|
 
- 积分
- 429
- 威望
- 429
- 包包
- 1768
|
本帖最后由 qianqianlaile 于 2011-3-22 22:26 编辑 5 \6 n& k% b) W* p5 y
! |3 a$ [' Z+ gMATERIALS AND METHODS - J* e- p0 e0 N+ X. Q- {
Isolation of Dental-Derived Stem Cells (PDLSCs, SHEDs)
2 Z1 Z( Q4 k( B+ O/ ^4 V6 TPDLSCs and SHEDs were harvested as previously described (Miura et. al, 2003; Seo et.
. R$ y: _5 X8 [8 Z+ a7 g& @: Mal, 2004). Briefly, PDLSCs were scraped from the root surface of a tooth into a p60 dish - r/ |. F: h* D Z
containing minimum essential alpha medium (DMEM, Gibco) and SHEDs were harvested by
! {7 S- {( [+ yscraping out the dental pulp tissue from a deciduous tooth into a p60 dish containing DMEM.7 x& v9 q* T. A t3 f+ L9 J; J
After collection, the cells were centrifuged at 1600 rpm for 5 minutes at room temperature. The
5 {! `9 ^, ?( W) qsupernatant was aspirated and the cells were resuspended in a phosphate buffered saline (PBS;
5 ^7 ]; H4 m( q+ ]5 W0 DGibco #14190) solution with 4 mg/ml Dispase II (Roche #04 942 078 001) and 2 mg/ml
- D6 B2 ~# Z# Q. z3 S& YCollagenase Type II (Worthington # LS004196) and incubated at 37°C for 60 minutes. The
" y) t+ h0 i) m# Q$ G* C2 Uenzyme solution was inactivated with 5 ml of DMEM- 15% FBS- 100µM ascorbic acid 2 7 y2 s( Q0 H$ W9 j! q' { J
phosphate (ASAP, Sigma A-8960) and centrifuged at 1600 rpm for 5 minutes at room7 \& e3 G* r% B7 h. {: I! ]8 R
temperature. Cells were resuspeneded in 5 ml DMEM- 15% FBS- 0.1mM ASAP and transferred
! E; ?. l1 E1 I& l' r' I7 b U5 R. @to T-25 flasks. Media was changed the next day and then every 2-3 days. $ u4 f o8 U9 [3 o
Cell Culture) o9 m. R0 q+ u5 @5 Q( r; R \9 ~
Cells were expanded in culture in DMEM, Iscove’s modified Dulbecco’s media (IMDM,
# f* r0 j* F6 v$ s7 @5 O2 DGibco-Invitrogen #12571), Gibco Stem Pro Mesenchymal Stem Cell Serum-Free Media 1 }' t+ V2 P1 K( L6 `) a( |% E) w
(MSCSFM; Invitrogen# A1033401) or Lonza Therapeak Mesenchymal Stem Cell Growth
/ o: P u6 O4 [# @* Q2 g& y5 lMedia- Chemically Defined (MSCGM-CD; Lonza #00190632) and grown in a 37°C humidified9 W6 ` j# |" n9 Z) H
tissue culture incubator at 5% CO2. Media formulations are as follows: DMem (Gibco-
# i8 o' u4 e3 I" e N6 F% ?Invitrogen #12571) with 15% FBS (Gibco-Invitrogen-16000), 100µM ASAP and 5 µg/ml
- a1 U9 ?2 b& w% {Gentamicin (Invitrogen # 15750060) (FBS-M); DMem with 2% bovine serum albumin (BSA;
+ P1 D% A& T' Z' Q/ R! ?* G6 ?Sigma A7888), 10ug/ml human insulin (Sigma), 4ug/ml low density lipoprotein, 200ug/ml$ z8 c" f( _) e$ I8 l# i
transferrin, 10 nM dexamethasone, 100 uM ASAP, 50 uM ȕ-mercaptoethanol, 5 ug/ml+ d1 x; ?$ N- L+ P: q3 J1 A$ h
gentamicin, 10ng/ml platelet-derived growth factor (PDGF; Sigma), 10ng/ml epidermal growth 8 m0 u. g. Y7 J* [
factor (EGF; R&D Systems), 10ng/ml basic fibroblast growth factor (b-FGF, Sigma) (SDM);
2 ?4 t, ?' p$ B9 rIMDM with 0.2% BSA, SITE 3 (Sigma #S5295), 384µM ASAP, 10 ng/ml PDGF, 10ng/ml- Q( b2 ]- R3 c, M/ T) p3 P# h
hydrocortisone 5ng/ml b-FGF, 1 ng/ml EGF, 10-7
4 a. f$ o: ^; f5 S- }9 G- T# ?3 k. l mgm/ml parathyroid hormone (PTH) and 5 5 |0 g; `( u0 a! [: f
µg/ml gentamicin (K-M). Media on the cells were changed every 2 or 3 days. Cells were grown
# X5 { Y* k F( [& F. min T-150 flasks to about 80% confluency then media was aspirated from the flasks, cells were & m: z5 j/ l5 }3 V$ p! o
washed with PBS and trypsinized with TrypLE Express (Gibco#12605) before being split into 12- F# P6 g. i' J( Y: F
well plates for the assays.
' `* r6 M; t6 }$ f1 eFibronectin Coating of Tissue Culture Plates
/ k7 _: p3 X t: k) T5 u3 WFibronectin (FN) was coated on the plates and flasks to provide growth and attachment
# D; f% V6 z3 O8 R3 Esupport for cells grown in the serum-free, IMDM media. For the 12 well plates, 0.1% FN
6 X- G! h/ {' ssolution (Sigma F-1141) was diluted in PBS so that each well received 3.8 micrograms per well
: D$ T3 S9 Z3 W t! n(1µg FN/cm2). The T-150 flasks were coated so that each received 150 micrograms of FN (1µg
- A0 ]4 }/ R+ W* O. ~- @$ Z# PFN /cm2). The plates and flasks were tilted back and forth to ensure complete coverage of the
0 c* V* r% q u) g# `: h6 r" q& OFN solution. The FN coating was allowed to stand at room temperature for 90 minutes. The FN
$ m5 P0 Y* ?( w J4 v3 M. k, J8 D3 bsolution was then aspirated before the resuspended cells were transferred to the flasks and plates.: f6 G7 U; U9 l- q
Proliferation Assays
: h$ v% V5 d8 \0 D) T$ uAfter trypsinization cells were resuspended in an equal amount of the appropriate media2 }; V- v) n# R0 Q+ r3 E+ @
before an aliquot was removed for counting on a hemocytometer to determine the concentration.
" S1 n: G$ \" y) t2 LThe cells were then centrifuged at ~1600 rpm for 5 minutes at room temperature. Cells were
& R6 t: c0 `7 i- @6 }: K* b* Oresuspended in the appropriate media at a concentration of 3800 cells per ml. One milliliter of 5 ~. x2 x( n l+ T4 ^4 `% `
cells was dispensed into each well of a 12 well plate. K-M plates were precoated with FN
1 j! l7 G6 }$ O" C5 V9 }1 o, hsolution (as outlined above). Four plates for each cell type and media condition were plated and : D4 X& O. g/ ]
counted on a hemocytometer at days 1, 3, 5 and 7 to determine the cell numbers within each
/ w u$ W7 U4 Wwell. All experiments were performed in triplicate.
# x5 O5 S9 q4 V9 d kRNA Isolation and Purification for MicroArray 2 n9 @2 R) [: _4 w
PDLSCs and SHEDs were grown in T-75 flasks to 80% confluency before the cells were ( Y. r0 K& T9 D; j" _2 L* k* X
harvested for RNA. The Trizol method (Invitrogen) was used for RNA isolation. This involved 2 t6 q' {& `0 v
washing the cell layer with PBS, adding Trizol directly to the cells and transferring this cell - Y) m" W- z$ c8 z$ z
suspension to polypropylene tubes. RNA was isolated from the cells by a Trizol-choloroform+ l2 x5 l2 N0 y
extraction, isopropanol precipitation, an ethanol rinse and resuspension of theRNA pellet in , J8 W: Q4 B" O# N8 R2 r- M( F& C+ E2 ~
Diethylpyrocarbonate (DEPC) water. The RNA was further purified by column
0 b% p7 K2 |) p2 r" j, j0 lchromatography, following manufacturer’s instructions (Qiagen RNeasy Kit # 74104), and 8 n) k e5 Y/ ^; d$ L9 J! B }6 @4 d1 @
resuspended in DEPC water. RNA concentration was determined by the 260/280 absorbance 9 M. A" W+ T# C- l3 W0 m/ R+ [
measurement using a Beckman DU540 spectrophotometer.* w! }5 P7 f$ L& m
In Vitro Multilineage Differentiation
* @+ V. G- C% t2 D3 ?7 ?( ], XMultipotency of PDLSCs and SHEDs was determined through lineage specific
1 C& v# \5 H0 E9 k2 }osteogenic, chondrogenic, and adipogenic induction, according to previously described methods
% i& `& t0 u2 Y; o3 x- P(Pittenger et. al, 1999). Briefly, cells were plated at a density of 30,000 cells per well in 12 well 0 L* Y, F$ a$ R/ K
plates. At 80% confluency cells were induced with osteogenic [Growth media plus 5mM E-9 R7 k' F6 s- x. Q n( }
glycerophosphate, 100nM dexamethasone, 50µM ascorbic acid 2-phosphate] or chondrogenic
; E% |- s* L. s- d) ]8 N0 a7 I. B[growth media plus 50µM ascorbic acid 2-phosphate, 100nM dexamethasone, 5 µg/ml human
) i3 |; t7 l3 T# ?- b$ Sinsulin (Sigma I-9278), 1 ng/ml TGFE, 400µM proline, 1X Non essential amino acids] or , d8 S6 F1 E% ~, y3 Z/ N
adipogenic [growth media plus 0.5mM IBMX, 1 µM dexamethasone, 10 µg/ml human insulin, + o; B: F1 B N# B7 e
200µM indomethacin] induction media. Cells were grown at 37°C in a humidified 5% CO2
4 z+ t$ o1 O+ B. H# T: [6 Oincubator. The media was changed every 2-3 days. At three weeks the cells were fixed and
4 t4 P3 C9 L, {" Y; q$ M$ cstained as outlined below. ! W: w9 o$ ?) v3 w1 l
Multipotent Staining of PDLSCs and SHEDs ; j B! m8 B4 y1 h
To identify the mineralized nodules, induced PDLSC, SHED and DPSC were fixed in 4% 7 d1 |" z# j: `0 h7 y! x/ I
paraformaldehyde for 30 minutes, immersed in fresh 5% silver nitrate and incubated in the dark
8 w$ Z. o- S; B+ sfor 30 minutes. After washing in water the PDLSC, SHED and DPSC were exposed to 5 @3 B/ s$ i6 [* B7 V$ N ] g+ y
ultraviolet light for 30 minutes followed by a four minute incubation in 1% sodium thiosulfate to , |' K! z. h+ s6 j+ R
neutralize the silver nitrate. Cells were washed twice with water before 1 ml of PBS was added
+ k, K# a' s% {- j/ n+ ~to each well and viewed. Plates were stored at 4°C.
& |, V9 w& `! s! NTo detect chondrogenic differentiation induced PDLSC, SHED and DPSC were fixed in . T" y$ y* T8 S' \
cold 100% methanol for 30 minutes and then exposed to 1% alcian blue in 0.1N HCl for 30 ; B m: |! W1 M6 T- i5 R" {2 q
minutes. Cells were washed twice with 0.1N HCl before 1 ml of PBS was added to each well
$ g& v: c2 r& g# jand viewed. Plates were stored at 4°C.
# \/ B) J' l$ |) k3 p$ nTo detect adipogenic differentiation by identifying lipid vesicles, induced PDLSC, SHED : n& t- u0 `, [0 R
and DPSC were fixed in 4% paraformaldehyde for 30 minutes, and then immersed in 0.3% oil
) h' H4 ?. D9 Jred O solution for 30 minutes. Cells were washed twice with water before 1 ml of PBS was 8 V# O6 Z0 Y3 }' i
added to each well and viewed. Plates were stored at 4°C. , A: j$ i+ }5 l3 J, O! t/ e2 x
Alkaline Phosphatase Activity and Detection8 N" k) K. x, P2 e& q( a" O
Early osteogenic differentiation was detected and quantified by the alkaline phosphatase
$ d1 O3 M( K* E& \* e8 Z(ALP) enzyme assay. Cells were plated at a density of 30,000 cells per well in 12 well plates.
8 o4 I$ v( f' T( k$ ~; sAt 80% confluence, cells were induced with osteogenic media as described above. The media
, L0 C4 B) S" `% ~; J* hwas changed every 2-3 days and after one week, ALP activity was measured.
H4 J5 I# {4 o# ~" NTo detect phosphatase activity, PDLSCs and SHEDs were fixed in 70% ethanol for 30 2 {8 V, v( S8 v; D( u
minutes. They were then incubated with freshly made substrate containing naphthol AS-TR
8 i1 K! s+ @ e/ h8 s9 x tphosphate (Sigma) and Fast blue (Sigma) for 30 minutes. Cells were washed twice with PBS then , b) q1 T4 m# S! [9 K+ F5 s* T
viewed or stored at 4’C.
$ b& }) ]2 O! t. TTo quantify the ALP activity and normalize the results, cells were lysed in Passive Lysis ! ~9 r# a8 ]1 C. x- `" V
Buffer (Promega) according to manufacturer’s instructions. Cell lysates were then sonicated, - n- d7 @& M9 c; X
and centrifuged (10,000 rpm for 10 minutes at 4°C). The supernatant was recovered for the
# y6 ~# a7 u3 [% d4 s! Hquantitative colormetric ALP assay (Manolagas et al., 1981) and the cell pellet was used for 2 G. ?) w' A6 O3 B0 y$ c
DNA isolation and the determination of the DNA concentration using the Quant-iT™ dsDNA
. u) B, u2 v) I7 r r4 fBR Assay (Invitrogen) per the manufacturer’s instructions. & B; e) a$ Y# @2 i4 g+ X. N0 W
Reverse Transcriptase Polymerase Chain Reaction (RT-PCR)
/ b- ]! o" B0 u N- t3 e7 yTo confirm chondrogenic and adipogenic differentiation, total PDLSC and SHED cellular
' |, I& Q& ]2 xRNA was extracted, reverse transcribed, and amplified using osteoblast specific gene primers.& M/ L' H, U; ^2 Z2 a' _5 L1 m" \
Media from the wells of induced and uninduced PDLSCs and SHEDs were aspirated. Cells
( x: B: I- {5 P& _* K' f) O" \$ Swere immediately resuspended in 1 ml of Trizol (Invitrogen) and RNA was isolated according to
+ o: r6 U _! v7 Pthe manufacturer’s instructions. Synthesis of cDNA was performed using Invitrogen’s ) }$ H8 ~% k m: j
SuperScriptII kit and oligo dT. PCR reaction components and concentrations were as described - E/ w7 q+ J L& Z
in the Invitrogen Platinum Taq polymerase instructions using the primer sets below. An MJ 3 |) r- @$ X& N* D" I; f
themorcycler was used for the following two PCR reaction conditions: - T9 @/ q' M( ?9 q" ]2 {6 w6 s
*94°C 2 minutes [94°C 45” 56°C 45” 72°C 1’] X 35 cycles 72°C 15’
& O9 P& i2 ^; w. s# q4 ?. jor
7 X' F0 s" }5 Q: {# Y6 a**94°C 2 minutes [94°C 45” 67°C 45” 72°C 1’] X 35 cycles 72°C 15’ + g$ g& u* ]: d% h
PCR Primer Pairs
8 N3 G& ]' o7 U( RPrimer Name Primer Sequence Product$ O+ `0 G3 t7 h0 I' o0 r( p
Size
* ]" d i; d1 i/ ]/ qAccession$ c( q* k! x @# R
Number8 R8 Y( g1 A% \' w5 `7 O
*GAPDH FWD AGCCGCATCTTCTTTTGCGTC 815 bp NM_002046, p/ |: `4 A$ L P( I0 a
*GAPDH REV TCATATTTGGCAGGTTTTTCT# W% O" P+ r% T4 o; _. ?
PPARJ2 FWD GCTGTGCAGGAGATCACAGA 226 bp NM_005037! t: |0 v! l+ Z) e: v. U& d4 b
PPARJ2 REV GGGCTCCATAAAGTCACCAA
, c1 V+ E6 x' F( ^7 q6 kLipoprotein lipase FWD GTCCGTGGCTACCTGTCATT 212 bp NM_000237% J5 U" _2 }2 |. e" [$ E9 Z
Lipoprotein lipase REV TGTCCCACCAGTTTGGTGTA+ R4 P- D# h. E3 S5 g
Sox 9 FWD TTGAGCCTTAAAACGGTGCT 224 bp NM0003464 H+ M [ l1 d5 y$ x m- |# u
Sox 9 REV CTGGTGTTCTGAGAGGCACA
) I7 \8 f# U5 E1 J+ DType X collagen FWD TGAGCAGCAACGTAAAAACG 471 bp NM_00049
) O7 m b9 W( f3 f; X4 c" dType X collagen REV AGGAAATGCCGAGTTTCTCA/ C+ p( |& N8 }' m' F6 Y
Statistical Analysis - ]- B! {# ?$ D/ ~4 Z4 ]
Statistical analysis was performed with the use of Instat software (GraphPad Software, San 7 s% p9 t! L' R; q6 R8 ?% B
Diego, CA, USA). All data were plotted as mean ± standard error of the mean (SEM), unless - m0 K7 Z7 E2 E2 y: }
otherwise noted. Statistically significant differences were determined by two-tailed Student t9 J$ E# k$ o+ v: E
tests, and statistical significance was defined as p < 0.05. |
|
发表于 2011-3-20 08:21
，脑子里也没有独家生产这个概念
，所以没理解。; |/ N8 f) S1 M" I1 I- L' C