHD in the IBM-DLI recipients. Furthermore, it is important to consider the difference between IBM-DLI and IV-DLI recipients in the differentiation process from naïve T to Tregs or Th1/Th2 cells. Our findings suggest that naïve T cells can develop into Tregs, Tr, and Th2 in recipients treated with IBM-BMT IBM-DLI whereas, in recipients treated with IBM-BMT IV-DLI, naïve T cells preferentially differentiate into Th1 without the development of Tregs.
8 m# m9 z3 q  L$ p5 A+ j$ l" y- y
DISCLOSURES OF POTENTIAL CONFLICTS OF INTEREST

The authors indicate no potential conflicts of interest.+ v- }1 `0 ^1 W2 p( x& W
, N+ l; R8 G! L% V3 y
ACKNOWLEDGMENTS
5 x# ^1 S6 x& O* B
We thank Y. Tokuyama for expert technical assistance and Hilary Eastwick-Field and K. Ando for their help with preparation of the manuscript. This work was supported by a grant from the Haiteku Research Center of the Ministry of Education, a grant from the Millennium program of the Ministry of Education, Culture, Sports, Science and Technology, a grant from the Science Frontier program of the Ministry of Education, Culture, Sports, Science and Technology, a grant from the 21st Century Center of Excellence (COE) program of the Ministry of Education, Culture, Sports, Science and Technology, a Grant-in-Aid for scientific research (B) 11470062, Grants-in-Aid for scientific research on priority areas (A)10181225 and (A)11162221, and Health and Labour Sciences research grants (Research on Human Genome, Tissue Engineering Food Biotechnology). This work was also supported by a grant from the Department of Transplantation for Regeneration Therapy (sponsored by Otsuka Pharmaceutical Co., Ltd.), a grant from Molecular Medical Science Institute, Otsuka Pharmaceutical Co., Ltd., and a grant from Japan Immunoresearch Laboratories Co., Ltd. (JIMRO).
      【参考文献】" J$ o7 Y+ n) ?1 a
. m  t' \" v; S8 M2 g( Z" ]. |

Petersdorf EW, Mickelson EM, Anasetti C et al. Effect of HLA mismatches on the outcome of hematopoietic transplants. Curr Opin Immunol 1999;11:521¨C526.
' B8 \8 |# z0 ]: E; \. l
Horowitz MM, Gale RP, Sondel PM et al. Graft-versus-leukemia reactions after bone marrow transplantation. Blood 1990;75:555¨C562.

Slavin S. New strategies for bone marrow transplantation. Curr Opin Immunol 2000;12:542¨C551.
" f$ E. T% U% l% }* ~' V
van Besien KW, de Lima M, Giralt SA et al. Management of lymphoma recurrence after allogeneic transplantation: The relevance of graft-versus-lymphoma effect. Bone Marrow Transplant 1997;19:977¨C982./ {8 w) n! z7 i: M$ X! E1 M
4 s* r2 f/ n' p( A% L$ Y5 z
Verdonck LF, Lokhorst HM, Dekker AW et al. Graft-versus-myeloma effect in two cases. Lancet 1996;347:800¨C801.6 W8 E! U& j) `  \8 K- c
' w) c" Q' T0 t& Z
Kushida T, Inaba M, Hisha H et al. Intra-bone marrow injection of allogeneic bone marrow cells: A powerful new strategy for treatment of intractable autoimmune diseases in MRL/lpr mice. Blood 2001;97:3292¨C3299." O+ d' ^# S% q7 Q/ T9 _
( w" |3 \5 l$ z0 a8 G( i
Nakamura K, Inaba M, Sugiura K et al. Enhancement of allogeneic hematopoietic stem cell engraftment and prevention of GVHD by intra-bone marrow bone marrow transplantation plus donor lymphocyte infusion. STEM CELLS 2004;22:125¨C134.

Di Nicola M, Carlo-Stella C, Magni M et al. Human bone marrow stromal cells suppress T-lymphocyte proliferation induced by cellular or nonspecific mitogenic stimuli. Blood 2002;99:3838¨C3843.
! `" X. q" ?$ y5 X' m" w1 C
Thomas ED. Pros and cons of stem cell transplantation for autoimmune disease. J Rheumatol Suppl 1997;48:100¨C102.

Ikehara S, Good RA, Nakamura T et al. Rationale for bone marrow transplantation in the treatment of autoimmune diseases. Proc Natl Acad Sci U S A 1985;82:2483¨C2487.9 }+ d- h& ?+ N: W
$ S) W$ a: F! I
Jacobs P, Vincent MD, Martell RW. Prolonged remission of severe refractory rheumatoid arthritis following allogeneic bone marrow transplantation for drug-induced aplastic anaemia. Bone Marrow Transplant 1986;1:237¨C239./ O6 M/ u2 L/ h/ i7 j

Lowenthal RM, Cohen ML, Atkinson K et al. Apparent cure of rheumatoid arthritis by bone marrow transplantation. J Rheumatol 1993;20:137¨C140.4 L8 M) M3 D1 L1 d; }) k1 r

Marmont AM. Immune ablation followed by allogeneic or autologous bone marrow transplantation: A new treatment for severe autoimmune diseases? STEM CELLS 1994;12:125¨C135.
1 R5 f/ L0 I. N' h0 p
Nelson JL, Torrez R, Louie FM et al. Pre-existing autoimmune disease in patients with long-term survival after allogeneic bone marrow transplantation. J Rheumatol Suppl 1997;48:23¨C29.# `! w" t* @6 x# f8 d  ~0 }& R' g
/ K$ F; l3 O- P5 K. n
Nishimura M, Toki J, Sugiura K et al. Focal segmental glomerular sclerosis, a type of intractable chronic glomerulonephritis, is a stem cell disorder. J Exp Med 1994;179:1053¨C1058.

Oyaizu N, Yasumizu R, Miyama-Inaba M et al. (NZW x BXSB)F1 mouse. A new animal model of idiopathic thrombocytopenic purpura. J Exp Med 1988;167:2017¨C2022.

Snowden JA, Kearney P, Kearney A et al. Long-term outcome of autoimmune disease following allogeneic bone marrow transplantation. Arthritis Rheum 1998;41:453¨C459.# M! S# n0 |, `- M
/ o  w" n, d0 S. `0 o
Yin JA, Jowitt SN. Resolution of immune-mediated diseases following allogeneic bone marrow transplantation for leukaemia. Bone Marrow Transplant 1992;9:31¨C33.

Slavin S, Marmont A, Burt RK. Allogeneic hematopoietic stem cell transplantation for autoimmune diseases. In: Burt RK, Marmont AM, eds. Stem Cell Therapy for Autoimmune Disease.Georgetown, TX: Landes Bioscience,2004;474¨C478.
+ A- n2 F! s$ D9 a8 }
Sato K, Yamashita N, Yamashita N et al. Regulatory dendritic cells protect mice from murine acute graft-versus-host disease and leukemia relapse. Immunity 2003;18:367¨C379.! g' I% o  c# U1 q2 j; Y! w
1 p; E2 ?4 E8 C! m: F- H) m. Q
Schmaltz C, Alpdogan O, Kappel BJ et al. T cells require TRAIL for optimal graft-versus-tumor activity. Nat Med 2002;8:1433¨C1437.; n  L7 W3 \; ~
2 I' f5 ~  Y8 G2 w  u
Shlomchik WD, Couzens MS, Tang CB et al. Prevention of graft versus host disease by inactivation of host antigen-presenting cells. Science 1999;285:412¨C415.

Tsukada N, Kobata T, Aizawa Y et al. Graft-versus-leukemia effect and graft-versus-host disease can be differentiated by cytotoxic mechanisms in a murine model of allogeneic bone marrow transplantation. Blood 1999;93:2738¨C2747.
: j' g0 C6 X: R( f+ N
Snider D, Liang H. Early intestinal Th1 inflammation and mucosal T cell recruitment during acute graft-versus-host reaction. J Immunol 2001;166:5991¨C5999.

Ferrara JL, Levy R, Chao NJ. Pathophysiologic mechanisms of acute graft-vs-host disease. Biol Blood Marrow Transplant 1999;5:347¨C356.4 c' n/ ?. H' c3 D9 c6 E- l

Hill GR, Ferrara JL. The primacy of the gastrointestinal tract as a target organ of acute graft-versus-host disease: Rationale for the use of cytokine shields in allogeneic bone marrow transplantation. Blood 2000;95:2754¨C2759.  o/ R9 y5 [8 ]
2 @+ ]7 W2 m9 R7 q- o+ L) A
Burnett AK, Hann IM, Robertson AG et al. Prevention of graft-versus-host disease by ex vivo T cell depletion: Reduction in graft failure with augmented total body irradiation. Leukemia 1988;2:300¨C303.6 W8 \5 E. X; ^
+ L. |' A9 K% r+ q' O/ J
Hertenstein B, Hampl W, Bunjes D et al. In vivo/ex vivo T cell depletion for GVHD prophylaxis influences onset and course of active cytomegalovirus infection and disease after BMT. Bone Marrow Transplant 1995;15:387¨C393.

Voltarelli JC, Corpuz S, Martin PJ. In vitro comparison of two methods of T cell depletion associated with different rates of graft failure after allogeneic marrow transplantation. Bone Marrow Transplant 1990;6:419¨C423.( g: P- x. n" m0 D0 \; E

Edinger M, Hoffmann P, Ermann J et al. CD4 CD25  regulatory T cells preserve graft-versus-tumor activity while inhibiting graft-versus-host disease after bone marrow transplantation. Nat Med 2003;9:1144¨C1150., }) a& `! J+ \5 m+ v" b! C1 \
) L" r1 W6 O* }
Hoffmann P, Ermann J, Edinger M et al. Donor-type CD4( )CD25( ) regulatory T cells suppress lethal acute graft-versus-host disease after allogeneic bone marrow transplantation. J Exp Med 2002;196:389¨C399.

Cohen JL, Trenado A, Vasey D et al. CD4( )CD25( ) immunoregulatory T Cells: New therapeutics for graft-versus-host disease. J Exp Med 2002;196:401¨C406.7 b# t& z/ f) S1 @4 b. }
$ r$ n* c2 D! r& ]  Z% c
Blazar BR, Korngold R, Vallera DA. Recent advances in graft-versus-host disease (GVHD) prevention. Immunol Rev 1997;157:79¨C109.$ M2 |4 c" R9 W" K/ {' ]2 B
; ~: T* U3 Q: `+ j, b
Takabayashi M, Kanamori H, Takasaki H et al. A possible association between the presence of interleukin-4-secreting cells and a reduction in the risk of acute graft-versus-host disease. Exp Hematol 2005;33:251¨C257.
2 o6 B% s4 ]2 `( e2 t' U$ k
Krenger W, Cooke KR, Crawford JM et al. Transplantation of polarized type 2 donor T cells reduces mortality caused by experimental graft-versus-host disease. Transplantation 1996;62:1278¨C1285.  C' Z( `# ]; P* T6 u9 \2 S
1 n( p8 @0 n: M5 x* y
Thornton AM, Shevach EM. CD4 CD25  immunoregulatory T cells suppress polyclonal T cell activation in vitro by inhibiting interleukin 2 production. J Exp Med 1998;188:287¨C296.- G/ R3 b* u% `2 m# F' M) u  B/ I
7 i9 H9 ~' O- p4 B
Battaglia M, Gregori S, Bacchetta R et al. Tr1 cells: From discovery to their clinical application. Semin Immunol 2006;18:120¨C127.
% J- ^- B' i6 d
Blaser BW, Roychowdhury S, Kim DJ et al. Donor-derived IL-15 is critical for acute allogeneic graft-versus-host disease. Blood 2005;105:894¨C901./ `  d. J4 v9 o# h( r& u. r

Itoi H, Fujimori Y, Tsutsui H et al. Involvement of interleukin-18 in acute graft-versus-host disease in mice. Transplantation 2004;78:1245¨C1250.4 X( Y' i  D: ]+ Y0 M7 y- W

Aggarwal S, Pittenger MF. Human mesenchymal stem cells modulate allogeneic immune cell responses. Blood 2005;105:1815¨C1822.8 P& O3 B  j( c

Le Blanc K, Rasmusson I, Sundberg B et al. Treatment of severe acute graft-versus-host disease with third party haploidentical mesenchymal stem cells. Lancet 2004;363:1439¨C1441.
; ?5 Y& p4 z6 z* ~) w" `0 q# F
Ichioka N, Inaba M, Kushida T et al. Prevention of senile osteoporosis in SAMP6 mice by intrabone marrow injection of allogeneic bone marrow cells. STEM CELLS 2002;20:542¨C551.
% J7 T/ o0 ^) s4 L
Takada K, Inaba M, Ichioka N et al. Treatment of senile osteoporosis in SAMP6 mice by intra-bone marrow injection of allogeneic bone marrow cells. STEM CELLS 2006;24:399¨C405.1 f% o4 C* _6 B, h

Huber S, Schramm C, Lehr HA et al. TGF-beta signaling is required for the in vivo expansion and immunosuppressive capacity of regulatory CD4 CD25  T cells. J Immunol 2004;173:6526¨C6531.

Rutella S, Danese S, Leone G et al. Tolerogenic dendritic cells: Cytokine modulation comes of age. Blood 2006;108:1435¨C1440.

收藏0 分享0 顶0 踩0