|
 
- 积分
- 429
- 威望
- 429
- 包包
- 1768
|
本帖最后由 qianqianlaile 于 2011-3-22 22:26 编辑 : U+ k. c. [5 N' \* D# d; b% r
8 p8 ^" G5 l$ f( \, Q
MATERIALS AND METHODS 9 n/ L/ x# ?5 A0 K1 \- t+ t
Isolation of Dental-Derived Stem Cells (PDLSCs, SHEDs) / j: r' M7 f8 `2 q
PDLSCs and SHEDs were harvested as previously described (Miura et. al, 2003; Seo et. * w; i# K8 G. `5 d, c
al, 2004). Briefly, PDLSCs were scraped from the root surface of a tooth into a p60 dish
6 p5 I2 j( q% b1 Y- ycontaining minimum essential alpha medium (DMEM, Gibco) and SHEDs were harvested by
) v8 I/ O7 \ {( R+ e9 z+ Iscraping out the dental pulp tissue from a deciduous tooth into a p60 dish containing DMEM.3 I# v0 K7 T. D) U) z- F6 B
After collection, the cells were centrifuged at 1600 rpm for 5 minutes at room temperature. The * X9 d% a1 M6 r* D5 j
supernatant was aspirated and the cells were resuspended in a phosphate buffered saline (PBS; i6 C( m9 O6 u0 W% M* e
Gibco #14190) solution with 4 mg/ml Dispase II (Roche #04 942 078 001) and 2 mg/ml
+ e% r& U2 C' ~# l+ z) TCollagenase Type II (Worthington # LS004196) and incubated at 37°C for 60 minutes. The 7 Z, I$ }+ Z4 k6 D6 F/ F7 K
enzyme solution was inactivated with 5 ml of DMEM- 15% FBS- 100µM ascorbic acid 2
1 J6 e$ I# z$ k7 A7 E& {! Vphosphate (ASAP, Sigma A-8960) and centrifuged at 1600 rpm for 5 minutes at room8 T" e/ D+ o$ j# s( l6 p+ X$ E7 I
temperature. Cells were resuspeneded in 5 ml DMEM- 15% FBS- 0.1mM ASAP and transferred 5 Q t$ t( f/ A8 {" `" l% X2 P
to T-25 flasks. Media was changed the next day and then every 2-3 days.
1 B" K$ G9 {) e9 @' `Cell Culture; L' S( U2 p* \' f. d2 U
Cells were expanded in culture in DMEM, Iscove’s modified Dulbecco’s media (IMDM,
2 m& H9 {* l! z. K0 |8 G$ F) lGibco-Invitrogen #12571), Gibco Stem Pro Mesenchymal Stem Cell Serum-Free Media 1 I; i" [ v+ k% H# X2 H3 E
(MSCSFM; Invitrogen# A1033401) or Lonza Therapeak Mesenchymal Stem Cell Growth
( X* v! j0 o" y, z( wMedia- Chemically Defined (MSCGM-CD; Lonza #00190632) and grown in a 37°C humidified5 H% K8 B |9 c: T. n
tissue culture incubator at 5% CO2. Media formulations are as follows: DMem (Gibco-
" s% P& P% x7 |6 @* _Invitrogen #12571) with 15% FBS (Gibco-Invitrogen-16000), 100µM ASAP and 5 µg/ml) Z% @- b: F* L& _
Gentamicin (Invitrogen # 15750060) (FBS-M); DMem with 2% bovine serum albumin (BSA; 5 o# x$ w/ i& v$ [ h
Sigma A7888), 10ug/ml human insulin (Sigma), 4ug/ml low density lipoprotein, 200ug/ml
/ z: Q! ~, s7 X# |5 A# V: Q; R }transferrin, 10 nM dexamethasone, 100 uM ASAP, 50 uM ȕ-mercaptoethanol, 5 ug/ml
8 {+ H( y# o1 F+ ]3 ?# A8 dgentamicin, 10ng/ml platelet-derived growth factor (PDGF; Sigma), 10ng/ml epidermal growth
4 n: }% n) e: E' j3 jfactor (EGF; R&D Systems), 10ng/ml basic fibroblast growth factor (b-FGF, Sigma) (SDM);9 U& n0 r! y W" v
IMDM with 0.2% BSA, SITE 3 (Sigma #S5295), 384µM ASAP, 10 ng/ml PDGF, 10ng/ml
- N( R( v9 ~, p2 z- chydrocortisone 5ng/ml b-FGF, 1 ng/ml EGF, 10-7( J1 v7 Y+ G( S% p
mgm/ml parathyroid hormone (PTH) and 5
* b& p. ?( a; U2 V3 p* eµg/ml gentamicin (K-M). Media on the cells were changed every 2 or 3 days. Cells were grown
2 m, E9 j+ ?5 C. [* m8 ^+ `- m! bin T-150 flasks to about 80% confluency then media was aspirated from the flasks, cells were p; L) U0 j' d4 U5 Q
washed with PBS and trypsinized with TrypLE Express (Gibco#12605) before being split into 123 H+ T+ H0 U2 t4 g5 G) S8 S
well plates for the assays.
' B; `/ h9 R: a8 w t" FFibronectin Coating of Tissue Culture Plates2 @/ u6 w1 B' r- Z [9 u
Fibronectin (FN) was coated on the plates and flasks to provide growth and attachment
' Z( j( a7 s2 ]- C/ O/ M) ^support for cells grown in the serum-free, IMDM media. For the 12 well plates, 0.1% FN % A( O% `. w) V1 `6 ~2 `
solution (Sigma F-1141) was diluted in PBS so that each well received 3.8 micrograms per well , x/ q! v) f& M
(1µg FN/cm2). The T-150 flasks were coated so that each received 150 micrograms of FN (1µg : X5 D) U F: q2 U6 ?" N+ T- h2 d
FN /cm2). The plates and flasks were tilted back and forth to ensure complete coverage of the ' G! Q$ a5 r% ~( X
FN solution. The FN coating was allowed to stand at room temperature for 90 minutes. The FN
9 m H5 \# O2 s/ V. Ysolution was then aspirated before the resuspended cells were transferred to the flasks and plates.
9 x# F& ?# j- W8 @9 N* {Proliferation Assays
9 g( k) r4 y" L$ u) AAfter trypsinization cells were resuspended in an equal amount of the appropriate media) l" L# k, h6 }
before an aliquot was removed for counting on a hemocytometer to determine the concentration.! i! f1 q6 k! |( _; c
The cells were then centrifuged at ~1600 rpm for 5 minutes at room temperature. Cells were
2 u+ ]/ G: i3 e d3 I5 ~; hresuspended in the appropriate media at a concentration of 3800 cells per ml. One milliliter of 0 h: n1 r' X5 t/ o0 S
cells was dispensed into each well of a 12 well plate. K-M plates were precoated with FN / U* I; ^* x, v- A. u
solution (as outlined above). Four plates for each cell type and media condition were plated and 3 K3 T c, W( l0 C U$ C' D( @, q
counted on a hemocytometer at days 1, 3, 5 and 7 to determine the cell numbers within each e7 _8 I7 \& P6 x" v M4 A
well. All experiments were performed in triplicate. / ^: j1 u+ b& H0 |, K) D n
RNA Isolation and Purification for MicroArray
; T* J9 v0 E. }. n3 ~ CPDLSCs and SHEDs were grown in T-75 flasks to 80% confluency before the cells were % ^# G3 |) k+ V8 ^0 o
harvested for RNA. The Trizol method (Invitrogen) was used for RNA isolation. This involved
$ r+ f3 c/ l7 z" kwashing the cell layer with PBS, adding Trizol directly to the cells and transferring this cell
8 \$ Q4 h! H: n" F/ K Isuspension to polypropylene tubes. RNA was isolated from the cells by a Trizol-choloroform
% S# E% F2 B5 w& E* rextraction, isopropanol precipitation, an ethanol rinse and resuspension of theRNA pellet in 5 s9 Z. @' n% X
Diethylpyrocarbonate (DEPC) water. The RNA was further purified by column, ^9 n2 g+ ~. _% f8 J8 D. c+ u
chromatography, following manufacturer’s instructions (Qiagen RNeasy Kit # 74104), and
! h% L8 u, c. l- h3 bresuspended in DEPC water. RNA concentration was determined by the 260/280 absorbance + k- @( w+ U b( F. K" i
measurement using a Beckman DU540 spectrophotometer.7 V" d: u0 e' K: R* s
In Vitro Multilineage Differentiation ' R* y' a7 `; A5 X, V
Multipotency of PDLSCs and SHEDs was determined through lineage specific
+ `. i! Y2 Z! |, ]0 C9 ]$ i- Uosteogenic, chondrogenic, and adipogenic induction, according to previously described methods
0 m7 c* r6 T3 N( a* M- [2 i(Pittenger et. al, 1999). Briefly, cells were plated at a density of 30,000 cells per well in 12 well
- _6 G% w" b0 g U4 zplates. At 80% confluency cells were induced with osteogenic [Growth media plus 5mM E-
6 r* e3 w+ [" p/ Y9 }1 m# zglycerophosphate, 100nM dexamethasone, 50µM ascorbic acid 2-phosphate] or chondrogenic & i- ^. h' [$ J% L7 q3 R
[growth media plus 50µM ascorbic acid 2-phosphate, 100nM dexamethasone, 5 µg/ml human
" d$ t+ n( o F" J z/ ?insulin (Sigma I-9278), 1 ng/ml TGFE, 400µM proline, 1X Non essential amino acids] or $ R% {/ J! h7 l; c6 P
adipogenic [growth media plus 0.5mM IBMX, 1 µM dexamethasone, 10 µg/ml human insulin, ' j4 x4 z4 ^% d; H L! F3 s
200µM indomethacin] induction media. Cells were grown at 37°C in a humidified 5% CO2
- x8 e/ V* b; |5 Tincubator. The media was changed every 2-3 days. At three weeks the cells were fixed and
! E) E9 r, Q/ }) g. u' Rstained as outlined below.
7 o5 _4 b& K5 r8 J9 }7 W; jMultipotent Staining of PDLSCs and SHEDs ; w$ o# X, x8 L* D: h
To identify the mineralized nodules, induced PDLSC, SHED and DPSC were fixed in 4% ; ?. Y8 E' ^% C" ] i( R
paraformaldehyde for 30 minutes, immersed in fresh 5% silver nitrate and incubated in the dark # b( p1 }4 p* J( Q7 }
for 30 minutes. After washing in water the PDLSC, SHED and DPSC were exposed to
8 Y/ [( O g( V& [( q' x! @. pultraviolet light for 30 minutes followed by a four minute incubation in 1% sodium thiosulfate to
1 l" E" e( \+ s1 ? L+ xneutralize the silver nitrate. Cells were washed twice with water before 1 ml of PBS was added
0 j" e& F* n b. \) pto each well and viewed. Plates were stored at 4°C.
* Y5 [! s* s& O) q3 J' I% e( GTo detect chondrogenic differentiation induced PDLSC, SHED and DPSC were fixed in
t. L$ j: F- D& M* S4 X! Ucold 100% methanol for 30 minutes and then exposed to 1% alcian blue in 0.1N HCl for 30 * _0 U9 P& Q4 e" C. _" V; W& W/ j
minutes. Cells were washed twice with 0.1N HCl before 1 ml of PBS was added to each well
& h6 d7 i9 q- G* n6 Aand viewed. Plates were stored at 4°C.
6 W, m& t5 a; M) ATo detect adipogenic differentiation by identifying lipid vesicles, induced PDLSC, SHED
, G: s3 a" i# D3 W5 \* Y, ?( Fand DPSC were fixed in 4% paraformaldehyde for 30 minutes, and then immersed in 0.3% oil ) @/ d# ^* z9 s. m8 j5 A
red O solution for 30 minutes. Cells were washed twice with water before 1 ml of PBS was 4 M" M# S" k5 {+ G+ G; Y
added to each well and viewed. Plates were stored at 4°C. - O. s& z6 O$ K' N# z+ J0 i, c8 k
Alkaline Phosphatase Activity and Detection
0 l; |/ ^( g; J& p. [6 d+ vEarly osteogenic differentiation was detected and quantified by the alkaline phosphatase
% Q3 m- ? i; K! y7 h7 Y+ G(ALP) enzyme assay. Cells were plated at a density of 30,000 cells per well in 12 well plates.* E9 t3 ]5 L6 p- |- J2 B- }# M
At 80% confluence, cells were induced with osteogenic media as described above. The media# r. d) F9 m) w- ?% R
was changed every 2-3 days and after one week, ALP activity was measured.
' E I: \: Z- ^3 qTo detect phosphatase activity, PDLSCs and SHEDs were fixed in 70% ethanol for 30 $ Y$ W8 F# C% [+ @9 L" Y `' H
minutes. They were then incubated with freshly made substrate containing naphthol AS-TR
% ~4 i9 w0 M; Q. [! I/ j3 M- q* {- _phosphate (Sigma) and Fast blue (Sigma) for 30 minutes. Cells were washed twice with PBS then & ^: z" z6 w6 B. T2 |
viewed or stored at 4’C.5 y. n- x; ?. y0 F" V9 L( l
To quantify the ALP activity and normalize the results, cells were lysed in Passive Lysis + p2 ]8 b F( o* g
Buffer (Promega) according to manufacturer’s instructions. Cell lysates were then sonicated,
8 x2 c0 K. h( H- Tand centrifuged (10,000 rpm for 10 minutes at 4°C). The supernatant was recovered for the
; g* S4 x1 ~. K5 ~$ ^quantitative colormetric ALP assay (Manolagas et al., 1981) and the cell pellet was used for * i! q- Z1 y" K6 p6 Z+ B' I6 |
DNA isolation and the determination of the DNA concentration using the Quant-iT™ dsDNA ( n# X0 ]- E3 w4 ?0 _
BR Assay (Invitrogen) per the manufacturer’s instructions. # |8 z, M* C+ ~1 o6 ~
Reverse Transcriptase Polymerase Chain Reaction (RT-PCR) ) g. B! g2 @. b. U Q' o9 _
To confirm chondrogenic and adipogenic differentiation, total PDLSC and SHED cellular
! Y; E6 O$ S2 Z! h, t" x1 ZRNA was extracted, reverse transcribed, and amplified using osteoblast specific gene primers.; u& e1 k3 p: T% _+ w* O( V
Media from the wells of induced and uninduced PDLSCs and SHEDs were aspirated. Cells
4 z, {; C$ L& f0 h2 b! uwere immediately resuspended in 1 ml of Trizol (Invitrogen) and RNA was isolated according to - G0 [! |* a7 p7 F! Z" z6 v" L
the manufacturer’s instructions. Synthesis of cDNA was performed using Invitrogen’s " [- c- q I" I7 W
SuperScriptII kit and oligo dT. PCR reaction components and concentrations were as described
- c3 b9 G, H1 n4 J0 g# S5 s& S! z% G+ Kin the Invitrogen Platinum Taq polymerase instructions using the primer sets below. An MJ , a5 A# m4 J( @& a
themorcycler was used for the following two PCR reaction conditions:
7 H. E- M$ y' l% C$ m6 e* D*94°C 2 minutes [94°C 45” 56°C 45” 72°C 1’] X 35 cycles 72°C 15’
( |* A8 ^" I! K3 M# n6 \ y Tor
* ~& C9 O* ?8 o3 P8 V**94°C 2 minutes [94°C 45” 67°C 45” 72°C 1’] X 35 cycles 72°C 15’ - D- a/ H/ Q/ g/ n5 g7 t$ ]
PCR Primer Pairs $ t) V) T( j1 ~3 a% e! e
Primer Name Primer Sequence Product* s6 z( z3 r0 `! d
Size E; }5 u# n& D5 X8 e! J
Accession
3 l" [( C% |4 c( N0 g4 z& C/ bNumber3 `* c$ c4 B* l: g
*GAPDH FWD AGCCGCATCTTCTTTTGCGTC 815 bp NM_002046+ J* O7 i6 l8 z W" w' D
*GAPDH REV TCATATTTGGCAGGTTTTTCT5 ~$ y9 m& q# ? |5 U- c
PPARJ2 FWD GCTGTGCAGGAGATCACAGA 226 bp NM_005037
- m1 d- u& Z V* C( P" c, HPPARJ2 REV GGGCTCCATAAAGTCACCAA4 O! O) V: ~8 {1 A/ C8 n. z
Lipoprotein lipase FWD GTCCGTGGCTACCTGTCATT 212 bp NM_000237* T. n ]) u, t: H2 k
Lipoprotein lipase REV TGTCCCACCAGTTTGGTGTA
2 p* p0 R5 b' g) T5 F+ ?, t, lSox 9 FWD TTGAGCCTTAAAACGGTGCT 224 bp NM000346+ o) V7 g( f9 F7 h0 e; d# X
Sox 9 REV CTGGTGTTCTGAGAGGCACA
6 ^3 p' S2 G7 w9 [; \, sType X collagen FWD TGAGCAGCAACGTAAAAACG 471 bp NM_00049+ m6 k8 G/ F" y
Type X collagen REV AGGAAATGCCGAGTTTCTCA
/ G& f8 _2 P) O$ ~Statistical Analysis
: O, R" t" g4 wStatistical analysis was performed with the use of Instat software (GraphPad Software, San 0 B( U- L5 B$ q
Diego, CA, USA). All data were plotted as mean ± standard error of the mean (SEM), unless
6 z; h) y7 q f: [* y. v$ @$ }9 h3 aotherwise noted. Statistically significant differences were determined by two-tailed Student t
- L# `( }7 {* i% `3 ?! vtests, and statistical significance was defined as p < 0.05. |
|
发表于 2011-3-20 08:21
，脑子里也没有独家生产这个概念
，所以没理解。. c# F* m" `* R4 `7 l
, F7 w3 e( o0 o5 O0 ~1 f